ID: 1184637089

View in Genome Browser
Species Human (GRCh38)
Location 22:45841481-45841503
Sequence GTGGAGGAGCTGGGAGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 741
Summary {0: 1, 1: 0, 2: 6, 3: 109, 4: 625}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184637079_1184637089 8 Left 1184637079 22:45841450-45841472 CCCAAGGCCCCAGGAACACACGA 0: 1
1: 0
2: 0
3: 16
4: 192
Right 1184637089 22:45841481-45841503 GTGGAGGAGCTGGGAGACACAGG 0: 1
1: 0
2: 6
3: 109
4: 625
1184637077_1184637089 19 Left 1184637077 22:45841439-45841461 CCATGTTGAGGCCCAAGGCCCCA 0: 1
1: 0
2: 0
3: 17
4: 192
Right 1184637089 22:45841481-45841503 GTGGAGGAGCTGGGAGACACAGG 0: 1
1: 0
2: 6
3: 109
4: 625
1184637081_1184637089 1 Left 1184637081 22:45841457-45841479 CCCCAGGAACACACGACCACAGC 0: 1
1: 0
2: 13
3: 318
4: 1323
Right 1184637089 22:45841481-45841503 GTGGAGGAGCTGGGAGACACAGG 0: 1
1: 0
2: 6
3: 109
4: 625
1184637083_1184637089 -1 Left 1184637083 22:45841459-45841481 CCAGGAACACACGACCACAGCTG 0: 1
1: 0
2: 1
3: 18
4: 234
Right 1184637089 22:45841481-45841503 GTGGAGGAGCTGGGAGACACAGG 0: 1
1: 0
2: 6
3: 109
4: 625
1184637075_1184637089 26 Left 1184637075 22:45841432-45841454 CCAGGCTCCATGTTGAGGCCCAA 0: 1
1: 0
2: 2
3: 21
4: 154
Right 1184637089 22:45841481-45841503 GTGGAGGAGCTGGGAGACACAGG 0: 1
1: 0
2: 6
3: 109
4: 625
1184637082_1184637089 0 Left 1184637082 22:45841458-45841480 CCCAGGAACACACGACCACAGCT 0: 1
1: 0
2: 1
3: 17
4: 165
Right 1184637089 22:45841481-45841503 GTGGAGGAGCTGGGAGACACAGG 0: 1
1: 0
2: 6
3: 109
4: 625
1184637080_1184637089 7 Left 1184637080 22:45841451-45841473 CCAAGGCCCCAGGAACACACGAC 0: 1
1: 0
2: 2
3: 20
4: 192
Right 1184637089 22:45841481-45841503 GTGGAGGAGCTGGGAGACACAGG 0: 1
1: 0
2: 6
3: 109
4: 625

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184637089 Original CRISPR GTGGAGGAGCTGGGAGACAC AGG Intronic
900436169 1:2632220-2632242 GAGGTGGAGCTGGGAGTCCCTGG - Intronic
900875463 1:5339620-5339642 GTGGAGGAGAGGAGAGGCACAGG - Intergenic
900926510 1:5709533-5709555 GGTGAGGTGCTGGGAGTCACGGG - Intergenic
901051132 1:6426393-6426415 GCAGAGGAGCTGGGAGAAGCAGG + Intronic
901437905 1:9260897-9260919 GTGGAGGCGCTCACAGACACGGG - Intronic
901768741 1:11519904-11519926 GGGGTGGAGCTGTGAGACAGGGG - Intronic
901769819 1:11524575-11524597 GTGGGGGAGGTGGTAGTCACTGG - Intronic
901769860 1:11524685-11524707 GTGGGGGAGGTGGTAGTCACTGG - Intronic
901769875 1:11524726-11524748 GTGGGGGAGATGGTAGGCACAGG - Intronic
902134397 1:14292457-14292479 GAGGAGGAGCTGCGAGATATAGG + Intergenic
902295233 1:15462719-15462741 CTGGAGGAGCTGGGAGAAAGGGG - Exonic
902298084 1:15482251-15482273 CCGGAGGAGCTGGGAGAAAGGGG - Exonic
902635162 1:17730042-17730064 GGGGAGCAGGTGGGAGCCACTGG - Intergenic
902955591 1:19922559-19922581 ATGGAGGAGCTGGGGGATCCTGG - Intronic
902992552 1:20199321-20199343 GTGGAGGAGGTGTGAGAGGCAGG + Intergenic
903700401 1:25243176-25243198 CTGGGGCAGCAGGGAGACACTGG + Intronic
904056251 1:27672307-27672329 GTGCAGGAGCTGGGAGAGAGGGG - Intergenic
904321086 1:29698217-29698239 GTGGAGGAGCAGGGAGGGAGTGG + Intergenic
905105526 1:35561342-35561364 GTGCTGGAGCTGGGAGGCAAGGG + Intronic
905410628 1:37765626-37765648 GGGGATGAGCTAGGAGACACCGG - Intergenic
905744853 1:40406417-40406439 GAGGAAGAGCTGGGAGAAAATGG + Intronic
906534408 1:46543795-46543817 GTGAAGGAGCTGGGGGACGCTGG - Intergenic
906918891 1:50042009-50042031 ATTGAGGAGAAGGGAGACACTGG + Intergenic
907278240 1:53328513-53328535 GTGGATGAGCAGGGAGAAGCTGG + Intergenic
907322675 1:53615373-53615395 GGGTAGGAGTTGGGAGACATGGG - Intronic
910489094 1:87748210-87748232 GTGGAGGATGGTGGAGACACTGG + Intergenic
911440488 1:97920717-97920739 GCGGAGGAGCGCGGAGCCACAGG - Intronic
912148810 1:106830619-106830641 GTGGGGGAGTTGGGAGAAATGGG + Intergenic
913319691 1:117579485-117579507 CTAGAGGAGCTGGGAGGCACAGG - Intergenic
914827819 1:151147739-151147761 GTGGGTGGCCTGGGAGACACTGG + Intergenic
915612929 1:157009405-157009427 CTTGAGGAGTTAGGAGACACAGG + Intronic
915972299 1:160363296-160363318 CTGGAGGAGCTGGGAAGCAGTGG - Intergenic
916749946 1:167714555-167714577 GTGGAGGAGCAGGGAGGGACCGG - Intergenic
917143250 1:171859109-171859131 CTGGAGAAGCTGGGCTACACAGG - Intronic
918435232 1:184504304-184504326 GAGGAAGAGAAGGGAGACACAGG - Intronic
921078698 1:211721510-211721532 GAGGAGGAGCTGGGAGTCTGGGG - Intergenic
921939403 1:220824548-220824570 GTGGCGGAGTTGGGACACTCAGG + Intergenic
922206878 1:223455808-223455830 GTGGTGGAGCTGGGAGAGTAGGG - Intergenic
922209721 1:223478243-223478265 GTGAAGGAGCTGAGGGACAGAGG - Intergenic
922930466 1:229385252-229385274 GTGGAGACTCTGGGAGACTCAGG + Intergenic
923193147 1:231640196-231640218 GTGGAGGAGGAGGGAGAGAGGGG - Intronic
923594875 1:235353357-235353379 GGGTAGGACCTGGGAGACAGAGG + Intergenic
924802143 1:247335358-247335380 GTGGAGGAGAAGGGAGAGAAGGG + Intergenic
1063485455 10:6416348-6416370 GTGGAGGGGCTGAGGGACAAAGG - Intergenic
1064102766 10:12477594-12477616 GTGAAGGGGCTGGAAGAGACAGG + Intronic
1064243809 10:13653765-13653787 CTGGAGGGTCTGGCAGACACAGG - Intronic
1064585735 10:16837736-16837758 ACGGATGAGCTGGGAGAAACTGG - Intronic
1065514070 10:26507074-26507096 GAGAGGCAGCTGGGAGACACAGG + Intronic
1066445659 10:35480397-35480419 GAGGAGGAGCGGAGAGGCACGGG + Intronic
1066676313 10:37891325-37891347 GGGCAAGAGCAGGGAGACACAGG - Intergenic
1067284257 10:44895896-44895918 CTGGAGGAGCAGGGAGACTGTGG - Intergenic
1067323500 10:45244641-45244663 ACGGATGAGCTGGGAGAAACTGG - Intergenic
1067510160 10:46888062-46888084 GTGGAGGAGCTGGGATGCTATGG + Intergenic
1067568193 10:47352998-47353020 GTGGAGCAGCTTAGAGACATAGG + Intronic
1067652094 10:48163802-48163824 GTGGAGGAGCTGGGATGCTATGG - Intronic
1067768980 10:49110003-49110025 ATGCAGCAGCTGGGGGACACTGG + Intronic
1069324275 10:67212276-67212298 GTGGAGGAGTGGGGAGAAAGAGG - Intronic
1069793000 10:71035269-71035291 GTGGAAGAGGTGGGAATCACTGG + Intergenic
1069961042 10:72079671-72079693 ATGGAGAAGCTGGGAGAGATTGG - Intronic
1070728388 10:78808048-78808070 GTGGAGGGGGTGGGAGACCCTGG - Intergenic
1070810597 10:79295920-79295942 GTGCAGGAGGTGGGAGAGCCAGG - Intronic
1071786490 10:88906086-88906108 GGGGACAAGTTGGGAGACACAGG + Intronic
1073454588 10:103628873-103628895 GTGGGCAATCTGGGAGACACAGG - Intronic
1073569339 10:104563291-104563313 GATGAGAAGCTGGGAGACCCAGG + Intergenic
1074130319 10:110567960-110567982 GTGGGGGAGGAGGGAGACCCGGG + Intronic
1074993850 10:118738279-118738301 GTGGAGAAACTGAGAGACAAAGG + Intronic
1075094120 10:119460029-119460051 AAGGAGGAGCTGGGTGACAAGGG + Intergenic
1075204109 10:120431961-120431983 GTGGAGGAGACGGGAGAGAGGGG + Intergenic
1075255656 10:120924094-120924116 ATGGAGGGGGTGGGAGACTCAGG - Intergenic
1075269346 10:121035430-121035452 ATGGAGGGGGTGGGAGACTCAGG + Intergenic
1076101071 10:127778960-127778982 GAGCAGGAGCTGGGAGGCAGAGG - Intergenic
