ID: 1184650079

View in Genome Browser
Species Human (GRCh38)
Location 22:45915644-45915666
Sequence AGATGGAGTTAGTGGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184650079_1184650091 25 Left 1184650079 22:45915644-45915666 CCCAGCTCCCACTAACTCCATCT No data
Right 1184650091 22:45915692-45915714 CTCGCCGCTTCCTTTCCCTCTGG No data
1184650079_1184650085 2 Left 1184650079 22:45915644-45915666 CCCAGCTCCCACTAACTCCATCT No data
Right 1184650085 22:45915669-45915691 ACTGTCCCTTCAGTTACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184650079 Original CRISPR AGATGGAGTTAGTGGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr