ID: 1184653345

View in Genome Browser
Species Human (GRCh38)
Location 22:45929349-45929371
Sequence GTGAATAGATGGATGGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1631
Summary {0: 1, 1: 1, 2: 31, 3: 275, 4: 1323}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184653345 Original CRISPR GTGAATAGATGGATGGATAA AGG (reversed) Intronic
900498136 1:2985870-2985892 GTGAATGAATGGATGGATGATGG - Intergenic
900498155 1:2985958-2985980 GTGAATGGATGGATGGTGGATGG - Intergenic
900498167 1:2986011-2986033 GTGAATGAATGGATGGAGGATGG - Intergenic
900498700 1:2989156-2989178 ATGAATGGTTGGATGGATGATGG - Intergenic
900498729 1:2989278-2989300 ATGAATGGATGGATGGAGGATGG - Intergenic
900498762 1:2989441-2989463 GAGTATAGATGGATGGAGGATGG - Intergenic
900498766 1:2989463-2989485 ATGGATGGATGGATGGATGATGG - Intergenic
900509425 1:3051531-3051553 ATGGATGGATGGATGGATGATGG - Intergenic
900509584 1:3052193-3052215 ATGAATGAATGGATGGATGATGG - Intergenic
900535792 1:3176602-3176624 ATGGATAGATGAATGGATGATGG - Intronic
900573359 1:3370946-3370968 ATGAATCGATGGATGGTGAATGG - Intronic
900573442 1:3371339-3371361 ATGAATGGATGGATGGTGAATGG - Intronic
900649889 1:3725590-3725612 GTGAATGGATGGTTGGGTAGAGG + Intronic
900922004 1:5678790-5678812 ATGGATGGATGGATGGATGAGGG + Intergenic
900930954 1:5737181-5737203 GATAATAGATAGATGGATGAGGG + Intergenic
900931020 1:5737659-5737681 ATGGATGGATGGATGGATGATGG + Intergenic
900931032 1:5737726-5737748 ATGGATAGATGGATGGATAATGG + Intergenic
900993359 1:6107894-6107916 ATGGAGAGATGGAGGGATAATGG + Intronic
900993435 1:6108158-6108180 GTGGAAAGATGGAGGGATGATGG + Intronic
900993446 1:6108193-6108215 GTGGAGAGATGGAGGGATGATGG + Intronic
900993589 1:6108801-6108823 GTGGAAGGATGGAGGGATAAGGG + Intronic
901001315 1:6150255-6150277 GACAATGGATGGATGGATGATGG + Intronic
901001379 1:6150578-6150600 ATGAATGGCTGGATGGATGAAGG + Intronic
901006553 1:6174490-6174512 ATGGATAGATGGATGGATGGTGG + Intronic
901006709 1:6175237-6175259 GTGGATTGATGGATGGATGGTGG + Intronic
901006748 1:6175429-6175451 GTGGATAGATGGATGAATGGTGG + Intronic
901006855 1:6176000-6176022 GTAGATGGATGGATGGATGATGG + Intronic
901262553 1:7884899-7884921 ATGAATGGATGCATGGATGATGG - Intergenic
901262591 1:7885092-7885114 ATGAATGGATGCATGGATGATGG - Intergenic
901317935 1:8321693-8321715 GTGAGTGGAAGGATGGATAGAGG + Intronic
901454767 1:9356797-9356819 ATGGACAGATGGATGGATGATGG + Intronic
901587819 1:10312920-10312942 CTGAGTGGATGGATGGATAATGG + Intronic
901786939 1:11630833-11630855 ATGAATAGATGAATAAATAAAGG + Intergenic
901863585 1:12089873-12089895 GTGGATAGATGGATGGGTTAGGG - Intronic
901863625 1:12090024-12090046 GTAGATAGATGGATGGGGAAAGG - Intronic
901863640 1:12090091-12090113 GTGGATAGATGGATGGGTTAGGG - Intronic
901863652 1:12090133-12090155 GTAGATAGATGGATGGGGAAAGG - Intronic
901863664 1:12090188-12090210 GTGGATAGATGGATGGGTTAGGG - Intronic
901863676 1:12090230-12090252 GTAGATAGATGGATGGGGAAAGG - Intronic
901863688 1:12090285-12090307 GTGGATAGATGGATGGGTTAGGG - Intronic
901863730 1:12090437-12090459 GTGGATGGATGGATGGATGGGGG - Intronic
901928637 1:12583135-12583157 GTGAGTGGATGGATGGAGTAGGG - Intronic
901940632 1:12658989-12659011 ATGAATAGATGGATGGATGGGGG + Intronic
902154679 1:14475147-14475169 ATGGATGGATGGATGGATAGTGG + Intergenic
902397931 1:16142659-16142681 ATGAGTGGATGGATGGATGAGGG + Intronic
902398004 1:16142926-16142948 ATGAGTAGATGGATGGATGAGGG + Intronic
902398075 1:16143188-16143210 ATGAATGGATGGATGGATGTAGG + Intronic
902412856 1:16221587-16221609 ATGGATGGATGGATGGATGATGG + Intergenic
902603883 1:17558106-17558128 ATGGATGGATGGATGGACAATGG - Intronic
902621821 1:17655251-17655273 GTGGATAGATGGATGGATGATGG - Intronic
902628674 1:17691821-17691843 ATGGACAGATGGATGGATGAAGG - Intronic
902721175 1:18305196-18305218 ATGGATGGATGAATGGATAATGG + Intronic
902721195 1:18305308-18305330 GATAATGGATGGATGGATGATGG + Intronic
902721208 1:18305383-18305405 ATGGATGGATGGATGGATAATGG + Intronic
902721214 1:18305417-18305439 ATGGATAGATGGATGGATTATGG + Intronic
902721222 1:18305471-18305493 ATGGATGGATGGATGGATGATGG + Intronic
902721233 1:18305529-18305551 ATGAATGGATGGATGGATGATGG + Intronic
902721240 1:18305560-18305582 ATGGATGGATGGATGGATTATGG + Intronic
902721244 1:18305579-18305601 ATGGATGGATGGATGGATGATGG + Intronic
902722855 1:18315650-18315672 ATGGGTAGATGGATGGAGAATGG + Intronic
903175173 1:21576236-21576258 ATGGATGGATGGATGGATGATGG + Intronic
903294860 1:22337273-22337295 TTGAGTGGATGGATGCATAATGG - Intergenic
903352470 1:22726046-22726068 ATGGACAGATGGATGGATGAAGG - Intronic
903357842 1:22758937-22758959 ATGAATGGATGGATGGATGATGG + Intronic
