ID: 1184636017

View in Genome Browser
Species Human (GRCh38)
Location 22:45832229-45832251
Sequence CTAAGAATCCCTGAAGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184636017 Original CRISPR CTAAGAATCCCTGAAGGAGC TGG Intronic
900962870 1:5936931-5936953 GCAAGCATCCCTGTAGGAGCAGG + Intronic
903134394 1:21300011-21300033 CTTAGAACCCCTGAGGGAGCTGG - Intronic
904082262 1:27879675-27879697 CTATGAAACCCTGGAGGAGCTGG + Exonic
906055753 1:42915500-42915522 CTAAGCTTCCCTGTAGGAGAAGG + Intergenic
907505004 1:54911710-54911732 CTAAGAATCCCTAAGCTAGCTGG - Intergenic
907907986 1:58801636-58801658 ATAAGTATCCGTGAATGAGCAGG - Intergenic
907976009 1:59432116-59432138 CTAAAAATCCCTGAAAGATGGGG + Intronic
908873681 1:68645299-68645321 ATCAGAAGCCCTGAAGTAGCTGG - Intergenic
911984097 1:104599984-104600006 GTAAGTATAGCTGAAGGAGCCGG - Intergenic
912519915 1:110238216-110238238 CTAGGGATCCCTGGAGAAGCAGG - Intronic
912729968 1:112093460-112093482 CCAAGTGTCCCTGAAGGGGCTGG + Intergenic
915250567 1:154585345-154585367 CTAGGAATCCCAGAAGCAACGGG + Intronic
915832251 1:159141909-159141931 CTCAGAATCCCTGATGGAACAGG + Intronic
919940277 1:202281590-202281612 CTCAGCATCCATGAGGGAGCTGG + Intronic
920917555 1:210270235-210270257 GAAAGAATCCATGAAGGTGCAGG - Intergenic
921108928 1:212014166-212014188 ATAAGAATAGCTGAAGGGGCCGG + Intronic
922205960 1:223446787-223446809 CTAAAAATCCCTGAAGAAAAAGG + Intergenic
922309803 1:224377810-224377832 CTAAGAATATCTGAATGAGAAGG - Exonic
922363310 1:224842394-224842416 GTAAGTATAGCTGAAGGAGCTGG + Intergenic
924038490 1:239959567-239959589 ATTAGAGTCCCTGAAGGAGATGG - Intergenic
1063864865 10:10353072-10353094 CTGAGAATTCCTGAAGTGGCGGG - Intergenic
1064425585 10:15226417-15226439 CTAAGAATCCATTAAAGAGGGGG - Intronic
1064552515 10:16519246-16519268 CTAAGAATCTCTGAATGTCCAGG + Intronic
1064717530 10:18192209-18192231 CAAAGAATCCTTGAAGGTTCAGG - Intronic
1064897880 10:20259781-20259803 GTAAGAATTTCTGAAGGGGCTGG + Intronic
1065592608 10:27280600-27280622 CTCAGAATCCCTGCAGGAGAAGG - Intergenic
1065657758 10:27969694-27969716 CCCAGAATCCCTGCAGGAGAAGG + Intronic
1071550559 10:86563328-86563350 CTGAGTATAGCTGAAGGAGCTGG + Intergenic
1073343094 10:102760765-102760787 CTAAGACTCCCCAAACGAGCGGG - Intronic
1073767396 10:106698163-106698185 CTAAGAACCTCTGAACGAGAAGG + Intronic
1074151739 10:110765425-110765447 CTGAGCACCCCTGAAGTAGCTGG + Intronic
1074272062 10:111963883-111963905 CTGTGACTCCATGAAGGAGCCGG - Intergenic
1076784818 10:132744529-132744551 CTGAGACCCCCTAAAGGAGCCGG - Intronic
1077066469 11:643162-643184 CTAAAAATCCCTAAACTAGCTGG + Intergenic