1076361752 10:129894537-129894559 GAGGAGGAGCTGGGGCACAGAGG - Intronic
1076670955 10:132120895-132120917 GTGGAGGGGCTGGGAGAGCCAGG + Intronic
1076738320 10:132468482-132468504 GGGGAGGAGATGGGAGGCAGGGG + Intergenic
1076836010 10:133021241-133021263 GGGGAGGAGCAGGGACAGACGGG + Intergenic
1076887448 10:133269167-133269189 GAGGAGGGGCTGGAAGACACAGG + Intronic
1077476716 11:2793951-2793973 GAGGAGGAGGAGGGTGACACAGG + Intronic
1077523089 11:3047832-3047854 GTGGAAGAGCTGGGGGTCAGCGG + Exonic
1078069142 11:8097019-8097041 GAGGTGGAGATGGGAGATACGGG - Intronic
1078854681 11:15197436-15197458 ATGCAGGAGCTGGGAGTCCCTGG + Intronic
1079367409 11:19821365-19821387 GTGAACGTGCTGGGAGAAACAGG - Intronic
1079403527 11:20125818-20125840 GTAGAGAAGCAGAGAGACACAGG - Intergenic
1080648072 11:34201704-34201726 GTGGAGGAGGGAGGAGACAGAGG - Intronic
1080702456 11:34655592-34655614 GTGGAGGATCTGAGAAACAGAGG - Intronic
1083746432 11:64739596-64739618 GTGGGGTGGTTGGGAGACACCGG + Intronic
1083839961 11:65298775-65298797 GTGGAGGAGCTGGGGGAGAACGG - Intronic
1083856100 11:65393860-65393882 GGGGATGGGCTGGGAGCCACCGG + Intronic
1084777092 11:71384475-71384497 GTGACAGAGCCGGGAGACACTGG - Intergenic
1084779669 11:71399979-71400001 AGGGAGGAGGTGGGAGACATGGG + Intergenic
1086350802 11:85941744-85941766 GTGCTGGTGCTGGTAGACACTGG + Intergenic
1086957967 11:92953528-92953550 GTGGAGGTGGAGGGAGAGACAGG + Intergenic
1088542832 11:110931199-110931221 ATGGCGGATCTGGGTGACACAGG - Intergenic
1089452422 11:118607668-118607690 GGGGGGGGGCAGGGAGACACTGG - Intronic
1089699256 11:120234579-120234601 GTGAAGGAGCCGGGAGAAATAGG - Intergenic
1090261319 11:125322706-125322728 CTGGGGGATCTGGGGGACACAGG - Intronic
1091274858 11:134343065-134343087 GGGGAGGAGGAGGGAGACCCTGG - Intronic
1091395945 12:154347-154369 GTGGGGGTGCTGGGAGGCCCAGG - Intronic
1092284508 12:7121114-7121136 GTGGAAGAGCAGGGAGCCGCTGG + Intergenic
1094355135 12:29569510-29569532 GTGGAGCAGCTGGGAGGGAGAGG + Intronic
1094404289 12:30098444-30098466 TGAGAGGAGCTGGGAGATACAGG - Intergenic
1094461220 12:30698299-30698321 CTGGAGGAGATGGGAGAGAATGG - Intergenic
1094523796 12:31218828-31218850 GTGGGGGAGCTTGCAGAGACTGG - Intergenic
1094602072 12:31917791-31917813 GTGGAAGGTCTGGCAGACACTGG + Intergenic
1095076600 12:37936138-37936160 ATGGAGCAGCTTGGAAACACTGG - Intergenic
1095523667 12:43098520-43098542 GTGGAGGAACTTGGAGATAATGG + Intergenic
1095808093 12:46343253-46343275 GTGGTGGTGCTGGTGGACACAGG - Intergenic
1095901576 12:47333650-47333672 ATGGAGGAGGTGGGAGGCTCAGG - Intergenic
1096747986 12:53740960-53740982 TTGGGGGAGCTGGAAGACTCAGG + Intergenic
1096773685 12:53951589-53951611 GAGGACGAGCTGAGGGACACAGG + Intergenic
1099488169 12:83253468-83253490 GGGGAGCAGGTGGGAGACAAGGG - Intergenic
1099607905 12:84828703-84828725 GTGAAGCAGCTGGGACACAGGGG - Intergenic
1101733663 12:107446719-107446741 GTGGATTATCTGGTAGACACAGG + Intronic
1102233307 12:111278290-111278312 CTGGAGTAGCTGGGGGCCACAGG - Intronic
1102405093 12:112666420-112666442 GTGTCAGAGCTGGGAGGCACAGG - Intronic
1103821334 12:123701239-123701261 GTGGAGGAGTTGGGAGGAAATGG + Intronic
1104733672 12:131122880-131122902 CTAGTGAAGCTGGGAGACACAGG - Intronic
1104927892 12:132323006-132323028 GTGGAGAAGCCGGGAGGCGCTGG - Intronic
1104973702 12:132542696-132542718 GGGGAGGAGATAGGAGACAGAGG - Intronic
1105201471 13:18183272-18183294 GTGGAGGAGCTGTGACACTTTGG - Intergenic
1105867439 13:24473671-24473693 GAGGAAGAACTGGGAGACAGAGG - Intronic
1106319655 13:28625408-28625430 GTGAAGGTGATGGGAGGCACTGG - Intergenic
1107440641 13:40424554-40424576 GTGGAGGAGCTGAGAGTGAGTGG - Intergenic
1107628797 13:42320528-42320550 GTGGGGGAGGTGAGAGACAGTGG - Exonic
1109164352 13:59015231-59015253 CTGAAGGAGCTTGGACACACAGG - Intergenic
1109249317 13:59999795-59999817 GAGGAGGAGCTGGGGGAGGCTGG - Intronic
1110425453 13:75361939-75361961 GAGGTGGAGCTGGGAGGAACTGG + Intronic
1110860316 13:80340137-80340159 CTGGTGGGGCTGGGGGACACAGG - Intronic
1111002963 13:82208650-82208672 GTGGAGGAGGAGGGAGATAGCGG - Intergenic
1112502526 13:99954024-99954046 GTGTAGGAGCTGGGAGAGAGGGG + Intergenic
1112518679 13:100077785-100077807 ATGGAGGAGGTGGGAGGCTCAGG - Intergenic
1113394305 13:109931666-109931688 GTGGAACAGCTGAGAGACAGGGG + Intergenic
1113582504 13:111439048-111439070 GTGGAAGAGCTGGTAGAAACAGG - Intergenic
1113967857 13:114164671-114164693 GTGGAGGAGCTGGGTGCCTCTGG - Intergenic
1115181398 14:30630528-30630550 GTGAAGGAGCTAAGAGACATGGG + Exonic
1118471923 14:66082247-66082269 GTGCAGGAGCAGGAAGACAGAGG - Intergenic
1118758170 14:68860634-68860656 GGGGAGGAACTGGGAGTGACAGG + Intergenic
1118899127 14:69972179-69972201 GTGGCGGAGCTGGGAGGTGCTGG + Intronic
1119175631 14:72565940-72565962 GTCCAGGAGCTGGGAAACTCTGG + Intronic
1119182961 14:72616686-72616708 ATGGAGTAGCTGTGTGACACTGG - Intergenic
1119847298 14:77839964-77839986 GGGGAGGAGCTGGGGTACTCGGG + Intronic
1121693737 14:95895870-95895892 GTGGAGCAGCCCAGAGACACCGG - Intergenic
1121842364 14:97144934-97144956 GTGGCTGAGCTGGGAACCACGGG - Intergenic
1121970160 14:98348657-98348679 GTGGAGGAGCTGTGTGACCTGGG + Intergenic
1122319570 14:100845622-100845644 GTGGAGGGGCTGGCGGGCACTGG + Intergenic
1122575081 14:102737055-102737077 GTGTAGGAGCTGAGTGACCCTGG - Intergenic
1123762950 15:23446763-23446785 GGGCAGGTGCTGGGACACACAGG + Intronic
1124109208 15:26772107-26772129 CTGGAGGAGCTGGGAGCCCACGG + Intronic
1124216693 15:27813207-27813229 GTGGAGTAGCTGGGTGACGGTGG - Intronic
1124646064 15:31438161-31438183 GTGTGGGAGCAGGAAGACACAGG - Intergenic
1125828351 15:42694056-42694078 GAGGAGGAGCTGGGGGCCAGCGG + Exonic
1127958061 15:63870527-63870549 GTGGAGGAGCTCAGAGACTGTGG - Intergenic
1128322595 15:66703577-66703599 GTGGCGGAGCCGGGAGGCCCGGG + Exonic
1128709823 15:69863519-69863541 TGGGAGCTGCTGGGAGACACGGG - Intergenic
1128927917 15:71675647-71675669 ATGAAGGAGGTGGGAGACCCAGG - Intronic
1129228908 15:74185588-74185610 GTGAGGGAGCTGGGTGACAGCGG - Intronic
1129292428 15:74578536-74578558 GTGGAGTGTCTGGGGGACACAGG + Intronic
1129601524 15:77001551-77001573 GTGCAGGAGGTGGGAGAGAGAGG + Intronic
1131111159 15:89766167-89766189 AAGGAGGGGCTGGGAGCCACAGG - Intronic
1131118439 15:89808582-89808604 GGGGACAAGCTGGGAGACAGAGG - Intronic
1131951310 15:97684157-97684179 GTGGAGGCGCTGGGAGATGTAGG - Intergenic
1132067272 15:98742477-98742499 GTGGAGGAGCTCTGACACAGTGG + Intronic
1132633646 16:932100-932122 GTCGAGGAGCCGGGTGACTCTGG - Intronic
1132718000 16:1301597-1301619 GTGGAGCAGCTGGGAGGGGCAGG - Intergenic
1132984296 16:2756309-2756331 GAGGGGGAGCGGGGAGACACGGG - Intronic
1133410280 16:5562504-5562526 GGGGAGGACCTGGGGGAGACAGG + Intergenic
1134609451 16:15596811-15596833 GAGGAGGGGCAGGGAGGCACGGG + Exonic
1135059004 16:19255151-19255173 GTAAAGGAGCTGGGAGACTCAGG - Intronic
