ID: 1184643447

View in Genome Browser
Species Human (GRCh38)
Location 22:45884037-45884059
Sequence CTGTAATTTCAGATGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184643441_1184643447 -7 Left 1184643441 22:45884021-45884043 CCTGAGCCCAGCGGCCCTGTAAT No data
Right 1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG No data
1184643436_1184643447 16 Left 1184643436 22:45883998-45884020 CCAGCCGTGGGCACAGGCCAGAC No data
Right 1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG No data
1184643433_1184643447 22 Left 1184643433 22:45883992-45884014 CCTCACCCAGCCGTGGGCACAGG No data
Right 1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG No data
1184643439_1184643447 -1 Left 1184643439 22:45884015-45884037 CCAGACCCTGAGCCCAGCGGCCC No data
Right 1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG No data
1184643435_1184643447 17 Left 1184643435 22:45883997-45884019 CCCAGCCGTGGGCACAGGCCAGA No data
Right 1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG No data
1184643437_1184643447 12 Left 1184643437 22:45884002-45884024 CCGTGGGCACAGGCCAGACCCTG No data
Right 1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG No data
1184643440_1184643447 -6 Left 1184643440 22:45884020-45884042 CCCTGAGCCCAGCGGCCCTGTAA No data
Right 1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184643447 Original CRISPR CTGTAATTTCAGATGTAGCT GGG Intergenic
No off target data available for this crispr