1077688279 11:4317845-4317867 GTGAGTATCGCTGAAGGAGCCGG + Intergenic
1079510740 11:21206785-21206807 CTGAGACTCCCTGAAGGAGAGGG + Intronic
1079720853 11:23812073-23812095 CTATTAGTCCCTGAATGAGCAGG + Intergenic
1080237564 11:30089535-30089557 ACAAGAACCCCAGAAGGAGCAGG - Intergenic
1081567593 11:44269658-44269680 CTAGGAATCCCTGGAGGAAAAGG - Intronic
1086042765 11:82498842-82498864 ATAAGAAATACTGAAGGAGCTGG + Intergenic
1086582328 11:88413451-88413473 CTATGAATCTCTGGAGGATCTGG - Intergenic
1088713701 11:112530197-112530219 CTGACACTCCCTGAAAGAGCTGG + Intergenic
1088841237 11:113629281-113629303 CCAAGAACCCCTGAAGAGGCTGG + Intergenic
1088969973 11:114764993-114765015 AGAAAAATCCCAGAAGGAGCAGG - Intergenic
1089031683 11:115337154-115337176 CTGAAAAACCCTGAAAGAGCCGG - Intronic
1089052556 11:115558349-115558371 CTAAGCAGCCCTGTAGGAACTGG + Intergenic
1089259871 11:117216955-117216977 CAAAAAATCCCCCAAGGAGCTGG + Intronic
1089259988 11:117217748-117217770 AAAAGAATCCCCCAAGGAGCTGG + Intronic
1090591744 11:128278480-128278502 CTCAGAGTCCCAGAAGGAGAGGG - Intergenic
1101160124 12:101964924-101964946 TTAAGAATCACTGATGAAGCTGG + Intronic
1101964651 12:109274215-109274237 CTCAGAATCCCAGATGGATCTGG + Intergenic
1103061701 12:117863579-117863601 CCAAGACTCCCTCAAGGAGGTGG - Intronic
1103153691 12:118664505-118664527 CTAAGAACCTCTGAAGGGGATGG - Intergenic
1103607209 12:122096237-122096259 CTAAGAAACACTGCAGAAGCCGG - Intronic
1106953889 13:34914304-34914326 CTGAGAATCTCTAAAGTAGCAGG + Intergenic
1107611369 13:42116598-42116620 CTAAGAATCCTTGAAAAATCAGG - Intronic
1107978321 13:45711601-45711623 CCAGGAACACCTGAAGGAGCTGG + Intronic
1112312605 13:98332553-98332575 CTAAGAATTCTTAAAGGATCCGG + Intronic
1112590590 13:100760498-100760520 CTCAGCATCCCTGAAGGAGAGGG - Intergenic
1113584500 13:111455462-111455484 CTAAGACTTCCTCAAGAAGCCGG + Intergenic
1114070967 14:19106518-19106540 CTAAGACTCCCTGAAGGCGCAGG - Intergenic
1114091296 14:19293487-19293509 CTAAGACTCTCTGAAGGCTCAGG + Intergenic
1115522143 14:34243637-34243659 CCAATAAAACCTGAAGGAGCTGG - Intronic
1118501705 14:66368312-66368334 CCAAGAATGCCAGAAGCAGCAGG + Intergenic
1123171717 14:106378740-106378762 CTGAGAATACCTGCAGGTGCAGG + Intergenic
1124841416 15:33245341-33245363 GGAGGAATCCCTGAGGGAGCTGG - Intergenic
1126844032 15:52742732-52742754 GTGAGAATAGCTGAAGGAGCCGG - Intergenic
1127707902 15:61565442-61565464 CTAAGAATGATTGAGGGAGCAGG - Intergenic
1128320619 15:66691487-66691509 GTAAGAATCCCTTCAGGAGAGGG + Intergenic
1130702831 15:86202701-86202723 CTGAGAATCCAGAAAGGAGCTGG + Intronic
1131729353 15:95262824-95262846 TTAAGAAACCCAGAAGGAACGGG - Intergenic
