ID: 1184651313

View in Genome Browser
Species Human (GRCh38)
Location 22:45920603-45920625
Sequence CTGTTGAAGCAGGAGGAGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1077
Summary {0: 1, 1: 0, 2: 0, 3: 53, 4: 1023}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184651300_1184651313 24 Left 1184651300 22:45920556-45920578 CCAAGGGACAGTGCGAGTGTCTC 0: 1
1: 0
2: 1
3: 9
4: 126
Right 1184651313 22:45920603-45920625 CTGTTGAAGCAGGAGGAGCCTGG 0: 1
1: 0
2: 0
3: 53
4: 1023

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184651313 Original CRISPR CTGTTGAAGCAGGAGGAGCC TGG Exonic
900154729 1:1199329-1199351 GGGGTGAAGCAGGAGGGGCCTGG + Intergenic
900687513 1:3958242-3958264 CCCTTGGAGCAGGAGGAGCTTGG + Intergenic
900961891 1:5927768-5927790 CAGGTGAAGCAGGTGGAGTCGGG - Exonic
901534882 1:9875592-9875614 GAGTTGAAGCAGGAGTAGCCTGG - Intronic
901727369 1:11252627-11252649 GTGCAGAAGCAGGAGGAGTCTGG - Intronic
901780656 1:11592413-11592435 CTGTTGATGAGGGAGGACCCAGG + Intergenic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
902602672 1:17550833-17550855 CTGGTGGAGGAGGAGGAGCCAGG + Intronic
903260871 1:22131339-22131361 TTGTTGAAGGTGGAGGTGCCTGG + Intronic
905060870 1:35137839-35137861 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
905499431 1:38425278-38425300 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
905500225 1:38430533-38430555 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
906080564 1:43085685-43085707 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
906352876 1:45079106-45079128 CTTTTGAGCCAGGATGAGCCAGG - Intronic
906744069 1:48209226-48209248 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
907295469 1:53449579-53449601 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
907373923 1:54020332-54020354 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
907491583 1:54812061-54812083 CTTTTGAAGAAGTAGGTGCCGGG - Exonic
908280604 1:62530883-62530905 CAGTGGGAGAAGGAGGAGCCAGG - Intronic
908407402 1:63828836-63828858 GTGCTGAAGCAGGAGTAGCCTGG - Intronic
909035126 1:70588549-70588571 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
909035914 1:70593746-70593768 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
909550582 1:76895034-76895056 CTTTTGAGCCAGGATGAGCCAGG + Intronic
909777017 1:79493937-79493959 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
909787821 1:79638979-79639001 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
910002244 1:82354791-82354813 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
910003085 1:82360382-82360404 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
910049016 1:82955475-82955497 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
910049907 1:82961349-82961371 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
910082887 1:83362909-83362931 CTGTTGTAGCAGGAAGAGGTGGG - Intergenic
910094468 1:83505247-83505269 CTCTGGAAGGAGGAGGAGGCAGG - Intergenic
910614408 1:89181331-89181353 CTTTTGAGCCAGGATGAGCCAGG + Exonic
911147462 1:94566690-94566712 CTTTTGAGGCAGGATGAGCCAGG + Intergenic
911148373 1:94572607-94572629 CTTTTGAGCCAGGACGAGCCAGG + Intergenic
911759207 1:101597441-101597463 CTTTTGAGACAGGATGAGCCAGG + Intergenic
911760071 1:101603309-101603331 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
912296901 1:108478397-108478419 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
912544025 1:110438131-110438153 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
912813263 1:112809831-112809853 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
912814790 1:112820357-112820379 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
912932806 1:113979922-113979944 CTGTTGAAGTTGGAGGTTCCCGG + Intronic
913249663 1:116902264-116902286 CTGTTGAGGCAGGAGAATCAGGG + Intergenic
913556188 1:119969552-119969574 CGGTCGATGCAGGTGGAGCCTGG + Exonic
914421778 1:147535015-147535037 CTCTTGCAGAAGGAGCAGCCAGG - Intergenic
914804702 1:150983481-150983503 CTGTAGACCAAGGAGGAGCCAGG + Intronic
914946370 1:152070393-152070415 CTACTGAAGGAGGAGGAGGCAGG + Intergenic
915346933 1:155202355-155202377 GTGTTGATGCAGCTGGAGCCCGG + Exonic
915552999 1:156646099-156646121 CTGCTAAAGCTGCAGGAGCCTGG - Exonic
916328573 1:163591461-163591483 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
916329293 1:163596284-163596306 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
918389818 1:184047670-184047692 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
919306633 1:195848360-195848382 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
919476017 1:198034815-198034837 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
920096685 1:203491144-203491166 CTTTTGAGCCAGGATGAGCCAGG - Exonic
920215437 1:204359101-204359123 CTCTTGAAGGAGCTGGAGCCTGG - Intronic
920302920 1:205000403-205000425 CTTTTGAAGCTGGAGGAGAATGG - Intronic
921508940 1:216008307-216008329 CTTTTGAGCCAGGATGAGCCAGG - Intronic
921509725 1:216013623-216013645 CTTTTGAGCCAGGATGAGCCAGG - Intronic
922363018 1:224840153-224840175 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
922363879 1:224845908-224845930 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
922460404 1:225810797-225810819 CTTTTGAGCCAGGATGAGCCAGG + Intronic
923000397 1:230002283-230002305 CAGGTGCAGCAGGAGGAGCAAGG + Intergenic
923002407 1:230018428-230018450 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
923213662 1:231829898-231829920 CTTTTGAGCCAGGATGAGCCAGG + Intronic
923214466 1:231835462-231835484 CTTTTGAGCCAGGATGAGCCAGG + Intronic
923963244 1:239106827-239106849 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
924180275 1:241434053-241434075 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
924743695 1:246813362-246813384 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
924896368 1:248340920-248340942 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1062930466 10:1349183-1349205 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1062931260 10:1354334-1354356 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1063231290 10:4067872-4067894 CTGATGAATGAGGAGGAGCCGGG - Intergenic
1063306703 10:4909329-4909351 CCTGTGCAGCAGGAGGAGCCTGG + Intergenic
1063362754 10:5470931-5470953 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1063394491 10:5674283-5674305 ATGTTGGAGGAGGAGGGGCCTGG - Intergenic
1064147914 10:12840055-12840077 CTCTTGAAGCAGGGGCAGCTTGG - Intergenic
1064887359 10:20124748-20124770 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1065437285 10:25716585-25716607 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1065438173 10:25722681-25722703 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1065455490 10:25902613-25902635 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1066564878 10:36710872-36710894 CTGTTGAGCCAGGGGGATCCAGG + Intergenic
1067042466 10:42962309-42962331 CTGCTGCATCAGGAGGGGCCAGG + Intergenic
1067360033 10:45571326-45571348 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1067741637 10:48899977-48899999 CTGTTGAAGCAGGAAGCGAAAGG - Intronic
1067770116 10:49116562-49116584 CTGTAGGAGGAGGAGGAGACAGG + Intergenic
1067998039 10:51298443-51298465 CTGTTGAAAAAGGAAGAACCTGG - Intronic
1069028614 10:63571399-63571421 CTGTAGAAGCTGGAGTAGACAGG - Intronic
1069411103 10:68154336-68154358 CTGCTGAAGCAGCTGGGGCCAGG - Intronic
1070771042 10:79082496-79082518 CTATTGGAGCAGGAGGGACCTGG + Intronic
1070778656 10:79125026-79125048 CTGTGGCAGCAGGAAGAGCAAGG + Intronic
1070789754 10:79181973-79181995 CTGGAGGAGGAGGAGGAGCCAGG + Intronic
1071008447 10:80910613-80910635 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1071166845 10:82816815-82816837 CAGTTGCAGCAGGAGAAGCATGG - Intronic
1071197824 10:83181955-83181977 GTGTTTAAGTATGAGGAGCCAGG - Intergenic
1071826379 10:89329994-89330016 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1071924021 10:90384716-90384738 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1072010827 10:91301567-91301589 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1072413638 10:95229305-95229327 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1073066904 10:100766495-100766517 CTGTTGGAGCTGGAGGAGGATGG - Intronic
1073250488 10:102117964-102117986 CTGGGGGAGGAGGAGGAGCCCGG + Intronic
1073428744 10:103472223-103472245 ATCTTGAAGGAGGAGGACCCAGG + Intergenic
1073708908 10:106016963-106016985 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1073709769 10:106022872-106022894 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1073779099 10:106817412-106817434 GTGGGGAAGCAGGAGGGGCCTGG - Intronic
1074615369 10:115062054-115062076 CAGTTGGAGGAGGAAGAGCCTGG - Intergenic
1074740418 10:116480839-116480861 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1074741249 10:116486274-116486296 CTTTTGAGTCAGGATGAGCCAGG - Intergenic
1074799349 10:116983574-116983596 ATCTTGAAGCAGGAGGGGCGAGG - Intronic
1074971492 10:118542967-118542989 CTGATGTGGCAGGAGGAGCTTGG + Intergenic
1075105640 10:119538452-119538474 CTGTTGGAGCAGGGGGACCCAGG + Intronic
1076335491 10:129703839-129703861 CTCTTGCTGCAGGAGGTGCCAGG + Intronic
1076752301 10:132549638-132549660 CAGGTGAAGCAGGAGCAGACAGG + Intronic
1076767043 10:132641866-132641888 ATGTTGCATCAGGAGAAGCCCGG - Intronic
1077257038 11:1590281-1590303 CTGTGGAAGCTGGAGCTGCCTGG + Intergenic
1077548088 11:3185206-3185228 ATGTTGGAGGAGGAGGAGGCTGG - Intergenic
1077590187 11:3485052-3485074 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1077611826 11:3648062-3648084 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1077612641 11:3653392-3653414 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1077765935 11:5160521-5160543 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1077766755 11:5165931-5165953 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1078649669 11:13177037-13177059 CTGTTGAAGAAGCAGGAGCATGG + Intergenic
1078872881 11:15365321-15365343 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1079727441 11:23892735-23892757 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1079847115 11:25486719-25486741 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1079854179 11:25579618-25579640 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1080203772 11:29705941-29705963 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1080227022 11:29973393-29973415 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1081543898 11:44056111-44056133 CTAGGGAAGGAGGAGGAGCCAGG + Intronic
1082673137 11:56059494-56059516 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1082688394 11:56268722-56268744 CTGTTGGAGCATGAGGGGCAGGG + Intergenic
1083226444 11:61287822-61287844 CTTTTGAGGCAGCAGGAGACAGG + Intronic