1135205470 16:20480348-20480370 GAGGAGTAGCTGAGAGACCCTGG + Intronic
1135705426 16:24670878-24670900 GTGGGGGAGGTGAGAGAAACGGG - Intergenic
1136007514 16:27341138-27341160 GTGGAGGAGATGAGAGGCTCCGG + Intronic
1136114515 16:28086451-28086473 TTGGAGGAGCTCGGAGGGACCGG + Intergenic
1136170642 16:28487258-28487280 GTGGAGGAGATGGGAGAAAATGG - Intronic
1137469021 16:48737993-48738015 ACGGAGAAGCTGGGAGACATCGG - Intergenic
1137554428 16:49461673-49461695 AGGGAGGACCTGGAAGACACAGG + Intergenic
1138009147 16:53361824-53361846 GTGGGTGAGTTGGGGGACACGGG - Intergenic
1138270860 16:55694982-55695004 GATGAGGAGTTGGGAGGCACTGG + Intronic
1138647857 16:58438295-58438317 GTGGAGGAGCTGGGAGCAGATGG - Intergenic
1138873816 16:60925777-60925799 GTGGAGGGGCTGGCATTCACTGG - Intergenic
1139164244 16:64547249-64547271 GGAGAGGGGCAGGGAGACACAGG - Intergenic
1139884114 16:70196789-70196811 GGGGAGGAGCTGGGAGGAGCTGG - Intergenic
1140115277 16:72036323-72036345 GTGGGGGAGCAGGGAGATACAGG + Intergenic
1140123952 16:72105199-72105221 AGGGAGGAGCTGTGAGACACTGG - Intronic
1140368404 16:74398707-74398729 GGGGAGGAGCTGGGAGGAGCTGG + Intergenic
1140830677 16:78747816-78747838 ATGGAGCAGCTTGGAGACAGAGG - Intronic
1140858337 16:78997657-78997679 GGGGAGGAGAGGGGAGAGACAGG - Intronic
1140918844 16:79518487-79518509 GAGGAGGAGTAGGGAAACACAGG + Intergenic
1141079342 16:81036407-81036429 GAGGAGGAGCTGGGAGCCCCGGG + Intronic
1141457264 16:84151559-84151581 GTAGAAGAGCTGGGAGAGAGAGG + Intronic
1141712763 16:85709658-85709680 GGTGAGGAGGTGGGAGACAGAGG - Intronic
1141985171 16:87575233-87575255 CTGGAGAAGCTGGGAGGCAGTGG - Intergenic
1142438084 16:90075964-90075986 GCCTAGGAGCTGGGAGACTCAGG - Intronic
1143151982 17:4812898-4812920 GAGGAGAAGCTGGGAGTCAGTGG + Intronic
1143570799 17:7756999-7757021 GTGGAGAGGCTGGGAAGCACAGG - Intronic
1144411065 17:15002288-15002310 GTGAAGGAGCAGGGAGATTCTGG - Intergenic
1144754386 17:17670389-17670411 GGGGAGGAGGTGGGAGGAACAGG + Intergenic
1145042001 17:19583899-19583921 GTGGAAAAGCTGGGAGCCAGGGG + Intergenic
1146651062 17:34606694-34606716 TTGGAGGAGCTGGGCCACCCGGG + Intronic
1147453780 17:40521864-40521886 GTGAAGGAGTTGGGTGACTCAGG - Intergenic
1147590827 17:41682445-41682467 GTGGAGGAGGTGCCAGACACAGG - Intergenic
1148126798 17:45241487-45241509 GTGGAGGAGCTGGAGGAGAAGGG + Exonic
1148290363 17:46442368-46442390 GTAAAGGAGGTGGGAGAGACAGG - Intergenic
1148312531 17:46659941-46659963 GTAAAGGAGGTGGGAGAGACAGG - Intronic
1148426863 17:47606187-47606209 GTAAAGGTGCTGAGAGACACAGG + Intronic
1148710634 17:49678191-49678213 GAGGAGGAGCAGGGAAACCCAGG - Intronic
1149500542 17:57149179-57149201 GTGGAGGAGATGGGGTACAGAGG - Intergenic
1149549664 17:57530992-57531014 GTGGAGAAGCAGGGAGAGAAAGG + Intronic
1149902343 17:60492043-60492065 GTAGAGCAGCTGGGACACAGGGG - Intronic
1150006044 17:61469622-61469644 GTGGAGAAGCCCAGAGACACTGG - Intronic
1150853982 17:68732996-68733018 GTAAAGGAGCTGGGAGAAAGAGG + Intergenic
1151201186 17:72469185-72469207 GTGGGAGAGCTGGGAGACTAAGG - Intergenic
1151386343 17:73757623-73757645 GTGGAGGAGGCGGCAGGCACAGG - Intergenic
1151941918 17:77298023-77298045 GAGGAGGAGGAGGGAGACGCAGG + Intronic
1152212137 17:79008348-79008370 GAGGAAGAGCTGGGAGATAGCGG + Intronic
1152317524 17:79589661-79589683 GGGGAGGAGCTGGGACCCCCTGG + Intergenic
1152465307 17:80462900-80462922 TTAGAGGAACTGGGAGACAAAGG + Intergenic
1152656804 17:81523633-81523655 GTGGAGTACCTGGGAATCACTGG + Intronic
1152899581 17:82932628-82932650 GAGAAGGAGCTGTGAGACCCTGG - Intronic
1152961035 18:80287-80309 GAGGAGGAGCAGGAAGGCACTGG - Intergenic
1154132664 18:11750502-11750524 GTGGAGGAGCCCGGATGCACCGG + Intronic
1155094723 18:22544618-22544640 GTGGATGAGATGGCAGACAGGGG + Intergenic
1155524667 18:26704190-26704212 CTGGAGGAGCTGGGAGGCAAAGG + Intergenic
1156472394 18:37385557-37385579 GTGGAGGGGAGGGGAGACATTGG - Intronic
1157425261 18:47579259-47579281 GAGGAGGAGCTGGGTGATTCAGG + Intergenic
1157522948 18:48357675-48357697 CTGGAGGAGGTGGGAGGCCCTGG - Intronic
1158227585 18:55216873-55216895 GTGAAGGTTCTGGGAGAGACAGG + Intergenic
1158543441 18:58376806-58376828 GAGGAGGAGCAGGGAGAGCCAGG - Intronic
1160492772 18:79351845-79351867 CAGGAGGGGCTGGGAGAGACAGG + Intronic
1160680189 19:408776-408798 GGGGCGGAGCTGGGACACCCCGG - Intronic
1160741772 19:689554-689576 CTGCAGGAGGTGGGAGCCACTGG + Intronic
1160851529 19:1195214-1195236 GTGGAGGAGGTCTGGGACACGGG + Intronic
1160851953 19:1197028-1197050 GTGGAGGAGGTCTGGGACACGGG + Intronic
1160866140 19:1256954-1256976 GTGGAGGCTTTGGGAGTCACAGG + Intronic
1160969356 19:1760562-1760584 TTGGAGGAGCTGGGGCACAGGGG - Intronic
1161479662 19:4504236-4504258 GGGGAGGAGGTGGGAGATGCAGG + Exonic
1162515860 19:11147255-11147277 GTGGATGGGCTGGGCCACACTGG + Exonic
1162592200 19:11599231-11599253 GTGGAGGAGCTGGGTGTCCTGGG + Intronic
1162618678 19:11822255-11822277 ATGGAGGAACTGGGAGAAAGTGG + Intronic
1162632671 19:11941386-11941408 ATGGAGGAGGTGGGAGACTCAGG + Intronic
1162818128 19:13208194-13208216 GAGGAGGAGAGGGGGGACACAGG + Intronic
1162858418 19:13487485-13487507 CTGGGGGAGCGGGGAGAGACAGG + Intronic
1163090471 19:15016119-15016141 GTGGACGAGGTAGGAGACTCAGG + Intronic
1163490412 19:17614502-17614524 GTGGAGGTGCTGGCGGTCACAGG - Intronic
1163715434 19:18870012-18870034 GTGGAGGAGCTGGGGGTCGCCGG - Exonic
1163835499 19:19571043-19571065 GGGGAGGAACGGGGAGACACAGG + Intronic
1164339786 19:24379675-24379697 GTGGAAGAGTTTGGAAACACTGG + Intergenic
1164834899 19:31350253-31350275 GGGGAGGAGCTGGGTGGCGCGGG - Intergenic
1165256675 19:34580459-34580481 GTGGAGGAGCTGGGGCAGGCAGG + Intergenic
1165265909 19:34663930-34663952 GTGGAGGAGCTGGGGCAGGCAGG - Intronic
1165273544 19:34730947-34730969 GTGGAGGAGCTGGGGCAGGCAGG - Intergenic
1165816394 19:38645041-38645063 GAGGGGGAGCTGGGAGACAGTGG + Intergenic
1165824508 19:38698154-38698176 GAGGAGATGCTGGGAGGCACAGG + Intronic
1165834469 19:38745689-38745711 TTGGAGGAAATGGGAGAAACAGG + Intronic
1166103570 19:40586256-40586278 ATGGAGGAACAGGGAGACAAAGG - Intronic
1166297820 19:41897369-41897391 GGGGAGGGGCTGGGAGAAATGGG - Intronic
1166631533 19:44411519-44411541 GGAGAGTAGCTGGGACACACAGG - Intergenic
1166631631 19:44412107-44412129 AGAGAGAAGCTGGGAGACACAGG - Intergenic
1166636044 19:44452643-44452665 GGAGGGGAGCTGGGAGACACAGG + Intergenic
1166636545 19:44456514-44456536 AGAGAGAAGCTGGGAGACACAGG + Intergenic
1166636647 19:44457102-44457124 GGAGAGTAGCTGGGACACACAGG + Intergenic
1166636847 19:44458275-44458297 GGAGAGTAACTGGGAGACACAGG + Intergenic
1166636881 19:44458422-44458444 GGGGAGTAGCTGGGAGACACGGG + Intergenic
1166638619 19:44473999-44474021 GGAGAGGAGCTGGGAGACACAGG + Intergenic
1166658599 19:44630180-44630202 GTGGACCAGCTGGGAGGAACTGG + Intronic
1167137466 19:47625807-47625829 ATGGATGGGCTGAGAGACACAGG + Intronic
