ID: 1184648413

View in Genome Browser
Species Human (GRCh38)
Location 22:45908401-45908423
Sequence CAGGTGAGCCAACCTGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184648403_1184648413 17 Left 1184648403 22:45908361-45908383 CCTCCTGGGATGTGGCAGGTGGG No data
Right 1184648413 22:45908401-45908423 CAGGTGAGCCAACCTGTGCCTGG No data
1184648407_1184648413 -6 Left 1184648407 22:45908384-45908406 CCAGTCCGTCCTAACCCCAGGTG No data
Right 1184648413 22:45908401-45908423 CAGGTGAGCCAACCTGTGCCTGG No data
1184648405_1184648413 14 Left 1184648405 22:45908364-45908386 CCTGGGATGTGGCAGGTGGGCCA No data
Right 1184648413 22:45908401-45908423 CAGGTGAGCCAACCTGTGCCTGG No data
1184648400_1184648413 22 Left 1184648400 22:45908356-45908378 CCAGGCCTCCTGGGATGTGGCAG No data
Right 1184648413 22:45908401-45908423 CAGGTGAGCCAACCTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184648413 Original CRISPR CAGGTGAGCCAACCTGTGCC TGG Intergenic
No off target data available for this crispr