903565973 1:24266170-24266192 ATGGATGGATGGATGGATAGAGG + Intergenic
903589385 1:24442624-24442646 GTGAAAAGATGCATGGGTTAAGG - Intronic
903690428 1:25169326-25169348 ATGGATGGATGGATGGATGATGG + Intergenic
903937626 1:26907494-26907516 ATGAATTAATGGATGGATAGTGG + Intronic
904407423 1:30301649-30301671 GTGTATAAATGCATAGATAATGG + Intergenic
904464524 1:30699979-30700001 ATGGATGGATGGATGGATGAAGG - Intergenic
904465112 1:30702955-30702977 ATGGATGGATGGATGGATGATGG + Intergenic
904465134 1:30703124-30703146 ATGGATAGATGGATAGATGATGG + Intergenic
904465139 1:30703158-30703180 ATGAATTGATGGAAGGATAATGG + Intergenic
904581357 1:31546517-31546539 ATGGATGGATGGATGGATGATGG - Intergenic
905274627 1:36809197-36809219 ATGGATGGATGGATGGATGATGG - Intronic
905309513 1:37039477-37039499 GTGAGTAGATGAATGGGTAAGGG - Intergenic
905524380 1:38625246-38625268 ATGAATAGATGGGGGGATAGAGG - Intergenic
905834322 1:41104255-41104277 GTGGATAGATAGGTGAATAAAGG + Intronic
906131001 1:43456061-43456083 GTAAATAGTTGCATGGATAATGG + Intergenic
906180686 1:43815915-43815937 ATGGATGGATGGATGGATGATGG + Intronic
906260831 1:44388406-44388428 GGGCATAGATAGATAGATAACGG + Intergenic
907245193 1:53103884-53103906 GGGGACAGATGGGTGGATAAAGG - Intronic
907790129 1:57655368-57655390 ATGAATGGATGGATGGATGATGG - Intronic
907839884 1:58146818-58146840 ATGGATGGATGGATGGATAAAGG - Intronic
908108468 1:60871495-60871517 GTGAATAGGTGAAGGAATAAAGG - Intronic
908391370 1:63686692-63686714 ATGGATGGATGGATGGATGAAGG - Intergenic
908391401 1:63686854-63686876 GTGAATGGATGAATGGATGGGGG - Intergenic
908437474 1:64120830-64120852 GTGGATGGATGGATGGAGAATGG + Intronic
909170365 1:72285501-72285523 GTGTATAGATGTCTGGATTATGG + Intergenic
912727903 1:112075792-112075814 GTGAAGGGATGGATGGGTGAAGG + Intergenic
912727945 1:112075932-112075954 GTGAAGGGATGGGTGGGTAAGGG + Intergenic
912948523 1:114104665-114104687 CTGAATGGATGGATGGATGGAGG - Intronic
913139769 1:115929280-115929302 GTGAATGAATGAATGCATAAAGG + Intergenic
913492557 1:119394963-119394985 TGGGATAGATGGATGGATAGAGG + Intergenic
913492559 1:119394975-119394997 ATGGATAGAGGGATAGATAAAGG + Intergenic
914351301 1:146842755-146842777 ATGCATGGATGGATGGATGATGG + Intergenic
914351374 1:146843018-146843040 GTGGATGGATGAATGGATGATGG + Intergenic
916105242 1:161424933-161424955 ATCAACAGATGAATGGATAAAGG - Intergenic
916152742 1:161811686-161811708 ATGGATGGATGGATGGATAGTGG - Intronic
916152748 1:161811713-161811735 GTGGATGGATGGATGGATAGTGG - Intronic
916738599 1:167629621-167629643 ATGGATAGATGGATAGATAGTGG + Intergenic
917640978 1:176982915-176982937 AGGAATAGAGGGATGGAAAAGGG + Intronic
918262639 1:182809606-182809628 GTGGAGAGAAGGAAGGATAAGGG + Intronic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919462680 1:197897175-197897197 ATGAATAGATGAATGAATAATGG - Intergenic
919496774 1:198282506-198282528 GTTAATACATGGCTTGATAAAGG - Intronic
919541795 1:198856433-198856455 TTGAACAGATGGATGGCTGATGG + Intergenic
920287354 1:204890214-204890236 GTGAATGGATGGATGCAGGAAGG - Intronic
921017189 1:211202816-211202838 GTGTATAGCTATATGGATAAAGG - Intergenic
921768804 1:219008329-219008351 ATGAATAAGTGAATGGATAATGG + Intergenic
922745707 1:228042385-228042407 CTGGATGGATGGATGGATGATGG + Intronic
922745773 1:228042800-228042822 GATGATGGATGGATGGATAATGG + Intronic
922790586 1:228308806-228308828 GTGGATGGATCGATGGATAATGG - Intronic
922790597 1:228308871-228308893 AAGAATGAATGGATGGATAATGG - Intronic
922790891 1:228310379-228310401 GTGAATGGATGGATGGTGGATGG - Intronic
922792879 1:228319847-228319869 ATGCATAGATGGATGGATGGTGG - Intronic
923214595 1:231836697-231836719 GTGAATGTGTGGATAGATAAGGG - Intronic
923301440 1:232644323-232644345 ATGGATAGATGGATGGATGAAGG - Intergenic
923916299 1:238509878-238509900 ATGAATAGATAGATAGATGATGG - Intergenic
924815593 1:247438986-247439008 GAAAATAGAGGGATGGATGATGG - Intronic
1062940150 10:1414883-1414905 ATGGTTAGATAGATGGATAAAGG + Intronic
1062943694 10:1444250-1444272 GGAAATAGATGGATGGTGAATGG - Intronic
1062943720 10:1444374-1444396 GTAGATAGATGGATGGTGAATGG - Intronic
1063118786 10:3089840-3089862 GTGTAAAGAAGGATGGTTAATGG - Intronic
1063588995 10:7378099-7378121 GTGTATGGATGGGTGGATGATGG + Intronic
1063766371 10:9145712-9145734 TAGAAGAGATGCATGGATAAAGG - Intergenic
1063957968 10:11283544-11283566 ATGGATAGATGGGTGGATGATGG + Intronic
1064302423 10:14134397-14134419 GTGGATGGATGGATGGATGGGGG + Intronic
1064698501 10:17992195-17992217 ATGAATTTATGGATGGATAGAGG + Intronic
1064896381 10:20241954-20241976 ATGGATGGATGGATGGAGAAAGG + Intronic