1131877910 15:96830428-96830450 CTGAGAATGCCTGAAGAAGCTGG + Intergenic
1132605074 16:790236-790258 CTTAGCCTCCCTGAAGAAGCAGG + Exonic
1133140531 16:3740550-3740572 CTAGGAAGTCCAGAAGGAGCAGG + Intronic
1135025180 16:18994148-18994170 CTGAGTATACCTGAAGGAGCTGG + Intronic
1135236258 16:20759259-20759281 CTAAGAAACCCAAAAGGGGCTGG + Intronic
1136864783 16:33738381-33738403 CTTAGAATCCCTCAAGGACTAGG - Intergenic
1137696441 16:50465119-50465141 CTGAGAGTCCCTGCAGGATCAGG + Intergenic
1138084561 16:54121971-54121993 CTAAGAATCCTGGAGTGAGCTGG + Intergenic
1138343529 16:56306396-56306418 GGAGGAAACCCTGAAGGAGCGGG - Intronic
1140997422 16:80274751-80274773 CGAAGAATCCCTGAGTGGGCTGG + Intergenic
1203126280 16_KI270728v1_random:1586517-1586539 CTTAGAATCCCTCAAGGACTAGG - Intergenic
1143145682 17:4773659-4773681 CCAAGAATCCATGCAGGAGGAGG - Intronic
1143503085 17:7350238-7350260 GTAAGAATGCCTGAAGGGGCGGG + Intronic
1144783180 17:17817899-17817921 CACAGAATCTCTGAAGGATCTGG - Exonic
1145080441 17:19890549-19890571 CTGAGCATAGCTGAAGGAGCTGG + Intergenic
1145832772 17:27930524-27930546 CACAGAATCTCTGGAGGAGCGGG + Intergenic
1148874364 17:50677967-50677989 CTGGGAATTCCTGGAGGAGCAGG - Intronic
1150315762 17:64167520-64167542 GTAAGAATCCCTGTTTGAGCTGG + Intronic
1151831404 17:76554252-76554274 ATCAGAATTCCTGAATGAGCCGG - Intergenic
1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG + Intronic
1155962224 18:32004229-32004251 CTGAGTATAGCTGAAGGAGCTGG - Intergenic
1159912792 18:74162247-74162269 GGAAGAAGCCCTGAAGGAGAAGG + Intergenic
1162420045 19:10561002-10561024 CCCAGATTCCCTGAAGGAACTGG - Exonic
1162458875 19:10802652-10802674 CTGAGAAGTCCTGAAGGAGAGGG - Intronic
1162953155 19:14083744-14083766 CTATGGACCCCTGCAGGAGCTGG - Exonic
1165843275 19:38802222-38802244 CTCTGAATCCCTAAAGGAGGAGG + Intronic
1168140264 19:54381209-54381231 CCAAGAAGACCTGAAGGAGAAGG - Intergenic
1168408921 19:56126383-56126405 CTAAGAATCCCTTGAGGATTGGG - Intergenic
925969614 2:9097109-9097131 CCCATTATCCCTGAAGGAGCGGG + Intergenic
927105087 2:19817335-19817357 CGAATGATCCCTGTAGGAGCTGG + Intergenic
930541316 2:52710487-52710509 CGCATAATGCCTGAAGGAGCAGG + Intergenic
932509409 2:72270278-72270300 CTAAGAAGCCTGGAAGGAGTAGG + Intronic
932876539 2:75458222-75458244 CTAAGCAAGTCTGAAGGAGCAGG + Intergenic
934800193 2:97148079-97148101 CTTAGAATCCCTCAAGAACCAGG + Intronic
936271470 2:111052669-111052691 CTAAGAATCAGTGAAGAAACAGG - Intronic
944037693 2:195315468-195315490 CTAACAGTCCCTGAAAGAGCAGG - Intergenic
947369727 2:229432711-229432733 CTTAGAGTCCCTGAATCAGCGGG - Intronic