1083487194 11:62990707-62990729 CTGTTGAGGCAGGTTGGGCCTGG + Intronic
1083534229 11:63453952-63453974 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1084353684 11:68622958-68622980 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1084399883 11:68937347-68937369 CTGCAGCAGCAGGAGGGGCCTGG + Intronic
1084612772 11:70214175-70214197 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1084652034 11:70495140-70495162 CTGCTGCAGCCGGAGGAGCTGGG - Intronic
1084796129 11:71505669-71505691 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1085281128 11:75331546-75331568 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1085934732 11:81127241-81127263 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1085987312 11:81802396-81802418 CTTTTGAGTCAGGATGAGCCAGG - Intergenic
1085988557 11:81812433-81812455 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1086132802 11:83419299-83419321 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1086136626 11:83448410-83448432 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1086549900 11:88043557-88043579 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1086550774 11:88049383-88049405 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1086720567 11:90116255-90116277 CTCTAGAAGCAGAGGGAGCCAGG - Intergenic
1087098756 11:94345889-94345911 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1087100111 11:94355299-94355321 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1087127456 11:94641765-94641787 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1087681223 11:101220074-101220096 CTGTTAAAGCAGGGGGAGTTTGG - Intergenic
1087723559 11:101693935-101693957 CTGGGGAACCAGGGGGAGCCTGG + Intronic
1087839061 11:102904135-102904157 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1088555436 11:111055862-111055884 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1088748371 11:112823240-112823262 CTGTTATAGCAGAAGGAGACAGG + Intergenic
1088876492 11:113940778-113940800 GTGATGGAGCAGGAGGTGCCGGG - Intronic
1089470605 11:118717256-118717278 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1089607518 11:119650118-119650140 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1089695173 11:120212097-120212119 CGCTTGCAGCAGGAGGATCCTGG + Intronic
1089987045 11:122824587-122824609 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1089988121 11:122832579-122832601 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1090450206 11:126799672-126799694 GGGGTGGAGCAGGAGGAGCCGGG + Intronic
1090455939 11:126849805-126849827 CTGTTGAGGATGGAGGTGCCTGG + Intronic
1090546012 11:127769134-127769156 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1090546830 11:127774712-127774734 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1090601132 11:128372653-128372675 ATATTCAAGCAGGAGGGGCCAGG + Intergenic
1090927306 11:131260093-131260115 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1091183301 11:133626938-133626960 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1091645951 12:2272390-2272412 CCGGGGAAGCAGGAGGAGGCAGG - Intronic
1091699503 12:2650706-2650728 CTGTTGGACCTGGGGGAGCCTGG - Intronic
1092231804 12:6779934-6779956 CTGCTGGAGCAGGAGGGGCATGG + Intergenic
1092475188 12:8813090-8813112 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1092592205 12:9962662-9962684 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1092789355 12:12058549-12058571 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1092790154 12:12063845-12063867 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1092924337 12:13259843-13259865 CTTTTGAGGCAGGATGAGCCAGG + Intergenic
1092925163 12:13265333-13265355 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1093547788 12:20368860-20368882 CCGCTGACGCTGGAGGAGCCGGG - Intergenic
1093951632 12:25169270-25169292 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1094329472 12:29275280-29275302 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1094401241 12:30062271-30062293 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1095637373 12:44450216-44450238 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1095638154 12:44455820-44455842 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1095805953 12:46321524-46321546 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1095897649 12:47296407-47296429 CTTTTGATCCAGGATGAGCCAGG - Intergenic
1096454337 12:51772683-51772705 CTGTTGATGAAAGTGGAGCCGGG + Intronic
1096583266 12:52601872-52601894 CTTCTGAAGCAGAAGCAGCCTGG - Intergenic
1096995013 12:55832955-55832977 GTCTTGAAGCAGCAGTAGCCTGG - Intergenic
1097542534 12:60957434-60957456 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1097544313 12:60979498-60979520 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1097592081 12:61587235-61587257 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1097690497 12:62730012-62730034 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1097915692 12:65018377-65018399 CTGTTAAAGAAGCAGGGGCCGGG + Intergenic
1098253174 12:68589974-68589996 CTGTGGGAGCCGGAGCAGCCAGG - Intergenic
1098385546 12:69914960-69914982 CTGATGATGGAGGAGAAGCCCGG + Intronic
1098653346 12:73002073-73002095 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1098654187 12:73007541-73007563 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1098841632 12:75484722-75484744 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1099291645 12:80783339-80783361 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1099292458 12:80788706-80788728 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1099296309 12:80832542-80832564 TTATTGAATCAGAAGGAGCCTGG + Intronic
1099382733 12:81975423-81975445 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1099836407 12:87912714-87912736 CTTTTGAGCCAGGAGGAGCCAGG + Intergenic
1100939948 12:99715345-99715367 CTTTTGAGTCAGGATGAGCCAGG - Intronic
1100940860 12:99721491-99721513 CTTTTGAGGCAGGATGAGCCAGG - Intronic
1102278001 12:111598244-111598266 CTGATGATTCCGGAGGAGCCCGG + Intronic
1102600002 12:114022466-114022488 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1103477902 12:121232236-121232258 CTGTGCAAGCAGGAGGATGCGGG - Intronic
1103541964 12:121672486-121672508 CAGTGGAAGAGGGAGGAGCCGGG + Intronic
1104634052 12:130426806-130426828 CTTTTGATGGAGGAAGAGCCCGG - Intronic
1105300956 13:19134156-19134178 CTGCCTCAGCAGGAGGAGCCTGG + Intergenic
1106607762 13:31247030-31247052 CTGATGAAGGAGGAGGACACTGG - Exonic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1108202211 13:48055519-48055541 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1108202324 13:48056521-48056543 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1108203190 13:48062048-48062070 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1108912963 13:55578452-55578474 TTTTTGAACCAGGATGAGCCAGG + Intergenic
1109343261 13:61088622-61088644 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1109344075 13:61094194-61094216 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1109353451 13:61211041-61211063 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1109498933 13:63213306-63213328 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1109499796 13:63218887-63218909 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1109838190 13:67886456-67886478 CTGATGAAACAAGATGAGCCGGG - Intergenic
1109945473 13:69426021-69426043 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1110650021 13:77933446-77933468 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1110765106 13:79274245-79274267 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1110765934 13:79279577-79279599 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1110815727 13:79858263-79858285 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1110978106 13:81866259-81866281 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1111261239 13:85743448-85743470 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1111361653 13:87186671-87186693 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1111362457 13:87191922-87191944 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1112013194 13:95308988-95309010 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1112236488 13:97642477-97642499 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1112237308 13:97647971-97647993 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1112237900 13:97652641-97652663 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1112729523 13:102344937-102344959 CTGTTGAAGCAGGGAAGGCCTGG + Intronic
1112889682 13:104213638-104213660 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1113698267 13:112364339-112364361 AGGTGGAGGCAGGAGGAGCCTGG + Intergenic
1116490078 14:45495131-45495153 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1116534331 14:46012657-46012679 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1116535129 14:46017917-46017939 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1117957426 14:61133456-61133478 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1117958267 14:61138974-61138996 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1118373372 14:65156645-65156667 CTGCTGGAGCGGGAGGAGGCAGG - Intergenic
1118936495 14:70293708-70293730 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1118937664 14:70301757-70301779 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1119022049 14:71124371-71124393 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1119668450 14:76500625-76500647 CTGCTCAAGCTGGAGGACCCAGG + Intronic
1120250901 14:82061127-82061149 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1120395406 14:83961743-83961765 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1120437605 14:84500473-84500495 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1120438406 14:84505787-84505809 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1120539031 14:85732656-85732678 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1120539895 14:85738415-85738437 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1120617968 14:86731751-86731773 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1120618687 14:86736815-86736837 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1120659455 14:87234914-87234936 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1120660323 14:87240605-87240627 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1120741893 14:88117849-88117871 CTTGTGGACCAGGAGGAGCCTGG - Intergenic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121089587 14:91171802-91171824 CTGTTAAGGCAGGAGGCACCAGG + Intronic