1065514299 10:26509765-26509787 GTGATTAGATGGACTGAAAAAGG - Intronic
1065860770 10:29870778-29870800 ATGAATGGATGGATGGTAAATGG - Intergenic
1066048447 10:31614592-31614614 GTGAAGGGATGGATGGCTGATGG - Intergenic
1066229319 10:33416838-33416860 GTGGCTAGTTGGATGGATGATGG + Intergenic
1066229333 10:33416910-33416932 GTGGATGGATGGATGGATGATGG + Intergenic
1066517522 10:36179683-36179705 ATGGATAGAGGGATGGATAATGG + Intergenic
1067051489 10:43024059-43024081 ATGGATAAATGGATGGATGATGG + Intergenic
1067694886 10:48527566-48527588 GTGAACAGAAGGAAGGATGATGG + Intronic
1067709629 10:48637607-48637629 GTGAATGGATGGATGGCAAATGG + Intronic
1067800857 10:49358641-49358663 ATCAACAGATGAATGGATAAAGG + Intergenic
1067808240 10:49407934-49407956 ATGAAAAAATGGATGGATGAAGG + Intergenic
1067833668 10:49624772-49624794 GTGGATAGATGGGTGGATGGTGG + Intronic
1067833704 10:49624952-49624974 ATGGATATATGGATGGATGATGG + Intronic
1067956819 10:50800702-50800724 GAGAATAGAGGGAGGGAAAAAGG + Exonic
1068810275 10:61247882-61247904 ATGGATAGATGGATGGATGGAGG - Intergenic
1069601630 10:69711869-69711891 ATGGATGGATGGATGGATGATGG - Intergenic
1069887494 10:71633363-71633385 GTGAATGGACGAAGGGATAAAGG - Intronic
1070749902 10:78957851-78957873 ATGGATGGATGGATGGATGAAGG + Intergenic
1070781603 10:79140686-79140708 GTAAATAGATGGGTGGATGGGGG - Intronic
1071060507 10:81564944-81564966 ATCAATGGATGAATGGATAATGG + Intergenic
1071508580 10:86247369-86247391 ATGGATGGATGGATGGATGATGG + Intronic
1072260646 10:93668283-93668305 GCAAATAGATGGATAGATATAGG - Exonic
1072767163 10:98104492-98104514 GCGAATAAATGTATTGATAATGG - Intergenic
1072935694 10:99711029-99711051 GTGAATGCATGAATGGAAAATGG - Intronic
1072991806 10:100202732-100202754 GTGTGCAGATGGGTGGATAAAGG + Intronic
1073429015 10:103474167-103474189 GAGGATAGATGAATGGATGAAGG - Intronic
1073429036 10:103474328-103474350 GAGAAGAGATGGATAGATGATGG - Intronic
1073467166 10:103700945-103700967 ATGGATGGATGGATGGATGATGG - Intronic
1073467191 10:103701059-103701081 ATGGATGGATGGATGGATGATGG - Intronic
1073467206 10:103701141-103701163 ATGGATGGATGGATGGATAGTGG - Intronic
1073467304 10:103701638-103701660 GTGGATGGATGGATAGATGATGG - Intronic
1073467332 10:103701782-103701804 GAAGATAGATGGATGGATGATGG - Intronic
1073467377 10:103702035-103702057 GTGGATGGATAGATGGATGATGG - Intronic
1073467381 10:103702057-103702079 ATGGATAGATGGATGGATGATGG - Intronic
1074067430 10:110029570-110029592 CTGAATAGATGATTAGATAAGGG + Intronic
1074905385 10:117858225-117858247 ATGGATGGATGGATGGATAATGG - Intergenic
1075480087 10:122772819-122772841 ATCAATGGATGAATGGATAAAGG - Intergenic
1075524988 10:123176519-123176541 GTGAATGGGTGAATGGATGATGG - Intergenic
1075648258 10:124110487-124110509 ATGGATGGATGGATGGATGATGG + Intergenic
1075906425 10:126085692-126085714 GTCAGTGGATGAATGGATAATGG - Intronic
1075918320 10:126188945-126188967 GTGAATAGATGGATGATGAATGG - Intronic
1076117809 10:127912819-127912841 ATGGAGAGATGGATGGATGAAGG + Intronic
1076122073 10:127944345-127944367 GTGGATGGATGGATGGACGATGG + Intronic
1076136725 10:128050242-128050264 ATGGATGGATGGATGGATGATGG + Intronic
1076494436 10:130887636-130887658 ATGGATGGATGGATGGATGAAGG + Intergenic
1076578002 10:131483681-131483703 GTGGATGGATGAATGGATGATGG + Intergenic
1076676720 10:132150900-132150922 ATGGATAAATGGATGGATTAAGG - Intronic
1076676780 10:132151265-132151287 GTGGATAGGTGGAAGGATAAAGG - Intronic
1076676789 10:132151296-132151318 ATGGATAGATGGATGGATGGAGG - Intronic
1076844939 10:133065429-133065451 ATGTATGGATGGATGGATGATGG + Intergenic
1076845216 10:133066333-133066355 GTGGATGGATGGATGGATGTTGG + Intergenic
1076845257 10:133066465-133066487 GTGGATGGATGGATGGATGTTGG + Intergenic
1076845301 10:133066605-133066627 GTGGATGGATGGATGGATGTTGG + Intergenic
1076867500 10:133175251-133175273 GTGGATAGATGGGTGGATGGTGG + Intronic
1076867588 10:133175651-133175673 GTGGATAGATGGGTGGAGGATGG + Intronic
1076931894 10:133536980-133537002 TTGAATAGATGGGTGGATGATGG + Intronic
1077159606 11:1106644-1106666 GTGAATGGAGGGAGGGAGAATGG - Intergenic
1077248986 11:1552313-1552335 GTGGGTAGATGGGTGGATGAGGG - Intergenic
1077280507 11:1742914-1742936 ATGGATAGATGGATGGAGGATGG + Intronic
1077280512 11:1742937-1742959 ATGGATAGATGGATGGAGGATGG + Intronic
1077280530 11:1743029-1743051 GTGGATGGATGGATGGATGAAGG + Intronic
1077280619 11:1743501-1743523 GAGAATGGATGGATGGAAGATGG + Intronic
1077304201 11:1861544-1861566 ATGGATGGATAGATGGATAATGG + Intronic
1077312117 11:1893525-1893547 ATGAGTGGATGGATGGATGAAGG + Intergenic
1077312167 11:1893735-1893757 GTAGATGGATGGATGGATGAAGG + Intergenic