1167349005 19:48963452-48963474 GAGGAGGGGCTGAGAGAGACAGG - Intergenic
1167354289 19:48993681-48993703 GAGGAGGAGCCAGGAGACATTGG + Exonic
1167738902 19:51312247-51312269 GTTGAGGAGGGGGCAGACACTGG + Intronic
1168063042 19:53904751-53904773 CTGGAGAAGCTGGGAGTCAGGGG - Intronic
1168538714 19:57192589-57192611 TTGGGGGATCTGGGAGACCCAGG + Intronic
1202648613 1_KI270706v1_random:161536-161558 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1202648690 1_KI270706v1_random:161978-162000 GGAGAGGAGCTGGGACAGACAGG + Intergenic
1202648741 1_KI270706v1_random:162269-162291 GCAGAGTAGCTGGGACACACAGG + Intergenic
1202648952 1_KI270706v1_random:163443-163465 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1202649307 1_KI270706v1_random:166146-166168 GGAGAGTAGCTGGGAGACACAGG - Intergenic
925018581 2:551300-551322 GTGAAGGAGGTGGGACACAGAGG + Intergenic
925214897 2:2085915-2085937 ATGGAGGGGCTGGGAGAAAAGGG - Intronic
925260793 2:2526754-2526776 GTGGAGGAGCTGGGAGGTCAGGG - Intergenic
925307517 2:2860967-2860989 GTGGAGGAGGAGAGAGACCCTGG + Intergenic
925408393 2:3624420-3624442 GAGGAGAAGTTGGGAGAGACTGG - Intronic
925611256 2:5705408-5705430 GTGGAGGAGCTGGGAGGCTGGGG + Intergenic
925611264 2:5705430-5705452 GTGGAGGAGCTGGGAGGCTGGGG + Intergenic
925611400 2:5705863-5705885 GTGAAGGAGCTGGGAGGCTGGGG + Intergenic
925611406 2:5705885-5705907 GTGGAGGAGCTGGGAGACCAGGG + Intergenic
925611464 2:5706042-5706064 GTGGAGGAGCTGGGAGGCCAGGG + Intergenic
925611499 2:5706153-5706175 GTAGAGGAGCAGGGAGACTGGGG + Intergenic
925611512 2:5706197-5706219 GTGGAGGAGCTGGGAGGCCAGGG + Intergenic
925611556 2:5706330-5706352 GTGGAGGAGCAGGGAGGCTGGGG + Intergenic
925611563 2:5706352-5706374 GTGGAGGAGCAGGGAGACTGGGG + Intergenic
925611570 2:5706374-5706396 GTGGAGAAGCTGGGAGGCTGGGG + Intergenic
925611578 2:5706396-5706418 GTGGAGGAGCTGGGAGGCTGGGG + Intergenic
925611584 2:5706418-5706440 GTAGAGGAGCAGGGAGACTGGGG + Intergenic
925611592 2:5706440-5706462 GTGGAGGAGCAGGGAGGCTGGGG + Intergenic
925611599 2:5706462-5706484 GTGGAGAAGCTGGGAGGCTGGGG + Intergenic
925611607 2:5706484-5706506 GTGGAGGAGCAGGGAGGCTGGGG + Intergenic
925611615 2:5706506-5706528 GTGGAGGAGCTGGGAGGCTGGGG + Intergenic
925611622 2:5706528-5706550 GTGGAGGAGCAGGGAGACTGGGG + Intergenic
925611630 2:5706550-5706572 GTGGAGGAGCAGGGAGGCTGGGG + Intergenic
925741664 2:7010234-7010256 GTGGAGGCACTGGGAGAGAAAGG + Intronic
927521119 2:23698929-23698951 CAGAAGGAGCTGGGAGACAGTGG - Intronic
927637636 2:24827675-24827697 GTGGAGGACTTGGGATACCCCGG - Intronic
927697981 2:25250948-25250970 GTGAAGGGGCTGAGAGACAAAGG - Intronic
928028177 2:27756560-27756582 GTGCAGGAGTGAGGAGACACGGG + Intergenic
928102123 2:28444942-28444964 GGGGAGGAACTGGGAGAGCCTGG + Intergenic
929569065 2:43008551-43008573 GTGGTGGGGCTGGCAGACACAGG - Intergenic
930063239 2:47308447-47308469 GTGGAGGGGCTGGGATCCACAGG - Intergenic
931051274 2:58417683-58417705 GTAGAGGAACTGAGAGATACAGG + Intergenic
931218768 2:60270295-60270317 GTGAAGGAGCTGGGGCACATTGG - Intergenic
931244374 2:60480152-60480174 GTGGAGGAGCTGGAGGCCAGGGG + Intronic
931263357 2:60638977-60638999 GTGTAGGAGATGGGAGACGAGGG - Intergenic
932002444 2:67897037-67897059 GTGGAGGAGCCAGGCGGCACTGG + Intergenic
932417907 2:71584739-71584761 GGGGAGAAGCTGGGAGAGGCTGG + Intronic
932419036 2:71590653-71590675 GTGGAGAAGTTGGGGGACCCCGG - Intronic
932674451 2:73766458-73766480 GTCGAGGAGCTGAGTGACCCTGG + Exonic
933084827 2:78042933-78042955 ATGGAGGAAATGGGAGACACTGG + Intergenic
933846033 2:86327982-86328004 GTGGTGGAGGTGGGAGTCATGGG + Intronic
933994948 2:87661300-87661322 TTAGAGGAGCTGGGACACATTGG + Intergenic
934112749 2:88757641-88757663 GTGGGGGTGCTGGGAGACAGTGG - Intergenic
934880100 2:97969333-97969355 GTGGAGGGCCTGGAAGAAACTGG - Intronic
934890145 2:98060430-98060452 TAGGAGGAGCTGGGAGACAGGGG + Intergenic
934938723 2:98484096-98484118 GTGGAGGGGATGGTAGTCACCGG - Intronic
935096887 2:99953235-99953257 GTAGAGGTGCCAGGAGACACAGG - Intronic
936092988 2:109512752-109512774 GTGGAGGCTCTGGGAGAGACAGG - Intergenic
936163957 2:110104102-110104124 GTGGGGGTGCTGGGAGACAGTGG - Intronic
936298908 2:111289613-111289635 TTAGAGGAGCTGGGACACATTGG - Intergenic
936999196 2:118448649-118448671 GTGAAGCAGCTGGAAGACGCAGG - Intergenic
937076995 2:119114285-119114307 GGGGAGCATCTGGGAGACAGCGG - Intergenic
937917901 2:127107879-127107901 GTGGAGCACCTGGGAGACAGAGG - Intergenic
938103589 2:128514529-128514551 GGGGTGGAGGTGGGAGACACAGG - Intergenic
938132714 2:128731426-128731448 CTGGAGGACCTGGAAGATACTGG + Intergenic
938310537 2:130285942-130285964 CTGGAGGAGCAGGGAGAGAATGG + Intergenic
938540826 2:132282276-132282298 GGAGAGTAACTGGGAGACACAGG + Intergenic
938540860 2:132282423-132282445 GGAGAGTAGCTGGGAGACACGGG + Intergenic
938541376 2:132286568-132286590 GGAGAGAAGCTGGGAGACACAGG + Intergenic
938541654 2:132288179-132288201 GGAGAGTAACTGGGAGACACAGG + Intergenic
938541680 2:132288326-132288348 GGAGAGTAGCTGGGAGACACGGG + Intergenic
939053184 2:137331698-137331720 ATGGAGGGGGTGGGAGACTCAGG + Intronic
939722207 2:145667878-145667900 CTGGAGGACCTGGGAAAAACGGG - Intergenic
941099629 2:161281926-161281948 GGAGAGTAGCTGGGAGACACAGG - Intergenic
941099658 2:161282073-161282095 GGAGAGAAGCTGGGAGACACAGG - Intergenic
942245388 2:174003400-174003422 GTGTTGGAGGTGGGTGACACAGG - Intergenic
942523330 2:176827464-176827486 GTGGCTGAGCTGTGACACACTGG - Intergenic
944192596 2:197019557-197019579 GTGGAGGAGCTGGGTTTCAAAGG + Intronic
945997660 2:216451636-216451658 GTGGAGCAGCTAAGAGACCCTGG - Intronic
946155804 2:217806001-217806023 GTGGGGGAGCTGGGGTCCACAGG + Intronic
946444524 2:219726961-219726983 GTGGTGGAGTCGGGAGGCACAGG + Intergenic
946676130 2:222161920-222161942 GTGGGGGAGTTGGGGGACAGAGG - Intergenic
946841620 2:223825520-223825542 GGGGAGGAGATGGGAGAGACAGG - Intronic
946922113 2:224591062-224591084 GTGGAGGTACAGGGAGACACAGG + Intergenic
947048025 2:226009895-226009917 GTGGAGGAGATGGGTGGGACTGG + Intergenic
947598028 2:231426300-231426322 GATGAGGAGCTGGCAGCCACCGG - Intergenic
947794062 2:232883398-232883420 GTGGAGGAGCTGGAGGACCAGGG - Exonic
947795139 2:232889891-232889913 GAGGGGGACCTGGGAGCCACAGG - Intronic
948208517 2:236175868-236175890 GAGGGAGAGCTGGGAGACAGAGG - Intergenic
948685872 2:239669556-239669578 AGGAAGGAGCTGGGAGACAGAGG - Intergenic
948883195 2:240870700-240870722 GTGGAGGAGGTAGGGGACCCGGG + Exonic
949027494 2:241773433-241773455 GTGGAGGGGCTGGGAAGCTCGGG + Intergenic
1169075199 20:2755871-2755893 GTGGAGCAGCTGGGCTACAGGGG + Intronic
1169303642 20:4469477-4469499 GGGGAGGAGCAGGGAGGCTCTGG - Intergenic
1169913026 20:10662561-10662583 GTTGAGGAGGGGGGAGACATAGG - Intronic
1171154616 20:22860620-22860642 TTGGAGCTGGTGGGAGACACTGG + Intergenic
1171310324 20:24140189-24140211 GTGAAGGGTCTGGGAGACATGGG + Intergenic