1121389162 14:93559614-93559636 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1121389887 14:93564797-93564819 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1121636987 14:95460748-95460770 CTGTTGATGGAGGAGGCTCCAGG - Intronic
1121704136 14:95978626-95978648 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1121980092 14:98447019-98447041 CTTTTGAGTCAGGATGAGCCAGG + Intergenic
1121980862 14:98452440-98452462 CTTTTGAGTCAGGATGAGCCAGG + Intergenic
1122380794 14:101305478-101305500 CTTTTGAACCAGGATGAGCCAGG + Intergenic
1122381652 14:101311073-101311095 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1122482444 14:102055735-102055757 GTTTGGAAGGAGGAGGAGCCAGG - Intergenic
1122785537 14:104161741-104161763 CTATAGAAGCAGGAGGCGCAGGG + Intronic
1123200630 14:106660184-106660206 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1125073931 15:35590818-35590840 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1125212764 15:37236442-37236464 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1125511210 15:40293418-40293440 CTCTTGAAACAGGAGGGCCCAGG + Intronic
1126843391 15:52738742-52738764 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1126844309 15:52744958-52744980 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1127527993 15:59812996-59813018 TTGTTTAAGGAGGAGGAGACAGG - Intergenic
1127779192 15:62296635-62296657 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1129259907 15:74359540-74359562 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1129272656 15:74427694-74427716 CTGGGGGAGGAGGAGGAGCCAGG - Intronic
1129446838 15:75625074-75625096 GGGTTGAAACAGCAGGAGCCCGG - Intronic
1129824509 15:78625823-78625845 ATGATGCAGCAGGAGGAGGCTGG - Intronic
1129869933 15:78933643-78933665 CTGCTGAAGGAGGCGGAGCTCGG + Intronic
1130192134 15:81747498-81747520 ATGTTGCAGCAGGTGGAGCCTGG + Intergenic
1130304237 15:82702529-82702551 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1130305084 15:82708166-82708188 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1131447345 15:92511522-92511544 CTTTTGAGCCAGGATGAGCCTGG - Intergenic
1131448221 15:92517182-92517204 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1131683838 15:94750913-94750935 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1131684636 15:94756224-94756246 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1131685204 15:94760127-94760149 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1132263513 15:100445964-100445986 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1132646917 16:1003420-1003442 CTGTGGCAGCAGGTGGGGCCCGG - Intergenic
1132747327 16:1442488-1442510 TTGCTGCAGCAGGAGGAGCAGGG - Exonic
1133602819 16:7356485-7356507 CTTGTGATGGAGGAGGAGCCTGG + Intronic
1133651045 16:7814850-7814872 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1133651840 16:7820154-7820176 CTTTTGAGCCAGGATGAGCCGGG - Intergenic
1133939284 16:10294997-10295019 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1133962349 16:10505612-10505634 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1134004590 16:10809764-10809786 CTTGGGATGCAGGAGGAGCCTGG - Intronic
1134021415 16:10923858-10923880 ATGCTGTAGCGGGAGGAGCCAGG - Exonic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134300086 16:12983140-12983162 CTGCTGAGGCAGGAAAAGCCAGG + Intronic
1136028389 16:27484958-27484980 CTGGTGCAGCTGGAGGAGGCAGG - Intronic
1136057544 16:27701629-27701651 CCGGGGCAGCAGGAGGAGCCAGG + Exonic
1136398820 16:30006929-30006951 CAGTTGGAGCAGGCGGAGCAGGG - Exonic
1136472479 16:30490509-30490531 GTGAAGAGGCAGGAGGAGCCAGG - Intronic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1137593580 16:49708826-49708848 GTGCTGAAGCAGGAGGAGGCAGG - Intronic
1138246945 16:55474628-55474650 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1138391650 16:56675018-56675040 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1138815732 16:60200882-60200904 CTTTAGAGGCAGGATGAGCCAGG - Intergenic
1141065856 16:80913068-80913090 TTGGAGAAGCAGGAAGAGCCAGG - Intergenic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141461167 16:84179588-84179610 CTGTCCACACAGGAGGAGCCAGG + Exonic
1141855428 16:86677900-86677922 CTGCTGAAGGAGGAGGAAACTGG - Intergenic
1141920832 16:87134321-87134343 CTGTTGACCCTGGAGGGGCCTGG - Intronic
1142143441 16:88482810-88482832 CTCTAGAAGGGGGAGGAGCCGGG + Intronic
1143103838 17:4518789-4518811 CTGCTGAAGCAGGAGTCGCTGGG - Intronic
1144832198 17:18138025-18138047 ATGTTGAATCTGAAGGAGCCTGG - Intronic
1145024621 17:19458554-19458576 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1145207727 17:20993571-20993593 CTGATGCAGCAAGGGGAGCCAGG + Intergenic
1145790543 17:27624027-27624049 CTTTTCCAGCAGGAGCAGCCTGG - Exonic
1146354864 17:32125464-32125486 CTGGAGAAGCAGCAGGGGCCTGG - Intergenic
1146414672 17:32620790-32620812 CTGATGTAGGGGGAGGAGCCAGG + Intronic
1146956078 17:36937014-36937036 CTTTTGCAGCGGGAGGAGTCGGG - Intronic
1147371386 17:39995318-39995340 CTGTTGGAGGAGCAGAAGCCAGG + Intronic
1147447656 17:40484579-40484601 CTGCTGAGGAAGGAGGAGCCAGG - Exonic
1147578094 17:41613910-41613932 CTGTAGAAACAGGACTAGCCGGG + Intronic
1147977206 17:44254713-44254735 GGGTGGGAGCAGGAGGAGCCAGG + Intronic
1148085558 17:44991814-44991836 CTTCTGAAGCAGGTGGAGCTGGG - Intergenic
1148334842 17:46834308-46834330 CTGGAGAAGCAGGTGGTGCCTGG + Intronic
1148930029 17:51120616-51120638 GTGGTGTATCAGGAGGAGCCCGG - Exonic
1149482798 17:57017288-57017310 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1151029879 17:70724162-70724184 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1151840080 17:76611325-76611347 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1152144006 17:78556683-78556705 CTGTACAATCAGGAGGGGCCCGG - Intronic
1152253942 17:79226564-79226586 CCTGTGGAGCAGGAGGAGCCTGG + Intronic
1152316912 17:79586289-79586311 CTGCTGGAGAAGGAAGAGCCAGG + Intergenic
1153773817 18:8435669-8435691 CTGGTGAAACAGGAGGAGTTTGG - Intergenic
1153834814 18:8954517-8954539 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1155174351 18:23289809-23289831 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1155425222 18:25700022-25700044 CTGGAGAAGCTGGAGAAGCCAGG - Intergenic
1155892228 18:31284423-31284445 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1155893031 18:31289750-31289772 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1155941194 18:31803947-31803969 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1155942068 18:31809820-31809842 CTTTTGAGACAGGATGAGCCAGG - Intergenic
1156071433 18:33215848-33215870 AAGTCAAAGCAGGAGGAGCCAGG + Intronic
1156237960 18:35222273-35222295 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1156251452 18:35356365-35356387 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1156252223 18:35361605-35361627 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1156957955 18:42991713-42991735 CTTTTGAGTCAGGATGAGCCAGG - Intronic
1157718869 18:49908060-49908082 CTGCTTAAGCTGGAGGACCCAGG - Intronic
1157721845 18:49931409-49931431 CTGTTGGAGCTGGAGGAGTCGGG - Intronic
1157773613 18:50373338-50373360 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1158484877 18:57857536-57857558 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1159164130 18:64681895-64681917 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1159164940 18:64687087-64687109 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1159424962 18:68272954-68272976 CCATTAAAGGAGGAGGAGCCCGG - Intergenic
1160009480 18:75094038-75094060 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1160802584 19:977186-977208 CTGTTGAGGCAGGAGGCGAGGGG - Intergenic
1160818334 19:1046541-1046563 CTGCTGCAGCGGGAGGAGCAGGG + Intronic
1160837427 19:1131442-1131464 CTTTTGAAGCGGGCAGAGCCAGG - Intronic
1161266434 19:3366727-3366749 GTTTTGAAGCAGGAGGAGGCGGG + Intronic
1163486965 19:17593679-17593701 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1163557481 19:18000991-18001013 CTGTTGAATCAGAAGCAGGCAGG - Intergenic
1164201995 19:23026653-23026675 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1164459616 19:28435577-28435599 CTCTTGAGCCAGGATGAGCCAGG + Intergenic
1165076315 19:33281668-33281690 CTGGGGAGGCAGCAGGAGCCCGG + Intergenic
1165098901 19:33426740-33426762 CTGAGGAAACAGGAGGAGCTGGG + Intronic
1165248905 19:34514248-34514270 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1165372981 19:35421510-35421532 CTGTGGGAGCTGGAGCAGCCTGG - Intergenic
1165835802 19:38755053-38755075 CTTTTGAACCAGGATGAGCCAGG - Intronic
1166192800 19:41186726-41186748 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1166926633 19:46273417-46273439 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1167084031 19:47296913-47296935 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1167099083 19:47393031-47393053 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1167099924 19:47398518-47398540 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1167152219 19:47716844-47716866 CTGCTGGAGCAGGAGGTGCCCGG + Exonic
1167532343 19:50025901-50025923 CTGAAGAAGCAGGAGGAGATGGG + Exonic
1167560782 19:50225768-50225790 CTGTTGAGGGAGGAGGGGCTGGG + Intronic
1167883876 19:52484710-52484732 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1167901806 19:52627957-52627979 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1167902587 19:52633159-52633181 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1168131324 19:54321460-54321482 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1168227538 19:55007051-55007073 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1168228325 19:55012237-55012259 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1168357290 19:55709743-55709765 CTGTTGAGGGAGTAGAAGCCAGG - Intronic
925831418 2:7899669-7899691 GTGTTGAATCATGAGGAGGCTGG - Intergenic
926748488 2:16179858-16179880 GTCTGGAAGCAGGAGGACCCAGG + Intergenic
926863670 2:17336033-17336055 TTTTTGAACCAGGATGAGCCAGG - Intergenic
927139100 2:20117865-20117887 CTGGAAGAGCAGGAGGAGCCCGG + Intergenic
927139139 2:20118033-20118055 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927139152 2:20118075-20118097 CTGGAGGAGCAGGGGGAGCCCGG + Intergenic
927139163 2:20118117-20118139 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927560825 2:24071725-24071747 CTGAAGAATGAGGAGGAGCCAGG + Intronic
928771100 2:34702589-34702611 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
928777976 2:34789984-34790006 CTTTTGAGGCAGGATGAGCCAGG - Intergenic
928778848 2:34795810-34795832 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
928827178 2:35437138-35437160 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
928827952 2:35442401-35442423 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
928988506 2:37205388-37205410 CTTTTGAGCCAGGATGAGCCAGG - Intronic