1077480881 11:2814000-2814022 ATGGATGGATGGATGGATGATGG + Intronic
1078548661 11:12264801-12264823 CTGAATAAATGAATGCATAAAGG - Intergenic
1078636973 11:13060727-13060749 GGGAAAAGATGCATGGAGAAGGG + Intergenic
1079386182 11:19981814-19981836 GTGGCTGGATGGATGGATGATGG + Intronic
1079440422 11:20508491-20508513 GTGAGCAGATGGATGGATGATGG + Exonic
1079604622 11:22349439-22349461 ATGAATAGATGGATTGAGGAGGG + Intronic
1079748611 11:24165325-24165347 GTGAATAAATGTTTGGAAAAGGG - Intergenic
1079773276 11:24491228-24491250 GGGAAGATATGGATGGAAAAAGG + Intergenic
1079836181 11:25336469-25336491 ATGAATAGATGGAGAGATTAAGG - Intergenic
1079887972 11:26013010-26013032 GTTAATGGATGAATAGATAAAGG - Intergenic
1079985821 11:27199702-27199724 GTGAATAGATGGACGAATCAGGG - Intergenic
1080414760 11:32058855-32058877 GTAAAAAGTTGGTTGGATAAAGG + Intronic
1080538168 11:33242711-33242733 ATTAATAGATGCATGGATAAAGG + Intergenic
1080550172 11:33367557-33367579 GTGGATGGATGAATGGATGAAGG - Intergenic
1080754697 11:35185581-35185603 ATGGATAGATGGATGGAGAGAGG - Intronic
1080781489 11:35433828-35433850 ATGGATGGATGGATGGATGAGGG + Intronic
1080849334 11:36054767-36054789 ATGGATAGATGGATGGATGATGG + Intronic
1081287183 11:41285246-41285268 ATGAATGAATGGATGGATGATGG - Intronic
1081629966 11:44682367-44682389 ATGGATAGATGGATAGATGATGG - Intergenic
1081738333 11:45420746-45420768 GTGAGTGAATGGATGGATAGTGG - Intergenic
1081996248 11:47366139-47366161 GATGATAGTTGGATGGATAATGG - Intronic
1082781382 11:57290190-57290212 ATGGATGGATGGATGGATGAAGG + Intergenic
1083622405 11:64055699-64055721 ATGGATGGATGGATGGATGATGG + Intronic
1083634752 11:64114457-64114479 ATGGATAGATGGATGGATGGAGG + Intronic
1083879843 11:65542978-65543000 ATGGATGGATGGATGGATGAAGG + Intronic
1083879852 11:65543013-65543035 GTGGATGGATGGATGGAGAAAGG + Intronic
1084413445 11:69016884-69016906 GTGGGTGGATGGATGGATGATGG - Intergenic
1084454899 11:69262849-69262871 GTGGATGGATGGATGGATGGAGG - Intergenic
1084464707 11:69315475-69315497 ATGGATGGATGGATGGATAATGG + Intronic
1084543830 11:69803775-69803797 ATGGATGGATGGATGGATGATGG + Intergenic
1084543847 11:69803888-69803910 ATGGATGGATGGATGGATGATGG + Intergenic
1084576524 11:69992156-69992178 GTGGGTAGATGAATGGATGATGG + Intergenic
1084576540 11:69992238-69992260 ATGGATGGATGGATGGATGATGG + Intergenic
1084579222 11:70012347-70012369 ATGGATGGATGGATGGATGAAGG - Intergenic
1084579265 11:70012688-70012710 ATGGATGGATGGATGGATGAAGG - Intergenic
1084596416 11:70119408-70119430 GTGAATGGATGGATGCCTGAGGG + Intronic
1084596474 11:70119697-70119719 GTGAATAGATGGATGCCGGAGGG + Intronic
1084596493 11:70119799-70119821 GTGAATAGATGGATGCCAGAGGG + Intronic
1084609784 11:70194732-70194754 GTGAATGGATGGATGGATGGTGG + Intergenic
1084609798 11:70194833-70194855 GTGAATGGATGGATGGATGGTGG + Intergenic
1084609836 11:70195033-70195055 ATGAATGGATGGATGGATGGTGG + Intergenic
1084658780 11:70535181-70535203 GTGAGCAGATGGATGGAAAATGG - Intronic
1084658813 11:70535409-70535431 ATGGATGGATGGATGGATGATGG - Intronic
1084658835 11:70535525-70535547 ATGAATAGACTGATGGATGATGG - Intronic
1084697560 11:70764709-70764731 GTAGATGGATGGATGGATGATGG - Intronic
1084705318 11:70812990-70813012 GTGAATGAATGAATGGAGAAAGG - Intronic
1084785710 11:71440584-71440606 GAGGGTAGATGGATGGATGATGG + Intronic
1085406864 11:76268642-76268664 GAGGATGGATGGATGGATGATGG - Intergenic
1085406874 11:76268684-76268706 ATGGATGGATGGATGGATAGAGG - Intergenic
1085406894 11:76268761-76268783 ATGAATGGATGGATGGAGGATGG - Intergenic
1085487232 11:76875564-76875586 ATGAACTGATGGATGGAGAAAGG - Intronic
1085534570 11:77210349-77210371 GTGAATTGATGGGTGGATATTGG + Intronic
1085690327 11:78658997-78659019 GTGGGTGGATGGATGGATGAAGG - Intronic
1086087806 11:82972515-82972537 GTGAATAAATGGATGGGTGAAGG + Intergenic
1086237629 11:84651098-84651120 ATGAATAGATTGATGAATGAAGG - Intronic
1086401979 11:86468335-86468357 ATGGATGGATGGATGGATGATGG - Intronic
1086576177 11:88341237-88341259 GTTAATAGATTAATGGATTATGG - Intergenic
1087813394 11:102632547-102632569 ATCAATGGATGAATGGATAAAGG + Intergenic
1087910430 11:103746757-103746779 GTGCATAGAGGTATGCATAATGG + Intergenic
1088375029 11:109131688-109131710 ATGGATGGATGGATGGTTAAGGG - Intergenic
1088825959 11:113494898-113494920 GCTAAAAGATGAATGGATAAGGG - Intergenic
1089166396 11:116480576-116480598 ATGTATAGATGGATGGATGAAGG + Intergenic
1089227815 11:116940743-116940765 GTGGAGAGATGCATGGATGAAGG - Intronic
1089419849 11:118323307-118323329 GTGAACGGATGGATGGATGATGG + Intergenic
1089580064 11:119476143-119476165 ACGAATAGATGGATGAATGATGG + Intergenic
1089580074 11:119476197-119476219 ATGAATAGATGGATGAATGATGG + Intergenic