947583478 2:231336684-231336706 CTAAGAATCCCCGAAAGGGCTGG + Intronic
948315961 2:237028664-237028686 CTAAGAAGCCCTTAAGAACCTGG + Intergenic
1169200271 20:3705939-3705961 CTACGTATGCCTGCAGGAGCAGG - Exonic
1171162161 20:22937342-22937364 CTAAGGATCCAAGAAGAAGCAGG - Intergenic
1173216239 20:41087187-41087209 CAAAGAAACCCTGAGGGACCTGG - Intronic
1173386499 20:42593175-42593197 CTCAGAATCACTGGAGGAGCAGG + Intronic
1175110792 20:56646521-56646543 CTAAAAATACATGAAGGGGCAGG - Intergenic
1175424528 20:58855212-58855234 CAAAGAAGCCCTGGAGAAGCGGG + Exonic
1175742284 20:61428133-61428155 TTAAGAATCCCAGAAGCAGAAGG - Intronic
1178715541 21:34960731-34960753 CCAAGAATCCCTTATGGTGCTGG + Intronic
1179727521 21:43348615-43348637 TTGAGAGTCCTTGAAGGAGCCGG - Intergenic
1180489433 22:15828984-15829006 CTAAGACTCCCTGAAGGCTCAGG - Intergenic
1184636017 22:45832229-45832251 CTAAGAATCCCTGAAGGAGCTGG + Intronic
1185107678 22:48883540-48883562 TGAAGCATCCCTGAAGAAGCAGG - Intergenic
1185194119 22:49457909-49457931 CTAAGAAGCCCTGGAGGACATGG + Intronic
951574569 3:24100633-24100655 CCCAGAATCCCTGCAGGGGCTGG + Intergenic
955192656 3:56775920-56775942 CAAAGATTCCCTGAGGGAGCAGG + Intronic
956354022 3:68370810-68370832 CTCATAATCCCTGAATGAGCTGG + Intronic
956430375 3:69180302-69180324 GTAAGAATCCTTATAGGAGCTGG - Intronic
956953329 3:74308095-74308117 GTAAGACTCCCGGAAGGAACAGG + Intronic
957616046 3:82528870-82528892 CTAAAAATCCCAAAAGTAGCTGG - Intergenic
959083684 3:101829048-101829070 CGCATAATCCCTGATGGAGCAGG + Intronic
959220909 3:103518239-103518261 TTAAAACTCCCTGAAGGATCTGG - Intergenic
961839186 3:129694480-129694502 CTAAGAATACCTGAAGTTGCTGG - Intronic
963478106 3:145832317-145832339 CTATCAATTCCTGAAGGAGCTGG - Intergenic
963497047 3:146077964-146077986 CAAAGAATACCTGAGAGAGCGGG - Intronic
966259023 3:177953212-177953234 GTAAGAACCCCTGAAAGAACAGG + Intergenic
968412984 4:405296-405318 CTGAGTATAGCTGAAGGAGCTGG + Intergenic
969370229 4:6727286-6727308 CTAAGAAGGCCCCAAGGAGCAGG - Intergenic
970566673 4:17338335-17338357 TTAAGCATCCCTTGAGGAGCTGG + Intergenic
971483804 4:27139401-27139423 CTAAGAATGCCTGAGAAAGCAGG + Intergenic
974708772 4:65559740-65559762 CTAAGGGTCCCTGAAGTTGCTGG - Intronic
976938632 4:90671903-90671925 CTAAGACTCTCTGATGGAGATGG - Intronic
978177892 4:105756221-105756243 ATAAAAATCCCTGAAGCAGGGGG - Intronic
979356206 4:119708741-119708763 CCAGGGATCACTGAAGGAGCAGG - Intergenic
982066957 4:151662661-151662683 CCCAGAGTTCCTGAAGGAGCTGG + Exonic
983371819 4:166869709-166869731 CTAAGAAAACCTGAAGAAACTGG + Intronic
984226559 4:177042404-177042426 CTAAGAATTCATTAAGGACCAGG - Intergenic