929069743 2:38017972-38017994 CTTTTGAGCCAGGATGAGCCCGG + Intronic
929076225 2:38081015-38081037 CTTTTGAGCCAGGATGAGCCAGG + Intronic
929077046 2:38086326-38086348 CTTTTGAGCCAGGATGAGCCAGG + Intronic
929598916 2:43192956-43192978 CTGTGGGAGCAGGTGGAGGCTGG - Intergenic
929818741 2:45257082-45257104 CTGTGGAAGCGGGAGGAACATGG + Intergenic
930113457 2:47698493-47698515 CTTTTGAGCCAGGATGAGCCAGG + Intronic
930487648 2:52027414-52027436 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
930510470 2:52337813-52337835 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
930958921 2:57234960-57234982 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
931042341 2:58314328-58314350 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
931089395 2:58869280-58869302 TAGCTGAAGCAGGTGGAGCCAGG + Intergenic
931236522 2:60417587-60417609 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
931608440 2:64075031-64075053 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
931850063 2:66244089-66244111 CTTCTGAACCAGGATGAGCCAGG - Intergenic
931947892 2:67331681-67331703 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
931948727 2:67337366-67337388 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
932158919 2:69443235-69443257 CTTTTGATCCAGGATGAGCCAGG + Intergenic
932159805 2:69449167-69449189 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
932295467 2:70620663-70620685 CTTTTGAGCCAGGATGAGCCAGG - Intronic
932296309 2:70626173-70626195 CTTTTGAGCCAGGATGAGCCAGG - Intronic
932838215 2:75057238-75057260 CTTTTGAGCCAGGATGAGCCAGG - Intronic
932873886 2:75430848-75430870 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
933074045 2:77900414-77900436 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
933138509 2:78764026-78764048 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
933164161 2:79056838-79056860 CTTTTGAGACAGGATGAGCCAGG - Intergenic
933179274 2:79211571-79211593 CTTTTGAGTCAGGATGAGCCAGG + Intronic
933180162 2:79217531-79217553 CTTTTGAGCCAGGATGAGCCAGG + Intronic
933417556 2:82005837-82005859 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
933447327 2:82398499-82398521 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
933552706 2:83794295-83794317 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
933719087 2:85385478-85385500 CTTTTGAGCCAGGATGAGCCAGG + Intronic
934161657 2:89255241-89255263 CAGCTGAAGCAGGATGAGCAGGG + Intergenic
934205627 2:89927174-89927196 CAGCTGAAGCAGGATGAGCAGGG - Intergenic
934737090 2:96695119-96695141 CTGAAGAAGCAGGAAGTGCCTGG - Intergenic
934886691 2:98031278-98031300 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
934905011 2:98192448-98192470 CTTTTGAGCCAGGATGAGCCAGG + Intronic
934930867 2:98421770-98421792 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
935466392 2:103403503-103403525 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
935724941 2:106015618-106015640 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
936154638 2:110040071-110040093 CAGATGCAGCAGGAGAAGCCTGG - Intergenic
936190045 2:110331343-110331365 CAGATGCAGCAGGAGAAGCCTGG + Intergenic
936387091 2:112040429-112040451 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
936794571 2:116189525-116189547 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
936794686 2:116190763-116190785 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
936991319 2:118369588-118369610 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
937072666 2:119076055-119076077 CTATTGAGGCAGCAGGAGCAGGG - Intergenic
937258008 2:120568359-120568381 CTGACACAGCAGGAGGAGCCAGG - Intergenic
937635808 2:124154187-124154209 CTTTTGAGCCAGAAGGAGCCTGG + Intronic
938091374 2:128437001-128437023 CAGTTCAACCAGGAGGACCCAGG - Intergenic
938380236 2:130832322-130832344 GGGGTGAAGCAGGAGGGGCCAGG - Intergenic
938902051 2:135806873-135806895 CAGATGGAGCAGGGGGAGCCTGG - Intronic
939086626 2:137726942-137726964 ATGTTGAAGGTGGAGGAGCATGG - Intergenic
939307129 2:140426556-140426578 CTTTTGAGCCAGGATGAGCCAGG - Intronic
939461027 2:142495161-142495183 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
939787984 2:146540057-146540079 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
940503271 2:154521154-154521176 CTTTTGATCCAGGATGAGCCAGG + Intergenic
940508230 2:154582862-154582884 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
940529829 2:154867477-154867499 CTTTTGAGACAGGATGAGCCAGG - Intergenic
940530861 2:154874314-154874336 CTTTTGAGACAGGATGAGCCAGG - Intergenic
940675367 2:156720309-156720331 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
940676157 2:156725658-156725680 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
941935397 2:170977672-170977694 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
941936245 2:170983200-170983222 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
942097632 2:172548513-172548535 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
942453093 2:176120853-176120875 CTGTTGAAGCCGGTGGAAGCTGG - Intergenic
942729813 2:179051804-179051826 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
942730605 2:179057142-179057164 CTTTTGAGTCAGGATGAGCCAGG + Intergenic
943002465 2:182345644-182345666 CTGTTTAAGCAGGAGCATGCTGG - Intronic
943061268 2:183044235-183044257 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
943062038 2:183049406-183049428 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
943142313 2:183997997-183998019 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
943155422 2:184169146-184169168 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
943157283 2:184198988-184199010 CTTTTTGAGCAGGATGAGCCAGG - Intergenic
943460665 2:188168913-188168935 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
943699962 2:190978939-190978961 CTGTTGAAGGACCAGCAGCCGGG - Exonic
943834817 2:192506243-192506265 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
943865062 2:192918485-192918507 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
943865933 2:192924598-192924620 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
943950824 2:194130927-194130949 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
944167139 2:196734940-196734962 GTGTTGGAGGAGGAGGGGCCTGG + Intronic
944264605 2:197709544-197709566 CTTTTGAACCAGGATGAGCCAGG + Intronic
944591428 2:201221456-201221478 CTTTTGAGCCAGGATGAGCCAGG - Exonic
944876486 2:203967499-203967521 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
945173946 2:207023037-207023059 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
945300980 2:208216153-208216175 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
945301827 2:208221754-208221776 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
945360776 2:208893932-208893954 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
946046998 2:216829629-216829651 CTCTTGATACAGCAGGAGCCTGG + Intergenic
946238615 2:218340658-218340680 CACTTGAAGCAGCAAGAGCCAGG - Intronic
946780426 2:223188987-223189009 CTTTTGAGCCAGGATGAGCCAGG + Intronic
946781385 2:223195317-223195339 CTTTTGAGCCAGGACGAGCCAGG + Intronic
946871230 2:224087576-224087598 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
946872116 2:224093331-224093353 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
946885190 2:224215910-224215932 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
946886150 2:224225495-224225517 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
946886951 2:224230751-224230773 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
946892912 2:224296797-224296819 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
946893725 2:224302117-224302139 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
947420445 2:229937616-229937638 CTGCTGAAGCAGGGAGAGCCAGG - Intronic
947617838 2:231569646-231569668 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
948390286 2:237606948-237606970 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
948391144 2:237612407-237612429 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
948601612 2:239110902-239110924 CTGAGGAGGCAGGAGGGGCCGGG - Intronic
1168763346 20:364943-364965 CTGAAGAAGAAGGAAGAGCCTGG + Intronic
1169218674 20:3807985-3808007 CTGCTGAGGAAGCAGGAGCCTGG + Intergenic
1169930876 20:10831753-10831775 CTCTTGTGACAGGAGGAGCCAGG + Intergenic
1170006686 20:11677161-11677183 CTGTTGAATCAGGAGGTGTCTGG - Intergenic
1170325008 20:15147910-15147932 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1170325835 20:15153367-15153389 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1171265066 20:23764927-23764949 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1172176387 20:32974793-32974815 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1172932874 20:38598613-38598635 CTTTTGAGCCAGGATGAGCCCGG + Intergenic
1173632179 20:44524929-44524951 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1174061935 20:47839159-47839181 CTGAGGAAAGAGGAGGAGCCAGG + Intergenic
1174069573 20:47890072-47890094 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1175034335 20:55985354-55985376 CAGTAGAAGCAGCAGGAGACTGG + Intergenic
1175530057 20:59668417-59668439 CTGTTGCAGGAGGAAGAGCCTGG - Intronic
1175586658 20:60146511-60146533 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1176037822 20:63048982-63049004 CGGTTTATCCAGGAGGAGCCCGG + Intergenic
1176336079 21:5601340-5601362 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1176342826 21:5714200-5714222 CTTTTAAAACAGGTGGAGCCAGG - Intergenic
1176391678 21:6219608-6219630 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1176469741 21:7096566-7096588 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1176475080 21:7146351-7146373 CTTTTAAAACAGGTGGAGCCAGG - Intergenic
1176493302 21:7478344-7478366 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1176502001 21:7610256-7610278 CTTTTAAAACAGGTGGAGCCAGG + Intergenic
1176507340 21:7660039-7660061 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1176537147 21:8112269-8112291 CTTTTAAAACAGGTGGAGCCAGG - Intergenic
1177080292 21:16631217-16631239 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1177841025 21:26233301-26233323 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1177857165 21:26412527-26412549 CTGTTCAATCAAGAGGAGACTGG - Intergenic
1178000912 21:28161597-28161619 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1178001654 21:28166662-28166684 CTTTTGAGCCAGGATGAGCCGGG - Intergenic
1178146942 21:29751055-29751077 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1178537141 21:33419903-33419925 CTCTTGGAGGAGGAGGAGCGGGG + Intronic
1178947253 21:36958995-36959017 CTGTGGAACCAGGGGGAGCTGGG + Intronic