1171869767 20:30515424-30515446 GGAGAGTAGCTGGGAGACACGGG + Intergenic
1171870277 20:30519590-30519612 GGAGAGGAGCTGGGAGACACAGG + Intergenic
1171870523 20:30521055-30521077 GGAGAGTAACTGGGAGACACAGG + Intergenic
1171870553 20:30521202-30521224 GGAGAGTAGCTGGGAGACACGGG + Intergenic
1172003563 20:31801042-31801064 GTGGAGAATTTGGGAGATACAGG - Exonic
1172293317 20:33791269-33791291 CTGGAGGAGCTGAAGGACACAGG + Exonic
1173115022 20:40233090-40233112 GTGAAGGAGCTGGGAGAGCAAGG + Intergenic
1173159109 20:40639271-40639293 GGAGAGGAGCTGGGAAATACAGG - Intergenic
1173601626 20:44299404-44299426 ATGGAGGAGGTGGGAGGCTCAGG - Intergenic
1173907925 20:46642261-46642283 GGGCAGGAGCTGGATGACACAGG + Intronic
1174562216 20:51439448-51439470 ATGGAGGAGCTGCAAGGCACAGG - Intronic
1174698299 20:52582316-52582338 GCTGAGGAGCTGAGAGACACAGG - Intergenic
1175159167 20:56995286-56995308 GTGGAGGAGATGGGAGTGAAAGG - Intergenic
1175577774 20:60075489-60075511 TGGGAAGAGCTGGGAGCCACGGG - Intergenic
1175800130 20:61796747-61796769 ATGGGGGTGCTGGGAGCCACAGG - Intronic
1175880369 20:62254513-62254535 AGGGAGGAACCGGGAGACACTGG + Intronic
1175963719 20:62649705-62649727 GAGGAGGGGGTGGGAGACCCGGG - Intronic
1176041805 20:63069633-63069655 GTGCCGGCTCTGGGAGACACAGG + Intergenic
1176110873 20:63410167-63410189 ATGGAGGAGATGGGAGTCCCTGG + Intronic
1176209885 20:63914185-63914207 GTGGAGGTGCTGTGACCCACAGG + Intronic
1176257125 20:64158465-64158487 GTGGAGCAGGTGGGGGACACAGG - Intronic
1176304025 21:5114144-5114166 GTGGAGGAGCTGGGAGTGGTGGG + Intergenic
1176304038 21:5114184-5114206 GTGGAGGAGCTGGGAGTGGTGGG + Intergenic
1176304063 21:5114264-5114286 GTGGAGGAGCTGGGAGTGGTGGG + Intergenic
1176304076 21:5114304-5114326 GTGGAGGAGCTGGGAGTGGTGGG + Intergenic
1176366165 21:6034132-6034154 GTGGGGGTTCTGGGTGACACAGG + Intergenic
1176387851 21:6148150-6148172 ATGGACGAGCTGGGGGACTCAGG - Intergenic
1176602514 21:8806400-8806422 GGAGAGTAGCTGGGAGACAAAGG + Intergenic
1176602867 21:8809099-8809121 GGAGAGTAGCTGGGAGACACAGG - Intergenic
1176603079 21:8810272-8810294 GGAGAGTAGCTGGGACACACAGG - Intergenic
1176603133 21:8810563-8810585 GGAGAGTAGCTGGGACACACAGG - Intergenic
1176603161 21:8810710-8810732 GGAGAGGAGCTGGGACAGACAGG - Intergenic
1176603240 21:8811151-8811173 GGAGAGAAGCTGGGAGACCCAGG - Intergenic
1176611835 21:8990935-8990957 GGAGAGTAGCTGGGAGACAGAGG - Intergenic
1176612038 21:8992106-8992128 GTAGAGTAGCTGGGACAGACAGG - Intergenic
1176716479 21:10354716-10354738 GTGGAGGAGCTGTGACACTTTGG + Intergenic
1177268441 21:18813456-18813478 GAGGAAGGGCTGGGAGTCACTGG + Intergenic
1177742145 21:25167711-25167733 GTGGAGTGGCTGGGACACAGCGG - Intergenic
1179068298 21:38047455-38047477 GTTGAGTAGATGGGAGACACAGG - Intronic
1179423613 21:41255272-41255294 GAGGAGGAGTTGGGAGTCTCAGG + Intronic
1179427638 21:41294646-41294668 GGGGAGGGGCTGGAAGGCACAGG - Intergenic
1179487900 21:41722559-41722581 GTAGAGGAGCTGAGAGAGGCCGG + Intergenic
1179550782 21:42142159-42142181 GTGGAGGTGCAGAGAGACACTGG - Exonic
1179735621 21:43390098-43390120 ATGGACGAGCTGGGGGACTCAGG + Intergenic
1179757352 21:43504413-43504435 GTGGGGGTTCTGGGTGACACAGG - Intergenic
1179852968 21:44147686-44147708 GTGGAGGAGCTGGGAGTGGTGGG - Intergenic
1179852993 21:44147766-44147788 GTGGAGGAGCTGGGAGTGGTGGG - Intergenic
1179853006 21:44147806-44147828 GTGGAGGAGCTGGGAGTGGTAGG - Intergenic
1179880117 21:44290046-44290068 CTGGTGGAGCTGGGGGTCACTGG - Exonic
1179895564 21:44360335-44360357 GGGGAGGAGGTGGGAGACCTTGG + Intronic
1179909468 21:44440410-44440432 GGGGAGGAGCTGGGGGTGACTGG - Intronic
1180006023 21:45021112-45021134 GGGGAGGGGCTGTGAGGCACAGG - Intergenic
1180073830 21:45451769-45451791 GCGCAGGACCTGGGTGACACAGG - Intronic
1180099464 21:45577815-45577837 CTGGAGGAGCTTGGCGACTCCGG + Intergenic
1180159952 21:45994539-45994561 TTGGAGCCCCTGGGAGACACTGG + Intronic
1180163614 21:46009082-46009104 CAGGAGGAGCTGGGACCCACTGG + Intergenic
1180179869 21:46113189-46113211 GAGCTGGAGCTGGGACACACAGG - Intronic
1180179975 21:46113846-46113868 GTGAGGGAGCTGTGAGACATGGG - Intronic
1180344799 22:11697953-11697975 GGAGAGTAGCTGGGAGACAAAGG + Intergenic
1180345152 22:11700656-11700678 GGAGAGTAGCTGGGAGACACAGG - Intergenic
1180345365 22:11701829-11701851 GGAGAGTAGCTGGGACACACAGG - Intergenic
1180345419 22:11702120-11702142 GGAGAGTAGCTGGGACACACAGG - Intergenic
1180345447 22:11702267-11702289 GGAGAGGAGCTGGGACAGACAGG - Intergenic
1180345526 22:11702708-11702730 GGAGAGAAGCTGGGAGACCCAGG - Intergenic
1180352192 22:11814604-11814626 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1180352303 22:11815192-11815214 GGAGAGTAGCTGGGACACACAGG + Intergenic
1180352353 22:11815483-11815505 GGAGAGTAGCTGGGACACACAGG + Intergenic
1180352401 22:11815774-11815796 GGAGAGTAGCTGGGACACACAGG + Intergenic
1180352623 22:11816947-11816969 GGAGAGTAGCTGGGAGGCACAGG + Intergenic
1180353137 22:11820070-11820092 GGAGAGTAGCTGGGACACACAGG - Intergenic
1180353187 22:11820361-11820383 GGAGAGTAGCTGGGACACACAGG - Intergenic
1180353289 22:11820949-11820971 GGAGAGAAGCTGGGAGACCCAGG - Intergenic
1180384951 22:12171408-12171430 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1180385054 22:12171996-12172018 GGAGAGTAGCTGGGACACACAGG + Intergenic
1180385104 22:12172287-12172309 GGAGAGTAGCTGGGACACACAGG + Intergenic
1180385315 22:12173459-12173481 GGAGAGTAGCGGGGAGACACAGG + Intergenic
1180385629 22:12175410-12175432 GGAGAGTAGCTGGGAGGCACAGG - Intergenic
1180385856 22:12176583-12176605 GGAGAGTAGCTGGGACACACAGG - Intergenic
1180385906 22:12176874-12176896 GGAGAGTAGCTGGGACACACAGG - Intergenic
1180386015 22:12177462-12177484 GGAGAGAAGCTGGGAGACCCAGG - Intergenic
1180601858 22:17025220-17025242 GTGGAGGAGCTGTGACACTTTGG - Intergenic
1181308019 22:21927807-21927829 GTGACGGAGGTGGGAGCCACTGG - Intronic
1181360526 22:22330726-22330748 ATGAAGGGGCTGGGAGACAAGGG + Intergenic
1181936395 22:26441979-26442001 CCGGAGTAGCTGGGAGGCACTGG - Intronic
1182473725 22:30564466-30564488 GTGGAGGAGGTGGGAGACCCAGG - Intronic
1182946971 22:34333261-34333283 GTGCTGGTGCTGGTAGACACCGG - Intergenic
1183089149 22:35509585-35509607 GTGGGGCAGCTGGGAGAATCCGG - Intergenic
1183368925 22:37421555-37421577 CTGGAGGAGAGGTGAGACACGGG - Intronic
1183639146 22:39082822-39082844 GTGGAGGGGCTGTGAGAGTCAGG - Intronic
1183688802 22:39376662-39376684 GGGTAGGATCTGGGGGACACAGG + Intronic
1184024818 22:41847434-41847456 GGTGAAGAGCTGGGAGATACAGG + Intronic
1184413500 22:44338981-44339003 GAGGAGGAGCTGGGAGACTGTGG - Intergenic
1184567101 22:45298653-45298675 GTGGGGGAGGAGGGAGAAACGGG + Intergenic
1184637089 22:45841481-45841503 GTGGAGGAGCTGGGAGACACAGG + Intronic
1184675713 22:46041911-46041933 CTGGAGTAGCTGGGAGTTACAGG + Intergenic
1184947241 22:47812205-47812227 CAGGAGGAGCTGGGAGAGGCAGG + Intergenic