984308721 4:178029319-178029341 CTAAGATTTCCCTAAGGAGCCGG - Intergenic
986058113 5:4159787-4159809 CTGCGAATCCCTGAGGAAGCAGG + Intergenic
986982604 5:13466525-13466547 GCAATAAACCCTGAAGGAGCAGG + Intergenic
990888827 5:60625700-60625722 ATTGGAATCCCTGAAGGAGGAGG - Intronic
990984732 5:61630921-61630943 CTAAGAAGCACTGAGGGAGTGGG + Intergenic
991280654 5:64909767-64909789 CTTAAATGCCCTGAAGGAGCTGG - Intronic
992275454 5:75112512-75112534 ATAAGAAACCCTGAAGATGCAGG - Exonic
993091755 5:83434869-83434891 CTACAAATCCCTGAAGGGGCTGG + Intergenic
995727737 5:115200082-115200104 CTAAGAACCCCAGATGGAGAAGG - Intergenic
998175470 5:139899219-139899241 TTAAGAATCACTGATTGAGCTGG - Intronic
999689674 5:154135942-154135964 TTCAGACTCACTGAAGGAGCTGG - Intronic
999830556 5:155315049-155315071 CTCAGAAGACCTGAAAGAGCTGG + Intergenic
1000126053 5:158245147-158245169 CAAAGAATCCATGAAAGAGAGGG - Intergenic
1000690185 5:164307948-164307970 CTAAGAATCTGTGAAGGGCCTGG - Intergenic
1000849942 5:166327896-166327918 CTACGAATCCCTGAAGCTGTTGG - Intergenic
1001380372 5:171302286-171302308 TTGAGCATCCCTGAAGCAGCTGG - Intergenic
1001588443 5:172849364-172849386 CTAAGAATCACTGAAGACACTGG - Intronic
1001966064 5:175910763-175910785 CTAAGGCTCCCTGCGGGAGCTGG + Intergenic
1002250882 5:177928439-177928461 CTAAGGCTCCCTGCGGGAGCTGG - Intergenic
1002455224 5:179342404-179342426 GTAAATATCCCTGGAGGAGCTGG - Intronic
1005411137 6:25548149-25548171 ATAAAAATCCCTGAAGTATCTGG - Intronic
1005787401 6:29259912-29259934 CTAATCATCCCTGAAGAAGGGGG - Intergenic
1010098451 6:72075032-72075054 CTGATCATCCCTGAAGTAGCTGG + Intronic
1011400730 6:86958675-86958697 CTATAAAACTCTGAAGGAGCAGG + Intronic
1011558263 6:88590881-88590903 CTCAGAACCCCTGAAGTATCTGG + Intergenic
1013777496 6:113694584-113694606 CTAAGAATTCCAGAATGAGCTGG + Intergenic
1013777701 6:113696799-113696821 CTAAGAATTCCAGAATGAGCTGG - Intergenic
1014689564 6:124546456-124546478 CTAAGCATCTCTGAAGCAGGAGG - Intronic
1015630640 6:135228767-135228789 TTAAGAATCACTGAGGTAGCTGG - Intergenic
1016352745 6:143185279-143185301 CTCAGTATCCCTCAAGGACCAGG - Intronic
1017474497 6:154774908-154774930 CTAAGATTCCCTGAATTAGTAGG + Intronic
1017886136 6:158600840-158600862 CTCAGACTCCCTGGAGGAGGGGG - Intronic
1017931128 6:158956698-158956720 CAAAGAACCCATGAGGGAGCTGG + Intergenic
1018427664 6:163698171-163698193 CTAAGAGTCCTAGAAGCAGCTGG - Intergenic
1018852168 6:167648604-167648626 CTAAGAATCCCTTCAGGGCCTGG + Intergenic
1021153975 7:17186605-17186627 CTAAGAATCTGTGACAGAGCTGG - Intergenic
1022701144 7:32761780-32761802 CTTATAATCCCTGGCGGAGCTGG + Intergenic
1023736407 7:43239782-43239804 CTAAGAAGCCCTGGAGTGGCTGG - Intronic