1179015595 21:37592322-37592344 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1179875826 21:44266890-44266912 CTGTGGAAGCCCCAGGAGCCTGG + Intergenic
1179892238 21:44341761-44341783 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1180099126 21:45576171-45576193 CTGCAGATGCAGGAGGACCCTGG + Intergenic
1181361794 22:22343334-22343356 CTGTTGGAGGAGGAAGAGCAGGG - Intergenic
1181431095 22:22882387-22882409 CAGTAGAGGGAGGAGGAGCCTGG - Intronic
1182892985 22:33834438-33834460 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1182905609 22:33933402-33933424 CTGTAGAAACTGCAGGAGCCTGG - Intergenic
1182998319 22:34834773-34834795 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1183046913 22:35227760-35227782 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1183093825 22:35540739-35540761 GAGGTGAAGGAGGAGGAGCCGGG + Intergenic
1184114266 22:42413100-42413122 CTGCTGGAGAAGGAGGGGCCTGG - Intronic
1184325739 22:43782935-43782957 CTGTTGGGGCAGGGGGAGGCAGG - Intronic
1184651313 22:45920603-45920625 CTGTTGAAGCAGGAGGAGCCTGG + Exonic
1184946267 22:47806333-47806355 GTGTTGGGGCAGGAGGACCCAGG - Intergenic
1185301235 22:50082148-50082170 CAGCTGAAGCAGGAGGGGCGTGG + Intronic
949161639 3:890919-890941 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
949162437 3:896227-896249 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
949163702 3:911827-911849 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
949820875 3:8114034-8114056 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
949827084 3:8177195-8177217 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
949827886 3:8182470-8182492 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
950157199 3:10730641-10730663 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
950926136 3:16744439-16744461 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
950926954 3:16749821-16749843 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
951298372 3:20967765-20967787 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
951299158 3:20973045-20973067 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
951299547 3:20977120-20977142 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
951315839 3:21189237-21189259 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
951316528 3:21194019-21194041 CTTTTGAACCAGGATGAGCCAGG + Intergenic
951455398 3:22886536-22886558 CTGATGAAGCACAGGGAGCCTGG + Intergenic
952030597 3:29137715-29137737 CTGCTGAAACAGGAGGCACCAGG + Intergenic
952238627 3:31506820-31506842 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
952343070 3:32461160-32461182 CTTTTGAGCCAGGATGAGCCAGG + Intronic
952343861 3:32466729-32466751 CTTTTGAGCCAGGATGAGCCAGG + Intronic
952663022 3:35874628-35874650 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
952663804 3:35879892-35879914 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
952864882 3:37848323-37848345 CTGTGTAAGAAGGAGAAGCCAGG + Intergenic
953076689 3:39578056-39578078 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
953077501 3:39583433-39583455 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
953177638 3:40566436-40566458 CTTTTGAGCCAGGATGAGCCAGG - Intronic
953715492 3:45313644-45313666 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
953848103 3:46444806-46444828 CTGCAGAAGCAGGTGGAGCCAGG + Intronic
954971770 3:54657114-54657136 CTTTTGAGCCAGGATGAGCCAGG + Intronic
955396595 3:58562171-58562193 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
955702171 3:61692688-61692710 CTTTTGAGCCAGGATGAGCCAGG + Intronic
956065490 3:65393129-65393151 CTGTTGAAGTTGGCAGAGCCAGG - Intronic
956548498 3:70434897-70434919 CTCTTGAGCCAGGATGAGCCAGG + Intergenic
956549283 3:70440233-70440255 CTCTTGAGCCAGGATGAGCCAGG + Intergenic
956696839 3:71925726-71925748 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
956708889 3:72023290-72023312 CTCTTGAGCCAGGATGAGCCAGG - Intergenic
956709716 3:72028659-72028681 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
957286346 3:78222137-78222159 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
957772185 3:84708045-84708067 CTGTTTAAGGAGGAAGAGGCGGG - Intergenic
957893242 3:86387044-86387066 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
958182864 3:90083148-90083170 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
958183306 3:90086479-90086501 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
958751455 3:98196545-98196567 CTTTTGAGCCAGGATGAGCCAGG - Intronic
959485313 3:106922980-106923002 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
959688803 3:109176617-109176639 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
959894949 3:111594943-111594965 CTGTTTCAGCAGGAGGAGCTGGG + Exonic
960258215 3:115533624-115533646 CTCTGGAAGCAAGTGGAGCCTGG + Intergenic
960528126 3:118733620-118733642 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
961293963 3:125869259-125869281 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
961372274 3:126438864-126438886 TTCTTGTAGCAGGAGGAGACAGG - Intronic
961894034 3:130152555-130152577 CTTTTGAACCAGGATGAGCAAGG + Intergenic
962592722 3:136907134-136907156 CTGCTGCAGCAGCAGGAGCAAGG - Intronic
962660326 3:137595803-137595825 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
962661101 3:137600944-137600966 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
963156886 3:142108838-142108860 CCCTTGAGGCAGGAGGAGCACGG - Intronic
963319443 3:143797694-143797716 CTTTTGAGCCAGGATGAGCCAGG - Intronic
963320621 3:143805680-143805702 CTTTTGAGCCAGGATGAGCCAGG - Intronic
963424686 3:145111490-145111512 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
963424891 3:145113228-145113250 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
963456237 3:145551452-145551474 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
963457026 3:145556736-145556758 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
963520162 3:146353979-146354001 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
963951724 3:151209205-151209227 CTATTGAAGCAGGGGGAGATAGG + Intronic
964067464 3:152597180-152597202 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
964068337 3:152602908-152602930 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
964124933 3:153226373-153226395 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
964125843 3:153232334-153232356 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
964299706 3:155274668-155274690 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
964300575 3:155280624-155280646 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
965069984 3:163907693-163907715 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
965070852 3:163913741-163913763 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
965105563 3:164347663-164347685 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
965262156 3:166500817-166500839 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
965262974 3:166506232-166506254 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
965332629 3:167395494-167395516 TTGTTGCTGCATGAGGAGCCAGG - Intergenic
965334763 3:167422598-167422620 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
965336823 3:167436893-167436915 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
965625236 3:170678076-170678098 CTTTTGAGCCAGGATGAGCCAGG + Intronic
965639531 3:170817830-170817852 CTTTTGAGCCAGGATGAGCCAGG + Intronic
965862303 3:173161358-173161380 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
965945200 3:174232252-174232274 CTTTTGAGCCAGGATGAGCCAGG + Intronic
966055266 3:175679076-175679098 CTTTTGAGCCAGGATGAGCCAGG + Intronic
966066019 3:175822939-175822961 CTTTTGAGGCAGGATAAGCCAGG - Intergenic
966085097 3:176061528-176061550 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
966278873 3:178207567-178207589 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
966279922 3:178214411-178214433 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
966397357 3:179517233-179517255 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
967243736 3:187466523-187466545 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
967244521 3:187471817-187471839 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
967495887 3:190144764-190144786 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
967626448 3:191691288-191691310 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
967643374 3:191895592-191895614 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
967646200 3:191927471-191927493 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
967657659 3:192071334-192071356 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
967658476 3:192076669-192076691 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
967740139 3:192995809-192995831 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
967740914 3:193001148-193001170 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
969003351 4:4000303-4000325 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
969339006 4:6528770-6528792 CTTTTGAGCCAGGATGAGCCAGG - Intronic
969696829 4:8739839-8739861 CTGCAGAAGGAAGAGGAGCCTGG + Intergenic
969810578 4:9644522-9644544 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
970028748 4:11653782-11653804 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
970029541 4:11659068-11659090 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
970041771 4:11806499-11806521 CTTTTGAGCCAGGATGAGCCTGG - Intergenic
970087240 4:12364030-12364052 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
970088022 4:12369443-12369465 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
970854394 4:20635792-20635814 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
971130039 4:23798012-23798034 CTTTTGAGCCAGGATGAGCCAGG - Intronic
971713664 4:30149019-30149041 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
972002021 4:34049506-34049528 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
973632773 4:52834966-52834988 CTTTTGAGACAGGATGAGCCAGG - Intergenic
973870070 4:55157681-55157703 CCGCTGAGGCAAGAGGAGCCCGG - Intergenic
974232979 4:59140720-59140742 TTTTTTAAGAAGGAGGAGCCTGG - Intergenic
974935719 4:68407417-68407439 CTTTTGAGCCAGGAGGAGCCAGG + Intergenic
976271449 4:83234659-83234681 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
976343179 4:83967307-83967329 CTGATGAAGCAGCAGGAGAAGGG - Intergenic
976695697 4:87917903-87917925 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
976884125 4:89965008-89965030 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
976884929 4:89970294-89970316 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
977224812 4:94383146-94383168 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