1185388814 22:50548242-50548264 GTGGAAGTGCTGGGACCCACGGG - Exonic
949165296 3:933494-933516 GTGGGGGAGCTGAGAGAAGCAGG - Intergenic
949938951 3:9139058-9139080 GCCAAGCAGCTGGGAGACACAGG - Intronic
950212900 3:11136934-11136956 GTGCAGGCGCTTGGACACACAGG - Intergenic
950523928 3:13512659-13512681 GAGCAGGAGCTGGGACCCACGGG + Intergenic
950525530 3:13520731-13520753 GAGCAGGAGCGGGGAGACAGAGG - Intergenic
950610147 3:14121476-14121498 GTGGATGAGCTGAGAGATTCTGG - Intronic
952342785 3:32459632-32459654 GGGGAGGAGCAGGGAGCCAGGGG + Intronic
952879033 3:37971532-37971554 GTGGAGGGGCTGGGAGTACCAGG - Intronic
952999972 3:38923634-38923656 GTAGTGGAGTTGGTAGACACTGG - Intronic
953187409 3:40651744-40651766 GAGGAGGAGAGGGGAGGCACTGG - Intergenic
953410877 3:42689927-42689949 GTCTAGGAGGTGGGAGAAACAGG + Intronic
953806794 3:46077401-46077423 CTGGAGGTGATGGGAGACAGTGG - Intergenic
953813804 3:46136597-46136619 GTGGAGGAACTGGAACACTCAGG - Intergenic
954446440 3:50549406-50549428 GGGGAGGAGCTGGGGGAGAGAGG + Intergenic
954609334 3:51936073-51936095 GGGGAGGAGCTGGGGGAGACCGG - Intronic
954620161 3:51990842-51990864 GTGGAGGGGGTGGGAGGCTCAGG - Intergenic
954715753 3:52525918-52525940 GTGGAAGCGCTGGGGGAAACAGG + Intronic
954801447 3:53189289-53189311 GGGCAGGGGCTGGCAGACACTGG + Intronic
954937393 3:54339141-54339163 GAAGAGGGGCTGGGAGAGACAGG - Intronic
955032812 3:55237439-55237461 GCGGAGGAGCAGGGAGAGGCAGG - Intergenic
955399208 3:58579267-58579289 GTGAGGGAGGTGGGAGACAGGGG + Intronic
955730935 3:61985555-61985577 GAGGAGGGGCTGTGAGCCACAGG + Intronic
956229647 3:66998804-66998826 GTTAAGGATCTGGGAGACAGAGG - Intronic
957108601 3:75924327-75924349 GTAGAGGAGCTTGGGGAGACTGG + Intronic
958294881 3:91891262-91891284 GGAGAGTAGCTGGGACACACAGG - Intergenic
958962104 3:100520692-100520714 TTGGAGGAGCAGGCAGGCACGGG + Intronic
961045350 3:123704148-123704170 GTGGAGGACTTGGGATACAAAGG + Intronic
961125256 3:124411864-124411886 TTGGGGGATCTGGGAGCCACTGG - Intronic
961386722 3:126526947-126526969 GTGCAGGTACTGGGAGACAGTGG + Intronic
961474277 3:127136968-127136990 GAGGATGAGCTGGGGGACAGAGG - Intergenic
962292270 3:134146681-134146703 GGGCAGGAGCTGGGAGATAGGGG - Intronic
962731789 3:138290219-138290241 GTGGTGAAGCTGGGAGTCAGTGG + Intronic
963319132 3:143793876-143793898 GTGGGTGACCTGAGAGACACAGG - Intronic
965078025 3:164003238-164003260 ATGGAGGAGGTGGGAGGCTCAGG - Intergenic
965936908 3:174125506-174125528 GTGGGGGAGCTGTGTGATACAGG + Intronic
966379750 3:179332231-179332253 GTGGAGAAACTGGGATACATGGG + Intronic
967115231 3:186331614-186331636 GTGGGGGAGCTGGGAGTGGCTGG + Intronic
968360409 3:198143018-198143040 GTTGAGAAGTGGGGAGACACAGG - Intergenic
968479042 4:825874-825896 GGGGAGGAGCTGGGCGAAGCCGG + Intronic
968885902 4:3332005-3332027 GTGGAGGGGCTGGGAAGCAGTGG + Intronic
969159972 4:5248214-5248236 GTGGAGGAGCTGGAACTCAGAGG + Intronic
969606936 4:8206480-8206502 AGGGAGGAGCTGGGAGCCTCTGG + Intronic
969607849 4:8211326-8211348 GAGGGGGAGAGGGGAGACACCGG - Intronic
969967438 4:11011753-11011775 GGGGAGGAGCTGGGGGAGGCAGG - Intergenic
970607303 4:17692676-17692698 CTGAAGCAGGTGGGAGACACAGG + Intronic
971572634 4:28232508-28232530 GTTGAGGAAATGGGAGACAAAGG - Intergenic
973374838 4:49279500-49279522 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
973375162 4:49281261-49281283 GGAGAGTAGCTGGGAGACACAGG + Intergenic
973375742 4:49285522-49285544 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
973375818 4:49285963-49285985 GGGGAGTAGCTGGGACAGACAGG + Intergenic
973375847 4:49286110-49286132 GGAGAGTAGCTGGGACACACAGG + Intergenic
973376062 4:49287283-49287305 GGAGAGTAGCTGGGAGACACAGG + Intergenic
973376641 4:49291541-49291563 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
973376718 4:49291982-49292004 GGGGAGTAGCTGGGACAGACAGG + Intergenic
973376769 4:49292273-49292295 GGAGAGTAGCTGGGACACACAGG + Intergenic
973376985 4:49293446-49293468 GGAGAGTAGCTGGGAGACACAGG + Intergenic
973377560 4:49297693-49297715 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
973377692 4:49298428-49298450 GGAGAGTAGCTGGGACACACAGG + Intergenic
973377906 4:49299601-49299623 GGAGAGTAGCAGGGAGACACAGG + Intergenic
973378479 4:49303829-49303851 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
973378634 4:49304708-49304730 GGAGAGTAGCTGGGAAACACAGG + Intergenic
973378848 4:49305881-49305903 GGAGAGTAGCTGGGAGACACAGG + Intergenic
973379370 4:49309773-49309795 GGAGAGTAGCTGGGAGACACAGG - Intergenic
973379584 4:49310946-49310968 GGAGAGTAGCTGGGAAACACAGG - Intergenic
973379682 4:49311534-49311556 GGAGAGAAGCTGGGAGACACAGG - Intergenic
973380241 4:49315769-49315791 GGAGAGTAGCTGGGAGACACAGG - Intergenic
973380424 4:49316795-49316817 GGAGAGTAGCTGGGACACACAGG - Intergenic
973380503 4:49317233-49317255 GGGGAGTAGCTGGGACAGACAGG - Intergenic
973380583 4:49317674-49317696 GGAGAGAAGCTGGGAGACCCAGG - Intergenic
973381161 4:49321935-49321957 GGAGAGTAGCTGGGAGACACAGG - Intergenic
973381592 4:49324278-49324300 GGGGAGTAGCTGGGACAGACAGG - Intergenic
973381668 4:49324719-49324741 GGAGAGAAGCTGGGAGACCCAGG - Intergenic
973382249 4:49328980-49329002 GGAGAGTAGCTGGGAGACACAGG - Intergenic
973382573 4:49330741-49330763 GGAGAGAAGCTGGGAGACCCAGG - Intergenic
973385784 4:49513592-49513614 GGAGAGTAGCTGGGAGACACAGG - Intergenic
973386002 4:49514765-49514787 GGAGAGTAGCTGGGACACACAGG - Intergenic
973386054 4:49515056-49515078 GGAGAGTAGCTGGGACACACAGG - Intergenic
973386112 4:49515350-49515372 GGGGAGTAGCTGGGACAGACAGG - Intergenic
973386186 4:49515790-49515812 GGAGAGAAGCTGGGAGACCCAGG - Intergenic
974590565 4:63942972-63942994 GTGGAGGGGGTGGGAGGCTCAGG + Intergenic
975969499 4:80016407-80016429 GTGGAGGAACTGAGACAGACAGG - Intronic
976053291 4:81032285-81032307 TGGGAGGAGCTGGGAGACAAGGG + Intronic
976401812 4:84615473-84615495 GTGGAGTTGCTGGAAGACAAAGG - Intronic
977966064 4:103149779-103149801 GAAGGGTAGCTGGGAGACACTGG + Intronic
981320111 4:143381822-143381844 GTGGAAGAGATGGAAGACTCTGG - Intronic
983540795 4:168907501-168907523 GTGGAGGAGCTGTGAGCTAGAGG + Intronic
986079312 5:4373220-4373242 CTGGAGGAGCTGAGTCACACTGG + Intergenic
986190929 5:5495280-5495302 GTGGAGGATCTGGGGCACAGGGG - Intergenic
987863014 5:23508959-23508981 GCCTAGGAGCTGGGAGACTCAGG + Exonic
988454397 5:31374233-31374255 CTGGAGAAGCTGGCAGACAATGG + Intergenic
990559796 5:56972515-56972537 CAGGAGGAGCTGGGAGCCAATGG + Intergenic
992461351 5:76963379-76963401 GTGGAGCTGCTGGGAGGAACTGG + Exonic
992616473 5:78550490-78550512 GTGAAGGCACAGGGAGACACTGG + Intronic
992682859 5:79170100-79170122 ATGGAGAAGATGGAAGACACTGG - Intronic
992993804 5:82313045-82313067 GGGTAGGAGGTGGGGGACACAGG - Intronic
993086292 5:83367701-83367723 GTGGAGAAGATGGGAGAGGCTGG + Intergenic
993396062 5:87390412-87390434 GGGGAGGGGCGGGGAGAAACAGG - Intronic
995857158 5:116605486-116605508 GGTGAGGAGGTTGGAGACACTGG + Intergenic
997468903 5:134105715-134105737 GCACAGGAGCTGGGAGACCCGGG - Intergenic
997507900 5:134432806-134432828 GTGGAACTGCTGGGAGACAGAGG - Intergenic
997690966 5:135827287-135827309 GTGGAGGAGCAGGGATCCAGTGG - Intergenic
998262971 5:140645224-140645246 GGGGAGGAGCTGGGACCCAAAGG - Exonic
998664988 5:144287067-144287089 GGGGAGGAGCTGGGAGTGGCTGG + Intronic
999077946 5:148815019-148815041 GTGGAGCATCCAGGAGACACAGG - Intergenic
999100623 5:149022397-149022419 GTGGTGAAGATGGGAGACATTGG + Intronic
999103399 5:149046794-149046816 ATTCAGGAACTGGGAGACACTGG - Intronic
999505268 5:152188113-152188135 GTGGAGGAGGTTGGGCACACTGG + Intergenic
1000210155 5:159100789-159100811 GTGGAGGAGACGGGAGAGCCCGG + Intergenic
1002029221 5:176416052-176416074 GGGCAGGAGCTGGGAGACGTGGG - Intronic
1002108288 5:176891152-176891174 GTGCTGGAGCTGGGGGCCACAGG - Exonic
1002345154 5:178543661-178543683 GAGGAGGAGCTGAGAGATGCAGG - Intronic
1002375903 5:178788985-178789007 GGGCAGAAGCTGGGAGACTCAGG - Intergenic
1002523499 5:179803842-179803864 GTGGAGGAGCTGGCAGGCGGGGG - Intronic
1003728566 6:8793948-8793970 GTGGAGAAACAGGGAGGCACTGG - Intergenic
1003863704 6:10344643-10344665 GTGGAGGAAATGGGAGATGCTGG + Intergenic
1004216900 6:13711660-13711682 GTTGAGGAGCTCGGAGACGCGGG + Intergenic
1004349967 6:14882488-14882510 AAAGAGGAGCTGTGAGACACAGG + Intergenic
1004452951 6:15764167-15764189 ATGGAAGAGCTGGGAGAGATTGG - Intergenic
1005303925 6:24495663-24495685 GTGGAGGGGCGGGGAGAAAGGGG + Intronic
1006465923 6:34194996-34195018 GTGGAGGAGGTCAGAGACCCTGG - Intergenic
1006642835 6:35497443-35497465 GTGGAGGGGCCGGGAGCCCCGGG - Intergenic
1006944807 6:37778178-37778200 GAGGAGGAGCTGGGAGATGTGGG - Intergenic
1007704979 6:43785100-43785122 GAGGAGGAGATGAGAGACTCTGG + Exonic
1011171548 6:84510210-84510232 ACGAAGGAGCTGGGAGACATAGG - Intergenic
1011699725 6:89944195-89944217 TTGGAGGATCTAGGAGTCACAGG + Intronic
1011995719 6:93585246-93585268 GTGCAGGAGCAGGGGGAAACCGG - Intergenic
1013186077 6:107759442-107759464 GTGGTCTAGCTGAGAGACACTGG + Intronic
1014397349 6:120942019-120942041 ATAGAGAAGCTGGGAGAGACTGG + Intergenic
1016949467 6:149566304-149566326 GGGGAGGGGCGGGGAGAGACGGG - Exonic
1017067876 6:150547043-150547065 TTGGAGGTGTTTGGAGACACCGG - Intergenic
1017839475 6:158209877-158209899 GTGGAGGGGGTGGGAGGCTCAGG + Intergenic
1018429802 6:163713776-163713798 GTGGAGGAGCTGGGTGCCCAGGG - Intergenic
1018640219 6:165898174-165898196 GTGAAGGAGATGGGAGGCAGCGG - Intronic
1018840622 6:167514145-167514167 GTGGTGGGGCTGGGGGACTCGGG + Intergenic
1018924525 6:168197178-168197200 GGGGAGGAGCAGGGAGGCAAGGG + Intergenic
1019053466 6:169202269-169202291 CTGGGGGAGCAGGGAGACTCGGG + Intergenic
1019171496 6:170135820-170135842 GGGGAGGAGCTGGCAGAGAGTGG - Intergenic
1019259592 7:73615-73637 GTTGAGAAGTGGGGAGACACAGG + Intergenic
1019299680 7:296810-296832 GAGGAGGTGCTGGGAGGCACTGG + Intergenic
1019299825 7:297298-297320 GAGGAGGTGCTGGGAGGCACTGG + Intergenic
1019528006 7:1489463-1489485 GAGGAGGAGCTGGGAGAAGCGGG - Intronic
1019531516 7:1505929-1505951 GATGAGGAGATGGGACACACCGG - Intergenic
1019542469 7:1557810-1557832 GTGGAGGAGTTGGGAAAAGCAGG - Intronic
1019613179 7:1947166-1947188 GTGCAGGAGCTGGGTGCCATGGG + Intronic
1019656925 7:2200877-2200899 GTGCAGGAGCTGGGAGGAGCGGG + Intronic
1019863531 7:3683592-3683614 GTGGAGGACCTGGGAGGAACGGG - Intronic
1020216852 7:6198926-6198948 ATGGAGGAGGTTGGACACACTGG + Intronic
1021508485 7:21410477-21410499 CTGGAGCAGATGGGACACACAGG + Intergenic
1021510834 7:21430108-21430130 GTGGAGGAGGAGGGAGATTCTGG - Exonic
1023384010 7:39636830-39636852 GTGGAGCAGGAGAGAGACACGGG + Intronic
1023411744 7:39894833-39894855 ATGGAGGAGCTGTGAGCCACGGG + Intergenic
1023752803 7:43388096-43388118 GAGGAGGAGCTGGCAGAGAAAGG + Intronic
1023986453 7:45099961-45099983 GGGAAGAAGCTGGGAGAGACAGG + Intergenic
1024012491 7:45281304-45281326 GTGGTGGAGCTGGGAGGGAGGGG + Intergenic
1024294326 7:47830646-47830668 GTTGAGGAGAGGGGAGAGACGGG + Intronic
1024923587 7:54587764-54587786 GTGGAGGAGGAGGAAGACACTGG - Intergenic
1025030941 7:55556229-55556251 CAGGAGGAGGTGGGAGAGACAGG + Intronic
1026503245 7:70960513-70960535 TGGGAGGAGCTGGGATACAGAGG + Intergenic
1026684051 7:72493148-72493170 GGGGAGGTGGTGGGAGACCCGGG - Intergenic
1027193698 7:76013344-76013366 GTGGAGGAGATGGGGGAGACTGG + Intronic
1028516242 7:91680828-91680850 TTGGTGGATCTGGGAGACAGTGG + Intergenic
1029921413 7:104268714-104268736 GGGGAAGAGCTGGGAGAGAAAGG - Intergenic
1030322690 7:108185967-108185989 CCAGAGGAGCTGGGAGACAGGGG + Intronic
1030836101 7:114288088-114288110 GTGGAAGATCTGGAAGAAACAGG + Intronic
1032071000 7:128806949-128806971 GTGGAGGAGCTGGCAGTGAGGGG + Intronic
1034073977 7:148214137-148214159 GTGCAGGATCAGGTAGACACAGG - Intronic
1034485990 7:151362901-151362923 GTGGAGGATTTGGTAGTCACAGG + Intronic
1035130723 7:156650732-156650754 GTGTGGGAGCAGGGAGAGACAGG - Intronic
1035443805 7:158925802-158925824 GGGAAGGAGCTGGGAGGCAGAGG - Intronic
1035483422 7:159204094-159204116 GGAGAGGAGCTGGGAGCCTCCGG - Intergenic
1035559903 8:596453-596475 GGTGAGGAGCAGGGAGACACAGG + Intergenic
1036286429 8:7447638-7447660 GAAGAGGTGCTGGGAGACCCAGG - Intronic
1036335047 8:7863890-7863912 GAAGAGGTGCTGGGAGACCCAGG + Intronic
1036668112 8:10761253-10761275 GTGGAGGAGGAGGGAGGCAGAGG + Intronic
1036772340 8:11587894-11587916 GTGGCCTGGCTGGGAGACACTGG - Intergenic
1036915005 8:12796534-12796556 ACGGAGGAGGTGGGAGGCACAGG - Intergenic
1036932028 8:12965664-12965686 GTGGAGGAGCTTGTGGAGACAGG + Intronic
1039550780 8:38441326-38441348 AGGGAGGAGGTGGGGGACACTGG - Intronic
1040060606 8:43100181-43100203 GTGGTGGAGCCGGGAGAGACTGG + Intronic
1040509868 8:48084339-48084361 GGAGAGGAGCTGGGAGACATGGG + Intergenic
1040509909 8:48084477-48084499 GGAGAGGAGCTGGGAGGCACTGG + Intergenic
1040509960 8:48084773-48084795 GGGGAGTAGCTGGGAGAGACAGG + Intergenic
1040834525 8:51718277-51718299 GGGGAGGAGCTGGGAGATTGTGG + Intronic
1041712608 8:60907941-60907963 CTGGGGGTGATGGGAGACACTGG - Intergenic
1042433150 8:68732038-68732060 GTGAAGGTGTTGGGACACACTGG + Intronic
1042435879 8:68764098-68764120 GTGGACGAGCTTGGACATACAGG + Intronic
1043352459 8:79377294-79377316 ATGGAGGGGGTGGGAGACTCAGG + Intergenic
1043366517 8:79539438-79539460 GTAGTGGAGGTGGGAGAGACTGG - Intergenic
1044673438 8:94706256-94706278 ATGGTGGAGATGGTAGACACTGG - Exonic
1046321951 8:112590439-112590461 TTGGAGGGGGTGGGAGACAAAGG + Intronic
1047443981 8:124903277-124903299 AGGAAGGAGCTGGGGGACACCGG + Intergenic
1047461603 8:125070972-125070994 CTGGAAGAGCTGTGAGACAGGGG + Intronic
1047870539 8:129077328-129077350 GTGGTGGAGCTGGGAGGTCCTGG + Intergenic
1048462303 8:134631419-134631441 GGGCAGGAGTCGGGAGACACGGG + Intronic
1049454670 8:142680876-142680898 GATGAGGAGCTGGGAGACATGGG + Intronic