1024571282 7:50724698-50724720 GGAAGGATGCCTGAAGGAGCTGG + Intronic
1028120511 7:87052050-87052072 CTAAGACACCCTGCAGAAGCAGG + Intronic
1031400206 7:121319334-121319356 GTGAGTATACCTGAAGGAGCCGG - Intergenic
1032322324 7:130896685-130896707 CGAGGAATCCCTGGAGGAGGTGG + Intergenic
1034738224 7:153448888-153448910 CCAAGAAACCCTGGAGGATCTGG - Intergenic
1034944819 7:155255070-155255092 CGCAGCATCCCTGAAGGAACGGG - Intergenic
1036813507 8:11884529-11884551 CAGAGACTCCCTCAAGGAGCTGG + Intergenic
1038023768 8:23571492-23571514 CTATGAGTTCCTGCAGGAGCAGG + Exonic
1039196789 8:35041041-35041063 CTCAGAAATCCTGAAGGAGGAGG - Intergenic
1040616658 8:49044346-49044368 CTCACACTCCCTGAAGGGGCAGG + Intergenic
1040944730 8:52872739-52872761 ATAAAAATGCCTTAAGGAGCTGG - Intergenic
1043564294 8:81531243-81531265 CGAAGACTACATGAAGGAGCTGG - Exonic
1044524386 8:93235379-93235401 ATTAGATTACCTGAAGGAGCTGG + Intergenic
1045549106 8:103154346-103154368 CTAGCAATCCATGAAGGGGCTGG - Intronic
1047264763 8:123295548-123295570 CTATAAATCCCTGGAAGAGCTGG - Intergenic
1047366464 8:124216177-124216199 CAAAGAATGCCTACAGGAGCTGG - Intergenic
1049318937 8:141985662-141985684 CTCAGAAGCCCTCAAGGAGGTGG - Intergenic
1050513749 9:6420588-6420610 CTCAGCCTCCCTGAAGTAGCTGG - Intronic
1051604216 9:18904879-18904901 TTAAGAACCACTGAAAGAGCAGG - Intronic
1057569841 9:96196230-96196252 GTAAGAATCCCAGAGGGACCAGG + Intergenic
1057919500 9:99085251-99085273 ATAGGGATCCCTGAGGGAGCTGG - Intergenic
1057987982 9:99736985-99737007 CAAAGAATCATTGAAGGAACTGG - Intergenic
1058544413 9:106044677-106044699 CTAAGAATCCTGGAAGAATCTGG - Intergenic
1058903845 9:109465278-109465300 CAAAGAATACATGAAGCAGCCGG + Intronic
1060980166 9:127786848-127786870 CTGAGACTCCCAGAAGCAGCAGG - Intronic
1061154095 9:128846723-128846745 CTCAGAATCCCTTCAGCAGCAGG + Intronic
1061619109 9:131799451-131799473 CTCAGAATTCCTGAAGGAGTGGG - Intergenic
1187303849 X:18077369-18077391 TGAAGAGTCCCTGAAGGAGCAGG + Intergenic
1188315487 X:28668175-28668197 ATAAAAATTCATGAAGGAGCAGG + Intronic
1189491106 X:41472482-41472504 CTTGGAATCCCAGAAGCAGCGGG - Intronic
1190837740 X:54116776-54116798 TTAAGGATCACTGAAGGAACTGG + Exonic
1193041990 X:77013890-77013912 CAAAGAATGCCTTCAGGAGCTGG + Intergenic
1193305306 X:79943673-79943695 ATCAGAATCCCTGAAAGAGAGGG - Intergenic
1195279638 X:103318523-103318545 CTAAAACTCTCTGAAGGAGAGGG + Intergenic
1199219914 X:145306098-145306120 ATAAAAATCCCTGAACCAGCTGG - Intergenic
1200392980 X:155963209-155963231 ATAAAAATCCCTGAAAGAGGTGG + Intergenic
1201061468 Y:10050405-10050427 CTGAGTATAGCTGAAGGAGCTGG + Intergenic