977781978 4:100991917-100991939 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
977782796 4:100997301-100997323 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
978439055 4:108714614-108714636 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
978827997 4:113047775-113047797 CTGCTGAAACAGGAGGAGGGTGG + Intronic
979054175 4:115975920-115975942 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
979054951 4:115981100-115981122 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
979146275 4:117252271-117252293 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
979147054 4:117257551-117257573 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
979471170 4:121098715-121098737 CTGTAGAAGTAGAATGAGCCTGG - Intergenic
980093320 4:128464600-128464622 CTTTTCAAGCAGGAGTAGTCAGG - Intergenic
980111459 4:128641117-128641139 CTTTTGAGCCAGGAGGAGCCAGG + Intergenic
980284623 4:130767573-130767595 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
980285414 4:130773034-130773056 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
980302475 4:131012075-131012097 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
980388568 4:132118344-132118366 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
980389374 4:132123645-132123667 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
980416439 4:132495452-132495474 CTTTTGAGCCAGGGGGAGCCAGG - Intergenic
980527541 4:134012376-134012398 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
980528370 4:134018138-134018160 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
980575196 4:134678160-134678182 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
980575984 4:134683366-134683388 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
980681717 4:136171248-136171270 CTTTTGAAGTAGGAGGAGAAAGG - Intergenic
980903555 4:138928000-138928022 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
980904383 4:138933306-138933328 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
980964358 4:139506386-139506408 ATGTTGAAGAAGTAGAAGCCAGG - Exonic
981525507 4:145703258-145703280 CTTTTGAGCCAGGATGAGCCAGG - Intronic
981540178 4:145838257-145838279 CTTTTGAGCCAGGATGAGCCAGG - Intronic
982084297 4:151818047-151818069 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
982396219 4:154918545-154918567 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
982397068 4:154924377-154924399 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
982612727 4:157596814-157596836 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
983023522 4:162709346-162709368 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
983024320 4:162714510-162714532 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
983345252 4:166520864-166520886 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
983346047 4:166526194-166526216 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
983659237 4:170116594-170116616 CTTTTGAGTCAGGATGAGCCAGG - Intergenic
983660020 4:170121914-170121936 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
983707363 4:170677809-170677831 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
983708011 4:170682099-170682121 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
983884181 4:172962126-172962148 CTTTTGAGCCAGGATGAGCCAGG + Intronic
984164803 4:176294452-176294474 CTTTTGAACCAGGATGAGCCAGG + Intergenic
984321825 4:178207284-178207306 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
984322708 4:178213095-178213117 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
984437823 4:179726650-179726672 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
984495643 4:180494002-180494024 AGGTTGAGGCAGGAGGAGCCTGG + Intergenic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
985056905 4:186044238-186044260 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
985057685 4:186049486-186049508 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
986032443 5:3906749-3906771 CTGTGGGACCAGGAGGAGCCAGG + Intergenic
986035272 5:3931187-3931209 TGGCTGAAGCAGGAGGTGCCAGG - Intergenic
986388429 5:7262501-7262523 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
987281678 5:16420133-16420155 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
987282445 5:16425180-16425202 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
987356305 5:17066107-17066129 CTTTTGAGCCAGGATGAGCCAGG + Intronic
988008125 5:25446035-25446057 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
989330539 5:40252860-40252882 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
989768323 5:45112660-45112682 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
990367445 5:55085525-55085547 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
990591616 5:57271176-57271198 CTGGTGACACAGCAGGAGCCAGG + Intergenic
991126789 5:63078823-63078845 CTGATGTAGTAGGAGGGGCCTGG + Intergenic
991468149 5:66936583-66936605 CTTTTGAGCCAGGATGAGCCAGG + Intronic
991594699 5:68290553-68290575 CTGATGAAGCAGGAGTGGTCTGG + Intronic
991600652 5:68348707-68348729 CTGTTGGAGCTGGAGCAGCCTGG - Intergenic
991675166 5:69083575-69083597 CCTTTACAGCAGGAGGAGCCTGG + Intergenic
992892493 5:81216745-81216767 CTTTTGATGCGGGAGGAGCTGGG - Intronic
992960472 5:81953417-81953439 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
994295661 5:98085079-98085101 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
994351633 5:98752762-98752784 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
994556643 5:101315404-101315426 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
994557355 5:101320352-101320374 CTTTTGAGCCAGGACGAGCCAGG - Intergenic
994775350 5:104031872-104031894 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
994776393 5:104039975-104039997 CTTTTGAGGCAGGATGAGCCAGG + Intergenic
995296533 5:110531097-110531119 CTTTTGAGCCAGGATGAGCCAGG - Intronic
995682174 5:114732043-114732065 CTCTGCAAGCAGGAGCAGCCAGG + Intergenic
995764028 5:115596408-115596430 AGGTTGAAGCTGAAGGAGCCAGG - Intronic
995858661 5:116619222-116619244 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
995883450 5:116867659-116867681 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
996203629 5:120703187-120703209 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
996510343 5:124309227-124309249 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
996575325 5:124972052-124972074 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
996725893 5:126673242-126673264 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
996727452 5:126685019-126685041 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
997468499 5:134103797-134103819 ATCTTGTAGCAGGAGGAGCGGGG + Intergenic
999269496 5:150288608-150288630 CTGCTGAGGCAGCAGGAGCACGG - Intronic
999817265 5:155189727-155189749 CTGTCAAAGAAGTAGGAGCCAGG + Intergenic
1000003632 5:157163473-157163495 CTGCTGAAGGAGGAGCAGCAAGG - Exonic
1000439068 5:161245969-161245991 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1000518951 5:162275653-162275675 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1000519779 5:162280975-162280997 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1000884979 5:166740262-166740284 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1000885646 5:166744464-166744486 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1000935115 5:167297856-167297878 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1000936013 5:167303492-167303514 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1001141351 5:169146584-169146606 CAGTGGAGGCAGGAGGAGCCGGG - Intronic
1001266656 5:170278877-170278899 CCCTTAAAGCAGGAGGACCCTGG - Intronic
1001331010 5:170762305-170762327 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1001393391 5:171398950-171398972 AAGCTGAAGCAGGAGGAACCAGG - Intronic
1001397866 5:171429599-171429621 CTGCTGCTGCTGGAGGAGCCAGG + Intronic
1001579268 5:172787902-172787924 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1001758120 5:174186301-174186323 CAGAGGGAGCAGGAGGAGCCGGG - Intronic
1001838216 5:174850557-174850579 CTGTTGAATGAGGAGGTGCGTGG - Intergenic
1002056347 5:176599790-176599812 CTTTTGAAGCAGCTGGAGCCAGG + Exonic
1002280542 5:178127499-178127521 CTGCCCAAGCATGAGGAGCCTGG - Intergenic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1002466591 5:179411838-179411860 CTGGCGGAGCAGGAGGAGGCTGG - Intergenic
1003015307 6:2463013-2463035 CTGCAGAAGCGGAAGGAGCCCGG + Intergenic
1003099610 6:3167192-3167214 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1003100588 6:3173610-3173632 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1003755027 6:9108523-9108545 CTGTTGAAGCAGTCTGAGCTTGG - Intergenic
1003900688 6:10652627-10652649 CTGTTGAGGGAAGAGGTGCCAGG + Intergenic
1004508387 6:16264707-16264729 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1004574874 6:16886149-16886171 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1004575681 6:16891410-16891432 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1004837495 6:19544576-19544598 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1005174507 6:23029174-23029196 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1005456915 6:26029035-26029057 CTTTTGAGTCAGGATGAGCCAGG + Intergenic
1006214492 6:32428656-32428678 CTGTGGAACCAGGAAGAGCCAGG + Intergenic
1007225818 6:40313365-40313387 CTCATGAAGCAGGGGTAGCCTGG - Intergenic
1007659808 6:43477197-43477219 CTGATGAAGGTGGAAGAGCCTGG + Intergenic
1007773333 6:44208582-44208604 CTGGGGAAGCTGGAGGAGCTTGG - Intergenic
1007870683 6:45034145-45034167 CTGTTGGAGGAGGAGGAGGTAGG - Intronic
1008603221 6:53116074-53116096 CTGTAGTAGCAGAAGGCGCCAGG - Intergenic
1008850634 6:56016599-56016621 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1009269506 6:61600389-61600411 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1009344032 6:62591492-62591514 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1009359043 6:62791784-62791806 CTTTTGAGCCAGGAAGAGCCAGG - Intergenic
1009379642 6:63011196-63011218 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1009765546 6:68070211-68070233 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1010498114 6:76561179-76561201 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1010498229 6:76562462-76562484 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1010829976 6:80515617-80515639 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1010840822 6:80647759-80647781 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1010841629 6:80653198-80653220 CTTTTGAACCAGGATGAGCCAGG + Intergenic