1089663854 11:120004289-120004311 GTGAATAGATGAATAAATTATGG - Intergenic
1090140976 11:124261177-124261199 GTGGATGGATGGATGGATAAAGG - Intergenic
1090237171 11:125157951-125157973 GTGAATAAATGAATGGATGAGGG + Intergenic
1090675174 11:128985678-128985700 ATGAATGAATGGATGGACAAAGG - Intronic
1090857096 11:130619709-130619731 ATGGATAGATGGATGGAGGATGG - Intergenic
1090910294 11:131112314-131112336 GTGAATTGATGGATGAAAAAGGG - Intergenic
1091036642 11:132239983-132240005 ATGAATGGATGGATGGATGATGG - Intronic
1091187304 11:133658294-133658316 ATGGATGGATGGATGGATGATGG + Intergenic
1091187346 11:133658421-133658443 GTGGGTGGATGGATGGATGATGG + Intergenic
1091187376 11:133658529-133658551 GTGAATGGATTGATGAATGATGG + Intergenic
1091993031 12:4972336-4972358 GTGAATGGATGGATGGAGGGAGG - Intergenic
1092113830 12:5984606-5984628 GTGAATAGTGGGCTGAATAATGG - Intronic
1092602188 12:10079273-10079295 GTGGATGGATGGATGGATAATGG + Intronic
1092841354 12:12544972-12544994 TGGAATAAATGAATGGATAATGG - Intronic
1094637564 12:32241285-32241307 GGGAATAGCTGCATGTATAAGGG + Intronic
1094764716 12:33579599-33579621 GTGAATGGAAGATTGGATAAAGG + Intergenic
1094783966 12:33824267-33824289 ATAAACTGATGGATGGATAAAGG + Intergenic
1095525510 12:43120177-43120199 ATGAATAGATGAATGAGTAATGG - Intergenic
1096122222 12:49095502-49095524 GTGCCTAGATGGACGGTTAAGGG - Intergenic
1096536760 12:52279827-52279849 GTGAATGGATGGATGGAGAATGG - Intronic
1097757416 12:63422221-63422243 TTGAATAAATGAATGGATTAGGG - Intergenic
1098624736 12:72650137-72650159 ATCAACAGATGGATGGATAAAGG + Intronic
1099217355 12:79869198-79869220 GTGAATAGGTAGATGAATGATGG - Intronic
1100011657 12:89961229-89961251 GAGGATAGATGGAGGGAGAAAGG - Intergenic
1101011700 12:100457430-100457452 GTGAATTAATGGATGAATTAGGG + Intergenic
1101201302 12:102439193-102439215 ATGAATAAATGAATGGAGAAGGG + Intronic
1101261980 12:103042370-103042392 GTGAAATGATGGCTGGAGAAAGG + Intergenic
1101270742 12:103141489-103141511 ATGGATTGATGAATGGATAAAGG + Intergenic
1101797993 12:107994069-107994091 ATTAATAGATGACTGGATAATGG - Intergenic
1102041329 12:109802807-109802829 ATGGATAGATGGATGGATGAAGG - Intronic
1102042453 12:109809367-109809389 ATGAATGGGTGGATGGATGATGG - Intronic
1102043146 12:109813689-109813711 ATGAATAGATGGATGGATGATGG + Intronic
1102043152 12:109813720-109813742 GTAGATGGATGGATGGATGATGG + Intronic
1102043168 12:109813845-109813867 ATGAATGGATGGATGGATGATGG + Intronic
1102434653 12:112911347-112911369 GGAAATAGAGGGATGGAAAAAGG + Intronic
1102452721 12:113053812-113053834 ATGGATTGATGGATGGATGATGG + Intergenic
1102452729 12:113053843-113053865 GTGTATGGATGAATGGATGATGG + Intergenic
1102504242 12:113373827-113373849 ATGGGTAGATGGATGGATGATGG - Intronic
1102506926 12:113389590-113389612 GTAGATGGATGGATGGATGATGG - Exonic
1102514748 12:113438895-113438917 ATGAATGCATGGATGGATTATGG - Intergenic
1102785952 12:115604959-115604981 AAGAATAGATGGATGGACAATGG + Intergenic
1102789136 12:115629621-115629643 ATGGACAGGTGGATGGATAATGG + Intergenic
1102789139 12:115629636-115629658 GATAATGGATGGATGGATGATGG + Intergenic
1102881805 12:116491210-116491232 GAGAATGGATAGATGTATAATGG - Intergenic
1102889992 12:116551267-116551289 AGGGATAGATGGATGGATGATGG + Intergenic
1102895620 12:116595853-116595875 ATGGATGGATGGATGGATGAAGG + Intergenic
1103002471 12:117395863-117395885 ATGAATGGATGGCTGGATAATGG - Intronic
1103012774 12:117469997-117470019 ATGGATGGATGGATGGATGAAGG - Intronic
1103055150 12:117813881-117813903 AAGAAGAGATGAATGGATAAAGG + Intronic
1103064171 12:117883084-117883106 CTGAATGGATGGATGGTTGAAGG - Intronic
1103149669 12:118626177-118626199 ATGAATAGATGGGTGGATGTAGG - Intergenic
1103178918 12:118890497-118890519 ATGAATAGATAGATGTATGAGGG + Intergenic
1103184864 12:118947995-118948017 GTGAATAGATGGGTGGATGAGGG - Intergenic
1103371453 12:120422659-120422681 ATGAATAAATGAATGAATAAAGG + Intergenic
1103403915 12:120661386-120661408 ATGAATAGATGCATGGGGAAGGG - Intronic
1103403950 12:120661614-120661636 ATAAATGGATGGATGGATGATGG - Intronic
1103530449 12:121597564-121597586 ATGAATAGATGGACGTAAAATGG + Intergenic
1103834325 12:123807128-123807150 ATGGATGGATGGATGGATGATGG - Intronic
1103900427 12:124300964-124300986 ATGGATAGATGGATGGATGGAGG + Intronic
1103908569 12:124339766-124339788 GTGGATGGATGGATGGATGGGGG - Intronic
1103941449 12:124503467-124503489 ATGGATGGATGGATGGATGATGG + Intronic
1104034648 12:125089902-125089924 ATGGATGGATAGATGGATAATGG - Intronic
1104034673 12:125090055-125090077 GTGGATGGATAGATGGATGAGGG - Intronic
1104034688 12:125090140-125090162 ATGGATAGATGGATGGATGATGG - Intronic
1104034698 12:125090204-125090226 ATGGATGGATAGATGGATAATGG - Intronic
1104034774 12:125090720-125090742 ATGGATGGATGGATGGATGATGG - Intronic
1104075695 12:125387792-125387814 ATGGATGGATGGATGGATAACGG - Intronic
1104394627 12:128421870-128421892 GTGAACAGAGAGATGGAAAAAGG - Intronic
1104491563 12:129198421-129198443 ATCAACAGATGGATGGGTAAAGG + Intronic
1104567607 12:129899325-129899347 ATGGATGGATGGATGGATGATGG + Intronic
1104567620 12:129899376-129899398 GTAGATGGATGGGTGGATAATGG + Intronic
1104765446 12:131327366-131327388 ATGAACAGATGGATGGATGGTGG + Intergenic
1104778404 12:131404630-131404652 ATGGATGGATGGATGGATGATGG - Intergenic
1104778423 12:131404708-131404730 ATGGATGGATGGATGGATGATGG - Intergenic
1104778467 12:131404886-131404908 GTTGATGGATGGATGGATGAGGG - Intergenic
1104778478 12:131404921-131404943 GTTGATGGATGGATGGATGACGG - Intergenic
1104778488 12:131404956-131404978 GTGGATGGATGGATGGATGACGG - Intergenic
1104778497 12:131404987-131405009 GTGGATGGATGGATGAATGATGG - Intergenic
1104778565 12:131405252-131405274 GTGGATGGATGGATGGATGATGG - Intergenic
1104778607 12:131405385-131405407 GATAATGGATGGATGGATGATGG - Intergenic
1104778641 12:131405513-131405535 GTGGATGGATGGATGGATGATGG - Intergenic
1104778648 12:131405544-131405566 GTGGATAGATGTATGGATGATGG - Intergenic
1104779334 12:131409819-131409841 GTGAATGGATGGATGGATGATGG - Intergenic
1104803159 12:131568547-131568569 ATGAATGGATGGATGGATAGGGG - Intergenic
1104813877 12:131634697-131634719 ATGAACAGATGGATGGATGGTGG - Intergenic
1104896304 12:132166644-132166666 GTGGGTGGATGGATGGATGATGG - Intergenic
1104896361 12:132166864-132166886 GTGGATGGACGGATGGATGATGG - Intergenic
1104896439 12:132167148-132167170 GTGGATGAATGGATGGATAAGGG - Intergenic
1104906696 12:132217350-132217372 GTAGGTAGATGGATGGATAAAGG - Intronic
1104906762 12:132217662-132217684 GTAGGTAGATGGATGGATAAAGG - Intronic
1104906799 12:132217843-132217865 GTAGGTAGATGGATGGATAAAGG - Intronic
1105249011 13:18679293-18679315 ATGGATAGTTAGATGGATAAGGG + Intergenic
1105279828 13:18956988-18957010 ATGGGTAGATGGATGGATCATGG - Intergenic
1105533770 13:21244839-21244861 GTGAATTGATGATTGTATAATGG + Intergenic
1105966718 13:25391320-25391342 ATGAATAGATGGGTGAAGAATGG - Intronic
1106000584 13:25719479-25719501 ATGGATGGATGGATGGATGATGG + Intronic
1106085303 13:26536340-26536362 GTGGATAGTTGAATGGAGAAGGG + Intergenic
1106331028 13:28739831-28739853 CAGAATAGATGTATGTATAAAGG + Intergenic
1106569612 13:30915334-30915356 CTGAATAGATGGATGGCAAGAGG + Intronic
1106688146 13:32084219-32084241 GTGAATAAAAGGAAGAATAAGGG + Intronic
1109914374 13:68961753-68961775 ATCAATGGATGTATGGATAAAGG - Intergenic
1110124892 13:71930448-71930470 ATCAACAGATGAATGGATAAAGG - Intergenic
1110476067 13:75915512-75915534 GTGAATTGAAGGAGGGGTAAAGG + Intergenic
1110752517 13:79131803-79131825 TTGAATGAATGGATGGATGAAGG - Intergenic
1111216999 13:85157010-85157032 GTGAATAGAGGTTTTGATAAAGG - Intergenic
1111716152 13:91881577-91881599 GTAGATAGATAGATGTATAAAGG - Intronic
1112081468 13:95976302-95976324 ATTAATGGATGGGTGGATAAAGG - Intronic
1112838626 13:103547918-103547940 GTGATTCGCTGGATGGAAAAGGG - Intergenic
1113037214 13:106063167-106063189 TTGAATGGATGGATGGCTGAAGG + Intergenic
1113072883 13:106438685-106438707 ATGGATGGATGGATGGATGATGG + Intergenic
1113072945 13:106439003-106439025 ATGGATATATGGATGGATGAAGG + Intergenic
1113901007 13:113798081-113798103 ATGGATAGAAGGATGGATAATGG + Intronic
1113901024 13:113798166-113798188 ATGGATAGAAGGATGGATGATGG + Intronic
1113901038 13:113798236-113798258 ATGGATAGAAGGATGGATGATGG + Intronic
1113901059 13:113798357-113798379 ATGAATAGAAGGATGGATAATGG + Intronic
1113901073 13:113798443-113798465 ATGAATCGAAGGATGGATAATGG + Intronic
1113901087 13:113798514-113798536 ATGAATGGAAGGATGGATGATGG + Intronic
1113901092 13:113798543-113798565 ATGGATAGAAGGATGGATGATGG + Intronic
1113901113 13:113798649-113798671 ATGAATGGAAGGATGGATAATGG + Intronic
1113901138 13:113798771-113798793 ATGAATGGAAGGATGGATGATGG + Intronic
1113935062 13:113989558-113989580 GTGGATAGATGGATGAGTGATGG - Intronic
1114497984 14:23147136-23147158 GTGGATGGATGCATGGATGATGG - Intronic
1114569344 14:23655327-23655349 GTGGATAGATGAATGGAAAGGGG - Intergenic
1114939844 14:27595009-27595031 GTCAATGGATGAATGAATAAAGG + Intergenic
1115086003 14:29515502-29515524 ATAAATAGGTGAATGGATAAAGG - Intergenic
1115297763 14:31848803-31848825 GTCAATAGATGGCTATATAAAGG + Intronic
1115679817 14:35724980-35725002 ATGAATAGCTGGATAGATATGGG - Intronic
1115813724 14:37139501-37139523 GAAAATATATGGAGGGATAAAGG - Intronic
1116723751 14:48534127-48534149 ATAGATAGATGGATAGATAACGG - Intergenic
1117016636 14:51525172-51525194 ATGGATGGATGGATGGATAAAGG + Intronic
1118846543 14:69551607-69551629 GTGAATGGATGGGAGGAAAAAGG - Intergenic
1118851637 14:69588255-69588277 TTGGATGGATGGATGGATGATGG - Intergenic
1119170733 14:72534580-72534602 ATGAATAGATAAATGGGTAAAGG - Intronic
1119279810 14:73396256-73396278 ATGGGTAGATGGATGGATAGAGG - Intronic
1120577035 14:86195190-86195212 ACGAATAGGTGGATGGATACAGG + Intergenic
1120656256 14:87193608-87193630 ATGGATGGATGAATGGATAATGG + Intergenic
1120671936 14:87372624-87372646 ATGGATAGATAGATAGATAAAGG - Intergenic
1121062234 14:90923425-90923447 ATGGATGGATGGATGGATGATGG - Intronic
1121096560 14:91221494-91221516 ATGCATGGATGGATGGATAGTGG + Intronic
1121277474 14:92678051-92678073 GTTAATGGATGGATGAATGATGG - Intronic
1121277550 14:92678363-92678385 GTGAATAAGTGGATGGGTAGGGG - Intronic
1121398231 14:93646953-93646975 GTGAATGAATGAATGAATAAAGG - Intronic
1121423174 14:93829995-93830017 ATGGATAGATGGATGGATGGTGG + Intergenic
1121449357 14:93997612-93997634 GTGAATAAATGCATGGATGGGGG + Intergenic
1121530086 14:94646394-94646416 GTGAATAGATGGATACATATGGG + Intergenic
1121627165 14:95394346-95394368 ATGAATGGATGGCTGGATGATGG + Intergenic
1121627191 14:95394520-95394542 TTGAATATATGGATGGATGATGG + Intergenic
1121658663 14:95618062-95618084 GGGAAAAGATGTAAGGATAAGGG + Intergenic
1121681181 14:95793882-95793904 GGGAATAGGTGGATGCATGAGGG + Intergenic
1121824939 14:97002454-97002476 GTGTATGGATGGATGGATGGGGG - Intergenic
1121855404 14:97264957-97264979 ATGAATTGCTGGAAGGATAAAGG + Intergenic
1122011545 14:98753116-98753138 GTGAGTGGATGGATGGATGGAGG + Intergenic
1122074796 14:99229092-99229114 ATGGATGGATGGATGGATACAGG + Intronic
1122252798 14:100452003-100452025 ATGGATAGTTGGATGGATGATGG - Intronic
1122354980 14:101117546-101117568 ATGGACAGATGGATGGATGATGG - Intergenic
1122395495 14:101425933-101425955 ATGAATTGATGGAAGGATAGAGG + Intergenic
1122600813 14:102920828-102920850 GTGAATAGGTGGATGGTGGATGG - Intergenic
1122600890 14:102921260-102921282 GTGAATAGATAGATGGTAAATGG - Intergenic
1122625232 14:103082123-103082145 GTGAATGGATGGGTGCATGATGG + Intergenic
1122794171 14:104197497-104197519 GTGGATATATGGATAGATGATGG - Intergenic
1122794207 14:104197816-104197838 ATGAATAGGTGGATGGATGGCGG - Intergenic
1122877500 14:104675595-104675617 GTGGTTAGATGGATGGATGGTGG + Intergenic
1122879821 14:104685739-104685761 ATGGGCAGATGGATGGATAAGGG + Intergenic
1122879963 14:104686263-104686285 ATGGGCAGATGGATGGATAAGGG + Intergenic
1122958230 14:105082797-105082819 GGGGATGGATGGATGGATAGAGG - Intergenic
1123057214 14:105576255-105576277 GGGGAGAGATGGATGGAGAAAGG - Intergenic
1123081030 14:105695636-105695658 GGGGAGAGATGGATGGAGAAAGG + Intergenic
1123083171 14:105705609-105705631 ATGGATGGATGGATGGATGATGG - Intergenic
1123736879 15:23194142-23194164 GTAGATAGATAGATGTATAAAGG - Intergenic
1123797861 15:23791784-23791806 TTGAATGGAGGGATGGATATGGG + Intergenic
1123915391 15:25020134-25020156 GAGAATTGATGGGTGGATACTGG + Intergenic
1124071586 15:26398426-26398448 TTCAATAGGTGAATGGATAAAGG - Intergenic
1124105292 15:26732083-26732105 GTGGATGGATGGATAGATGATGG + Intronic
1124287579 15:28417119-28417141 GTAGATAGATAGATGTATAAAGG - Intergenic
1124288100 15:28422820-28422842 GTAGATAGATAGATGTATAAAGG - Intergenic
1124295126 15:28494507-28494529 GTAGATAGATAGATGTATAAAGG + Intergenic
1124395756 15:29300133-29300155 GTGAGTAAATGGATGGATAATGG + Intronic
1124395798 15:29300316-29300338 ATGGATGGATGGATGGATGATGG + Intronic
1124656852 15:31515927-31515949 ATGGATGGATGGATGGATAGAGG - Intronic
1124849914 15:33326275-33326297 GTGGATGGACGGATGAATAAGGG - Intronic
1125810614 15:42537648-42537670 ATCAACAGATGAATGGATAAGGG + Intronic
1126103248 15:45132179-45132201 TTGAAGAAATAGATGGATAATGG + Intronic
1126753233 15:51898575-51898597 TCGAATACATGTATGGATAAGGG + Intronic
1126891514 15:53210090-53210112 GTAGATAGATGGATAGATAGAGG - Intergenic
1127764016 15:62166980-62167002 GTGAATAGATGGAGGAAGGATGG - Intergenic
1128518968 15:68362911-68362933 ATGAATGGGTGGATGGATGATGG + Intronic
1128793500 15:70449467-70449489 ATGAATAGATGGAAGGATATAGG + Intergenic
1128793701 15:70450202-70450224 ATGAATGGATGGAGAGATAAAGG + Intergenic
1129085394 15:73084531-73084553 ATCAACAGATGAATGGATAAAGG - Intronic
1129604991 15:77020525-77020547 GTGACTAAATGGATGGAGGATGG - Intronic
1129720065 15:77873005-77873027 ATGAATGGATGGATGGATGGGGG + Intergenic
1130353617 15:83111306-83111328 ATAAATGGATGGATGGATGATGG - Intronic
1130353625 15:83111358-83111380 GTGAATAGATGGATGGATGATGG - Intronic
