ID: 1184639856

View in Genome Browser
Species Human (GRCh38)
Location 22:45864777-45864799
Sequence CCTTCCTGGGGAGCAGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184639856_1184639868 15 Left 1184639856 22:45864777-45864799 CCCGGCCCTGCTCCCCAGGAAGG No data
Right 1184639868 22:45864815-45864837 GTGAGACCGTTCTTTAACCAAGG No data
1184639856_1184639870 20 Left 1184639856 22:45864777-45864799 CCCGGCCCTGCTCCCCAGGAAGG No data
Right 1184639870 22:45864820-45864842 ACCGTTCTTTAACCAAGGGAAGG No data
1184639856_1184639872 21 Left 1184639856 22:45864777-45864799 CCCGGCCCTGCTCCCCAGGAAGG No data
Right 1184639872 22:45864821-45864843 CCGTTCTTTAACCAAGGGAAGGG No data
1184639856_1184639866 -7 Left 1184639856 22:45864777-45864799 CCCGGCCCTGCTCCCCAGGAAGG No data
Right 1184639866 22:45864793-45864815 AGGAAGGTCCTTGGGAAGAAAGG No data
1184639856_1184639869 16 Left 1184639856 22:45864777-45864799 CCCGGCCCTGCTCCCCAGGAAGG No data
Right 1184639869 22:45864816-45864838 TGAGACCGTTCTTTAACCAAGGG No data
1184639856_1184639873 25 Left 1184639856 22:45864777-45864799 CCCGGCCCTGCTCCCCAGGAAGG No data
Right 1184639873 22:45864825-45864847 TCTTTAACCAAGGGAAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184639856 Original CRISPR CCTTCCTGGGGAGCAGGGCC GGG (reversed) Intergenic