1011354346 6:86458607-86458629 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1011368214 6:86603718-86603740 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1014395654 6:120924989-120925011 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1014396517 6:120930632-120930654 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1014454413 6:121620645-121620667 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1014612546 6:123562102-123562124 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1014614221 6:123582550-123582572 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1014615018 6:123587821-123587843 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1015164852 6:130192475-130192497 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1015165685 6:130197984-130198006 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1015271000 6:131339002-131339024 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1015801748 6:137066935-137066957 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1015928094 6:138330033-138330055 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1016113696 6:140257716-140257738 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1016114481 6:140262894-140262916 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1016513589 6:144870070-144870092 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1016535309 6:145103398-145103420 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1016536102 6:145108671-145108693 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1016750940 6:147630504-147630526 CTTTTGAGTCAGGATGAGCCAGG - Intronic
1016802806 6:148183630-148183652 TTCTTGAAGCAGCTGGAGCCAGG + Intergenic
1016853723 6:148645263-148645285 CTTTTGAGCCAGGATGAGCCGGG - Intergenic
1017034844 6:150257842-150257864 ATGTTGAAGAATGAGGGGCCGGG + Intergenic
1017286569 6:152683148-152683170 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1017351082 6:153442743-153442765 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1018077280 6:160228803-160228825 CTTTTGAGCCAGGACGAGCCAGG - Intronic
1018084868 6:160292128-160292150 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1018136257 6:160780830-160780852 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1018494946 6:164338992-164339014 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1018495825 6:164344592-164344614 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1018521879 6:164657879-164657901 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1018903146 6:168061110-168061132 CTGATGCAGGAGGAAGAGCCCGG + Intronic
1019106822 6:169674949-169674971 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1019339997 7:504460-504482 CTGCTGAGGCAGGAGGGGGCTGG - Intronic
1019643541 7:2117164-2117186 CTGTTCAGGAAGGAGGGGCCTGG - Intronic
1020094453 7:5360883-5360905 CTGAGGAAGCAGAAGGAGCGTGG - Intronic
1020350085 7:7209976-7209998 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1020541462 7:9463992-9464014 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1020591819 7:10148324-10148346 TTGATGAAGCAGGAACAGCCAGG - Intergenic
1021200755 7:17726559-17726581 CTGCTGGAGCATGAGAAGCCAGG + Intergenic
1021430366 7:20551452-20551474 CTTTTGAGCCAGGAAGAGCCAGG - Intergenic
1021636969 7:22703522-22703544 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1021637834 7:22709068-22709090 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1022425987 7:30269284-30269306 CTGGTGGAGGAAGAGGAGCCAGG - Intergenic
1022572308 7:31467074-31467096 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1022573058 7:31472193-31472215 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1022709549 7:32838037-32838059 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1022734772 7:33065230-33065252 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1024222106 7:47297183-47297205 ATGTTGAAGGACAAGGAGCCGGG - Exonic
1025232524 7:57212005-57212027 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1025553291 7:62275285-62275307 ATGTTGGAGCCGGAGGACCCAGG - Intergenic
1026004919 7:66592849-66592871 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1026548081 7:71341931-71341953 CTGTGGATGCAGGAGGATGCAGG + Intronic
1026584786 7:71647431-71647453 CTGTAGGAGCAGGAGGAACTGGG - Intronic
1026959031 7:74397014-74397036 GTGTGGGAGCTGGAGGAGCCAGG + Intronic
1027157933 7:75781688-75781710 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1027158928 7:75788317-75788339 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1027299723 7:76819111-76819133 CTGTTGTAGCAGGAAGAGGTGGG - Intergenic
1027471315 7:78577695-78577717 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1027880846 7:83833904-83833926 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1028670946 7:93399378-93399400 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1028690613 7:93645310-93645332 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1029425356 7:100490880-100490902 CTGATGAGGCAGGGGCAGCCTGG + Intronic
1029499882 7:100922427-100922449 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1029500711 7:100927757-100927779 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1029657207 7:101935188-101935210 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1029745718 7:102514757-102514779 CTGTGGAAGGAGGAGGACCAGGG + Intronic
1029763657 7:102613736-102613758 CTGTGGAAGGAGGAGGATCAGGG + Intronic
1030441205 7:109592036-109592058 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1030703544 7:112667608-112667630 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1031193887 7:118588490-118588512 CAGCTGAAGCTGGAGCAGCCAGG + Intergenic
1031354684 7:120776838-120776860 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1031355565 7:120782700-120782722 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1031365095 7:120891206-120891228 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1031421962 7:121563861-121563883 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1031627588 7:124008468-124008490 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1031686287 7:124734489-124734511 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1032616704 7:133480382-133480404 CTGTTTAAGCAAGACGAGCCTGG - Intronic
1033172114 7:139093571-139093593 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1033211208 7:139461617-139461639 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1033478165 7:141710983-141711005 CTGTTGAACAAAGAAGAGCCTGG + Intronic
1033734441 7:144208074-144208096 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1033748610 7:144342895-144342917 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1033909849 7:146249039-146249061 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1034084272 7:148309639-148309661 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1034085147 7:148315431-148315453 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1034446428 7:151116295-151116317 CGGGTGAAGAGGGAGGAGCCTGG - Intronic
1034517768 7:151594063-151594085 CTGGTGGAGCAGGAAGAGCCTGG + Intronic
1035599471 8:889101-889123 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1035665417 8:1376571-1376593 CTGCTGAAGAAGGGGGAGCCGGG + Intergenic
1035675581 8:1453268-1453290 GGGGAGAAGCAGGAGGAGCCTGG + Intergenic
1035880181 8:3238219-3238241 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1036071267 8:5442111-5442133 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1036280206 8:7393803-7393825 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1036341319 8:7918080-7918102 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1036472705 8:9065009-9065031 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1036639107 8:10571245-10571267 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1036966206 8:13301008-13301030 GTGTAGAAGGTGGAGGAGCCTGG + Intronic
1037391263 8:18394168-18394190 CTATTGAGCCAGGATGAGCCAGG + Intronic
1037809812 8:22080723-22080745 CTGGTGAAGAAGAAGAAGCCGGG + Intronic
1038067845 8:23982327-23982349 CCAGTGAAGCAGGAGGAGCCTGG - Intergenic
1038721021 8:30035421-30035443 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1039019225 8:33186647-33186669 GTGTTGAAGCAGGTGAGGCCAGG + Intergenic
1040530420 8:48261944-48261966 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1040568996 8:48591701-48591723 CTGATGAAGCAGGTGGACCTGGG - Intergenic
1040589251 8:48774236-48774258 CAGCTGAAGCAGGAGGAAGCAGG - Intergenic
1041303800 8:56439190-56439212 CTTTTGAGCCAGGACGAGCCAGG - Intronic
1041439111 8:57874708-57874730 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1041445063 8:57942025-57942047 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1041950652 8:63497218-63497240 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1041983225 8:63888365-63888387 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1043037562 8:75217288-75217310 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1043695076 8:83207894-83207916 CTGTGGAGTCAGAAGGAGCCAGG + Intergenic
1043717400 8:83504917-83504939 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1043718259 8:83510736-83510758 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1043837351 8:85062995-85063017 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1044859105 8:96504996-96505018 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1045252824 8:100495789-100495811 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1045595099 8:103646079-103646101 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1045609126 8:103814577-103814599 CTGTTTAAGAAGGAGAAGTCAGG + Intronic
1046294559 8:112201168-112201190 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1046918197 8:119699595-119699617 GTTCTGAAGCAGGAGGTGCCTGG - Intergenic
1047587103 8:126284411-126284433 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1047856859 8:128920072-128920094 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1048098039 8:131315611-131315633 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1048135129 8:131740917-131740939 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1048135933 8:131746389-131746411 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1048143607 8:131820319-131820341 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1048245513 8:132793086-132793108 CTGTCAGAGCAGCAGGAGCCGGG + Intronic
1048500485 8:134970516-134970538 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1048763742 8:137824856-137824878 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1048764591 8:137830382-137830404 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1048829605 8:138463470-138463492 ATGGTGAAGCAGGAAGAGCCTGG + Intronic
1048888300 8:138926004-138926026 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1049318044 8:141980114-141980136 CTGTTCCTCCAGGAGGAGCCTGG - Intergenic
