ID: 1184649257

View in Genome Browser
Species Human (GRCh38)
Location 22:45912242-45912264
Sequence GTCGCCCTTCAGGCCTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184649257_1184649267 8 Left 1184649257 22:45912242-45912264 CCCACTGAGGCCTGAAGGGCGAC No data
Right 1184649267 22:45912273-45912295 GGGGCTGTGTCTCTGCCTGAGGG No data
1184649257_1184649266 7 Left 1184649257 22:45912242-45912264 CCCACTGAGGCCTGAAGGGCGAC No data
Right 1184649266 22:45912272-45912294 AGGGGCTGTGTCTCTGCCTGAGG No data
1184649257_1184649270 24 Left 1184649257 22:45912242-45912264 CCCACTGAGGCCTGAAGGGCGAC No data
Right 1184649270 22:45912289-45912311 CTGAGGGAACTGCCAAGGTGAGG No data
1184649257_1184649271 28 Left 1184649257 22:45912242-45912264 CCCACTGAGGCCTGAAGGGCGAC No data
Right 1184649271 22:45912293-45912315 GGGAACTGCCAAGGTGAGGCTGG No data
1184649257_1184649272 29 Left 1184649257 22:45912242-45912264 CCCACTGAGGCCTGAAGGGCGAC No data
Right 1184649272 22:45912294-45912316 GGAACTGCCAAGGTGAGGCTGGG No data
1184649257_1184649268 19 Left 1184649257 22:45912242-45912264 CCCACTGAGGCCTGAAGGGCGAC No data
Right 1184649268 22:45912284-45912306 TCTGCCTGAGGGAACTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184649257 Original CRISPR GTCGCCCTTCAGGCCTCAGT GGG (reversed) Intergenic
No off target data available for this crispr