1051896312 9:21993643-21993665 GTGGAGGACCCGTGAGATACGGG - Intronic
1052095606 9:24380250-24380272 GTAGGGGAGCAGGGAGACACAGG + Intergenic
1053590956 9:39514085-39514107 GTGCAGGAACTGTGAGACACAGG - Intergenic
1054575350 9:66851205-66851227 GTGCAGGAACTGTGAGACACAGG + Intergenic
1056032783 9:82570272-82570294 GAGAAGGAGCTTGGAGACCCTGG + Intergenic
1056474575 9:86941421-86941443 TTTGAGTAGCTGGGAGAAACAGG + Intergenic
1056705369 9:88948066-88948088 GTGAAGGAGGTAGGAGACAGTGG + Intergenic
1056848344 9:90059394-90059416 GTGGAGGGGCTGGGAGAGGCAGG + Intergenic
1058178494 9:101767108-101767130 GTGGAGAAGCAGGGAGATGCAGG + Intergenic
1060221476 9:121766273-121766295 GAGGAGGAGCAGGGAGACCCAGG - Intronic
1061295939 9:129676757-129676779 GTGTGGGTGCTGGGAGACCCGGG + Intronic
1061488088 9:130930406-130930428 GGGGAGACGCGGGGAGACACGGG + Intronic
1061967631 9:134025238-134025260 GAGGAGGAGCTGGGAGAGGAGGG - Intergenic
1062134671 9:134918821-134918843 GTGGGGGATCCAGGAGACACAGG + Intergenic
1062287050 9:135777964-135777986 ATGGAGGAGCTGGGAGACAGAGG - Intronic
1062287056 9:135777997-135778019 TGGGAGGAGCTGGGAGCCACAGG - Intronic
1062353630 9:136151726-136151748 GCGGAGGAGCTGCGAGAAAGCGG + Intergenic
1062403064 9:136380842-136380864 GTGGAACAGCTGCGGGACACAGG + Exonic
1062580048 9:137225380-137225402 GGGTGGCAGCTGGGAGACACCGG + Intronic
1062737128 9:138143700-138143722 GAGGAGGAGCAGGAAGGCACTGG + Intergenic
1062745108 9:138206848-138206870 GTTGAGAAGTGGGGAGACACAGG - Intergenic
1203698548 Un_GL000214v1:117605-117627 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1203698671 Un_GL000214v1:118337-118359 GGAGAGTAGCTGGGACACACAGG + Intergenic
1203698879 Un_GL000214v1:119510-119532 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203699467 Un_GL000214v1:123756-123778 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1203699836 Un_GL000214v1:125808-125830 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203700413 Un_GL000214v1:130039-130061 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1203700738 Un_GL000214v1:131800-131822 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203701328 Un_GL000214v1:136059-136081 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1203701483 Un_GL000214v1:136937-136959 GGAGAGTAGCTGGGACACACAGG + Intergenic
1203479572 Un_GL000224v1:398-420 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203480158 Un_GL000224v1:4642-4664 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1203480268 Un_GL000224v1:5230-5252 GGAGAGTAGCTGGGACACACAGG + Intergenic
1203480319 Un_GL000224v1:5521-5543 GGAGAGTAGCTGGGACACACAGG + Intergenic
1203480539 Un_GL000224v1:6694-6716 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203481125 Un_GL000224v1:10970-10992 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1203481235 Un_GL000224v1:11558-11580 GGAGAGTAGCTGGGACACACAGG + Intergenic
1203481286 Un_GL000224v1:11849-11871 GGAGAGTAGCTGGGACACACAGG + Intergenic
1203481506 Un_GL000224v1:13022-13044 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203482089 Un_GL000224v1:17279-17301 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1203482199 Un_GL000224v1:17867-17889 GGAGAGTAGCTGGGACACACAGG + Intergenic
1203482250 Un_GL000224v1:18158-18180 GGAGAGTAGCTGGGACACACAGG + Intergenic
1203482469 Un_GL000224v1:19331-19353 GGAGAGTAGCTTGGAGACACAGG + Intergenic
1203548654 Un_KI270743v1:150999-151021 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1203548733 Un_KI270743v1:151440-151462 GGGGAGTAGCTGGGACAGACAGG + Intergenic
1203548759 Un_KI270743v1:151587-151609 GGAGAGTAGCTGGGACACACAGG + Intergenic
1203548836 Un_KI270743v1:152022-152044 GGAGAGTAGCTGGGACACACAGG + Intergenic
1203549058 Un_KI270743v1:153195-153217 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203549392 Un_KI270743v1:155354-155376 GGAGAGTAGCTGGGAGACACAGG - Intergenic
1203549606 Un_KI270743v1:156527-156549 GGAGAGTAGCTGGGACACACAGG - Intergenic
1203549657 Un_KI270743v1:156818-156840 GGAGAGTAGCTGGGACACACAGG - Intergenic
1203549684 Un_KI270743v1:156965-156987 GGGGAGTAGCTGGGACAGACAGG - Intergenic
1203549763 Un_KI270743v1:157406-157428 GGAGAGAAGCTGGGAGACCCAGG - Intergenic
1203550350 Un_KI270743v1:161666-161688 GGAGAGTAGCTGGGAGACACAGG - Intergenic
1203550463 Un_KI270743v1:162254-162276 GGAGAGGAGCTGGGACAGACAGG - Intergenic
1203550548 Un_KI270743v1:162692-162714 GGAGAGTAGCTGGGACACACAGG - Intergenic
1203568119 Un_KI270744v1:108750-108772 GGAGAGAAGCTGGGAGGCACAGG + Intergenic
1203568223 Un_KI270744v1:109338-109360 GGAGAGTAGCTGGGACACACAGG + Intergenic
1203568298 Un_KI270744v1:109773-109795 GGAGAGTAGCTGGGACACACAGG + Intergenic
1203568369 Un_KI270744v1:110208-110230 GGAGAGTAGCTGGGACACACAGG + Intergenic
1203568463 Un_KI270744v1:110787-110809 GGAGAGTAGCTGGGAGAGACTGG + Intergenic
1203568604 Un_KI270744v1:111522-111544 GGAGAGTAGCTGGGAGACCCAGG + Intergenic
1203569176 Un_KI270744v1:115756-115778 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1203569759 Un_KI270744v1:119993-120015 GGAGAGAAGCTGGGAGACCCAGG + Intergenic
1203569859 Un_KI270744v1:120581-120603 GGAGAGTAGCTGGGACACACAGG + Intergenic
1203569911 Un_KI270744v1:120872-120894 GGAGAGTAGCTGGGACACACAGG + Intergenic
1203570125 Un_KI270744v1:122045-122067 GGAGAGTAGCTGGGAGACACAGG + Intergenic
1185499056 X:583989-584011 GTGGAGGAGGAGGGAGACAGAGG + Intergenic
1185616894 X:1427494-1427516 GTGGAGGACGTGGCAGAGACTGG + Intronic
1186062054 X:5719547-5719569 GTGGAGGTGATGGGAGACTCAGG - Intergenic
1186130666 X:6462037-6462059 GAGAACGAGCTGGGAGCCACAGG - Intergenic
1186364221 X:8874529-8874551 GTGGAGGGGCTGGGAGGGCCAGG + Intergenic
1188797138 X:34481188-34481210 GGTGAGGTGCTGGTAGACACAGG + Intergenic
1189248153 X:39579483-39579505 GTAGTGGGGCTGGGAGCCACTGG - Intergenic
1190016689 X:46833665-46833687 GAGGAGGCACTGGGAAACACAGG + Intergenic
1190062725 X:47221574-47221596 GGGGAGGGGCTGGGGGAGACTGG - Intronic
1190990917 X:55549389-55549411 GTGGGGGAGGTGGGCTACACTGG - Intergenic
1191590095 X:62873040-62873062 GTGAAGGAGCTGGGTGAGGCTGG - Intergenic
1191898986 X:66022121-66022143 CTGGAGCCGCTGGGAGTCACTGG - Exonic
1192161706 X:68793217-68793239 GTGGCAGAGGTGGGAGATACTGG + Intergenic
1193553239 X:82924793-82924815 GAGGAGGTGCTGAGAGACATAGG - Intergenic
1194824012 X:98539666-98539688 GTGGAGGGGCTGGGAGAGATGGG + Intergenic
1196748679 X:119095022-119095044 GTGGAGGAGCAGGGCGGCAGAGG - Intronic
1200064859 X:153499509-153499531 GTGGAGGGGCTGGGAAACCCCGG - Intronic
1200106405 X:153715695-153715717 GTGGAGCAGAGAGGAGACACGGG + Intronic
1200204797 X:154308165-154308187 GTGGAGGAGGTAGGAGGCACTGG + Intronic
1201535020 Y:15037827-15037849 GTGGAGGTGATAGGAGACCCAGG + Intergenic
1201719282 Y:17079044-17079066 GTGGAGCACATGGGAGAAACAGG + Intergenic