1049397515 8:142408164-142408186 CTGTGGAATGAGGAGGAGCCAGG - Intergenic
1049674854 8:143884879-143884901 CTGGTGAGGCAGGAGCAGCCAGG - Intergenic
1049868327 8:144954133-144954155 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1049869172 8:144959812-144959834 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1050223847 9:3427896-3427918 CTGTTGAAGCAGCTGGAATCTGG - Intronic
1050251525 9:3749852-3749874 CTGTTGAGCCAGGATGAGCCAGG - Intergenic
1050257587 9:3811116-3811138 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1050258431 9:3816579-3816601 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1050282165 9:4061863-4061885 CTGATAAACCAGGAGGAGCACGG - Intronic
1050325036 9:4490433-4490455 CGGCGGCAGCAGGAGGAGCCGGG + Exonic
1050473811 9:6020223-6020245 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1050895779 9:10885146-10885168 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1050908686 9:11038837-11038859 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1051053090 9:12953850-12953872 CTTTTGAGCCAGGATGAGCCGGG - Intergenic
1051680717 9:19605140-19605162 CTGGTTACGCAGGAGGAGCTAGG + Intronic
1051912134 9:22165154-22165176 TTGTTAAAGCAGGAGGAGGGAGG + Intergenic
1051952943 9:22658740-22658762 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1051953708 9:22663876-22663898 CTTTTGAGCCAGGAAGAGCCAGG + Intergenic
1052191475 9:25669093-25669115 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1052192352 9:25674980-25675002 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1052192478 9:25676137-25676159 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1052547792 9:29902591-29902613 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1053057619 9:35003457-35003479 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1053058495 9:35009086-35009108 CTTTTGAGCCAGGAAGAGCCAGG - Intergenic
1053174123 9:35909998-35910020 CTATGGATGCAGGAGGAGCCCGG - Intergenic
1053539169 9:38955821-38955843 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1054626972 9:67408098-67408120 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1055626345 9:78180858-78180880 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1055627236 9:78186573-78186595 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1055881421 9:81009248-81009270 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1055882249 9:81015036-81015058 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1056557259 9:87700030-87700052 CTCTTGAGCCAGTAGGAGCCTGG + Intronic
1057131612 9:92657940-92657962 CTGTGGGAGCAGGCGGAGGCTGG - Intronic
1057342401 9:94214424-94214446 CGTTTGTAGCAGGAGGGGCCTGG + Intergenic
1057812032 9:98265538-98265560 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1057813264 9:98274045-98274067 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1057813408 9:98275129-98275151 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1058025684 9:100140404-100140426 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1058026586 9:100146336-100146358 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1058576601 9:106410133-106410155 CAGTTGAGGCAGGAGAAACCCGG + Intergenic
1058612079 9:106788446-106788468 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1059341217 9:113598576-113598598 GAGTTGATGCAGGAGGAGCTGGG + Intergenic
1059545729 9:115174876-115174898 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1060041714 9:120306236-120306258 CTGTGGAAGCAGGAAGGCCCAGG + Intergenic
1060318790 9:122535962-122535984 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1060409302 9:123389519-123389541 CTGTGGAAGTGGCAGGAGCCAGG - Intronic
1060491597 9:124089166-124089188 CTGTTCAGGGAGGAGGAGCCAGG + Intergenic
1060737388 9:126074661-126074683 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1060738256 9:126080228-126080250 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1060863715 9:126978030-126978052 CATTTTCAGCAGGAGGAGCCTGG - Intronic
1061407028 9:130398227-130398249 CTGTTGGAGGGGGAGGAGACTGG - Intronic
1061582735 9:131547378-131547400 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1061583415 9:131551693-131551715 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1061711146 9:132488808-132488830 CTGATATTGCAGGAGGAGCCCGG + Intronic
1061792948 9:133068148-133068170 CTGCTGAGGCAGGCGGGGCCTGG - Intronic
1061795554 9:133083932-133083954 CTGCTGAGGCAGGCGGGGCCTGG - Intronic
1062144177 9:134979665-134979687 CTGTGGAAACAGGAAGGGCCTGG + Intergenic
1062261363 9:135664807-135664829 CTGTGAGACCAGGAGGAGCCTGG - Intronic
1062426629 9:136509057-136509079 CCGTTGAAGCAGGAGCTGCAAGG + Exonic
1062591057 9:137274873-137274895 CTGAGGAAGCAGGAGAGGCCTGG + Intergenic
1203425563 Un_GL000195v1:33562-33584 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1203458415 Un_GL000220v1:11750-11772 CTTTTAAAACAGGTGGAGCCAGG - Intergenic
1203704821 Un_KI270742v1:29992-30014 CTGTAGAAGAAGGAGGAACAGGG + Intergenic
1185781422 X:2850690-2850712 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1186112398 X:6272442-6272464 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1186113247 X:6277757-6277779 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1186355043 X:8782331-8782353 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1186495091 X:10006749-10006771 CTGAAGCAGCAGCAGGAGCCTGG + Intergenic
1186783719 X:12940029-12940051 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1186784528 X:12945291-12945313 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1187001769 X:15188099-15188121 CTTTGCAAGTAGGAGGAGCCTGG + Intergenic
1187086885 X:16050228-16050250 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1187099531 X:16179425-16179447 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1187104585 X:16228027-16228049 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1187233710 X:17446455-17446477 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1187819086 X:23266153-23266175 CTGTTGGTGCAGGAAGAGACAGG - Intergenic
1188420000 X:29981001-29981023 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1188431519 X:30109008-30109030 CTTTTGATCCAGGATGAGCCAGG - Intergenic
1188438810 X:30194029-30194051 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1188462915 X:30449155-30449177 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1188553153 X:31383126-31383148 CTTTTGAGCCAGGAAGAGCCAGG - Intronic
1188688873 X:33104470-33104492 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1189635775 X:43007305-43007327 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1190681574 X:52830930-52830952 CTGTGGAGGCAGCAGGAGCCAGG + Intergenic
1191021795 X:55868381-55868403 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1192705737 X:73527552-73527574 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1192706684 X:73533701-73533723 CTGTTGAGCCAGGATGAGCCAGG - Intergenic
1193885606 X:86982048-86982070 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1193886368 X:86987251-86987273 CTTTTGAGTCAGGATGAGCCAGG - Intergenic
1194199211 X:90934359-90934381 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1194366759 X:93023123-93023145 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1194367556 X:93028390-93028412 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1194660336 X:96624189-96624211 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1194661240 X:96630205-96630227 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1194680107 X:96841975-96841997 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1194817560 X:98462863-98462885 GTGGTGAAGAAGGAGAAGCCGGG - Intergenic
1194873247 X:99158935-99158957 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1194874162 X:99165000-99165022 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1195219628 X:102734012-102734034 CTTTTGAGCCAGGATGAGCCAGG + Intronic
1195291597 X:103435264-103435286 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1195326313 X:103761377-103761399 CTTTTGAGTCAGGATGAGCCAGG + Intergenic
1195327180 X:103767155-103767177 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1195533386 X:105982735-105982757 CTGTGGGAGCAAGTGGAGCCTGG + Intergenic
1196246089 X:113402183-113402205 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1196299688 X:114040256-114040278 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1196301186 X:114051393-114051415 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1196496719 X:116332155-116332177 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1196497353 X:116336596-116336618 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1196524931 X:116720538-116720560 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1196525845 X:116726526-116726548 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1197204401 X:123777449-123777471 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1197362469 X:125522717-125522739 CTGTAGAACCAGGAAGAGCTGGG + Intergenic
1197471453 X:126868745-126868767 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1197500279 X:127232782-127232804 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1197579391 X:128262975-128262997 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1198258562 X:134946486-134946508 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1198598956 X:138264568-138264590 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1198599798 X:138270149-138270171 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1198748345 X:139913599-139913621 CTTTTGAGCCAGGATGAGCCAGG - Intronic
1198983258 X:142423601-142423623 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1198984031 X:142428776-142428798 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1199139207 X:144289982-144290004 CAGTTGAAGCTGGAGCAGCTGGG - Intergenic
1199377542 X:147131902-147131924 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1199377980 X:147134596-147134618 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1200545205 Y:4510778-4510800 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1200675763 Y:6144649-6144671 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1200942617 Y:8801541-8801563 CTTTTGAGACAGGATGAGCCAGG - Intergenic
1201483377 Y:14465693-14465715 CTTTTGAGACAGGATGAGCCAGG - Intergenic
1201581041 Y:15512478-15512500 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1201581810 Y:15517837-15517859 CTTTTGAGCCAGGAAGAGCCAGG - Intergenic
1201604796 Y:15772789-15772811 CTTTTGAGCCAGGATGAGCCAGG - Intergenic
1201698291 Y:16852009-16852031 CTTTTGAGCCAGGATGAGCCAGG + Intergenic
1202411958 Y:24583465-24583487 TTGTGCAAGGAGGAGGAGCCTGG - Intergenic