1130353634 15:83111400-83111422 ATGAATGGATGGATGGATGATGG - Intronic
1130353643 15:83111465-83111487 GTGAATGGTTGGATGGATGATGG - Intronic
1130353648 15:83111488-83111510 ATGGATAGATGGATGGATGATGG - Intronic
1130384954 15:83403076-83403098 GTCAAAATATGAATGGATAATGG + Intergenic
1130565395 15:84989947-84989969 ATGGGTTGATGGATGGATAAAGG - Intronic
1130740751 15:86597128-86597150 ATGGATGGATGGATGGATATAGG - Intronic
1131214524 15:90526246-90526268 GTGAATTGGTGGACAGATAATGG + Intergenic
1132030857 15:98437721-98437743 ATGGATGGATGGATGGATGATGG + Exonic
1132030864 15:98437755-98437777 ATGAATGGATGGATGGAGGATGG + Exonic
1132030886 15:98437869-98437891 GAGGATGGATGGATGGATGATGG + Exonic
1132030901 15:98437924-98437946 ATGGATAGATGGATGGATGGAGG + Exonic
1132030914 15:98437981-98438003 ATGGATGGATGGATGGATGATGG + Exonic
1132030920 15:98438007-98438029 GAGGATGGATGGATGGATGATGG + Exonic
1132083113 15:98884239-98884261 GTCAGCAGATGGATGGAGAAGGG - Intronic
1132358493 15:101191874-101191896 GTGAGTAGATAGATGGATGAAGG - Intronic
1132644951 16:994465-994487 ATGAACAGATGGATGAATGAGGG - Intergenic
1132653668 16:1032611-1032633 ATGGATTGATGGATGGATGATGG - Intergenic
1132653736 16:1032936-1032958 ATGGATGGATGGATGGATGATGG - Intergenic
1132653816 16:1033321-1033343 ATGAGTGGATGGATGGATGATGG - Intergenic
1132653829 16:1033388-1033410 ATGGATTGATGGATGGATGATGG - Intergenic
1132653854 16:1033506-1033528 ATGGATGGATGGATGGATGATGG - Intergenic
1132903266 16:2269680-2269702 GTGAATGGATGGATAGATAGTGG + Intergenic
1133204833 16:4227056-4227078 ATGGATGGATGGATGGATGATGG + Intronic
1133204868 16:4227230-4227252 GTGGGTGGATGGATGGATGAAGG + Intronic
1133326811 16:4946989-4947011 ATGGATAGATGGATGGATGGAGG - Intronic
1133326833 16:4947077-4947099 ATGAATGGATGGATGGAGGAAGG - Intronic
1133435861 16:5778959-5778981 ATGAATAGATCAATGGATGAGGG - Intergenic
1133500846 16:6365224-6365246 ATGGGTAGATGGATGGATAGAGG + Intronic
1133530855 16:6653707-6653729 ATGAATAGATGAGTGGATAGAGG + Intronic
1133530913 16:6653989-6654011 ATGGATGGATGGATGGATAGAGG + Intronic
1133530941 16:6654108-6654130 GTGGATGGATGGATGGGTAGAGG + Intronic
1133554397 16:6891096-6891118 ATGAATGAATGGATGGATATTGG - Intronic
1133614023 16:7459022-7459044 GTGAATGGATGGATGAATGATGG + Intronic
1133614032 16:7459074-7459096 GTGAGTGGATGGATGGATGATGG + Intronic
1133614041 16:7459126-7459148 GTGAGTGGATGGATGAATGACGG + Intronic
1133862495 16:9609399-9609421 ATGAATGGATGGATGAATTATGG + Intergenic
1133874169 16:9717869-9717891 ATGAATAGATGCATTAATAATGG - Intergenic
1134083315 16:11339462-11339484 GTGGATGGATGGGTGGATAGAGG - Intronic
1134105971 16:11486251-11486273 GTGAATAGATGGATGGATGGAGG + Intronic
1134106039 16:11486601-11486623 GTGGTTAGATGAATGGATGATGG + Intronic
1134106074 16:11486725-11486747 GTGGGTGGATGAATGGATAATGG + Intronic
1134106083 16:11486756-11486778 GTGGATGGATGAATGGATAATGG + Intronic
1134224437 16:12380483-12380505 GTGGATAGGTGGATGGATGGTGG - Intronic
1134224447 16:12380514-12380536 GTGGACAGGTGGATGGATGAGGG - Intronic
1134224514 16:12380724-12380746 GTGGATGGATGGATGGATGGCGG - Intronic
1134224681 16:12381226-12381248 GTGGATAGGTAGATGGATGAGGG - Intronic
1134224745 16:12381456-12381478 GTGGATAGGTGGATGGATGATGG - Intronic
1134224769 16:12381533-12381555 GTGGATAGGTGGATGGATGATGG - Intronic
1134224798 16:12381630-12381652 GTGGATAGGTGGATGAATGATGG - Intronic
1134224825 16:12381707-12381729 GTGGATAGGTGGATGGACGATGG - Intronic
1134456843 16:14401210-14401232 TTGGATAGATGGAAGGATAGAGG + Intergenic
1134488430 16:14677723-14677745 ATGGATGGATGGATGGATGATGG + Intronic
1134529108 16:14968622-14968644 GTGAACAGCTGGGTGGATGATGG + Intergenic
1134632254 16:15765254-15765276 GAGGATAGATGGATGAATAGAGG + Intronic
1134685539 16:16155592-16155614 ATGAATGGAAGGATGGATGAGGG - Intronic
1134766924 16:16767259-16767281 ATGGATAGATGGATGGATGGTGG - Intergenic
1134788004 16:16962459-16962481 ATGGATGGATGGATGGATGAAGG + Intergenic
1134819986 16:17239278-17239300 GTGGATGGATGGATGGATCATGG - Intronic
1134819996 16:17239330-17239352 GTGAGTGGATGGATGGATGATGG - Intronic
1134820015 16:17239416-17239438 GTAGATGGATGGATGGATCATGG - Intronic
1134820024 16:17239468-17239490 GTGGGTGGATGGATGGATGATGG - Intronic
1134859392 16:17547651-17547673 GTGGATAGATGGATGAATGAAGG - Intergenic
1135614740 16:23901493-23901515 GAGAGTAGATGGATAGATGAGGG + Intronic
1135828833 16:25755001-25755023 ATGGACAGATGGATGGATGATGG - Intronic
1136041246 16:27580647-27580669 GGGAATGGATGGGTGGGTAAAGG - Intronic
1136071358 16:27789417-27789439 ATGGATAGATGGAGGGATGATGG + Exonic
1136071396 16:27789700-27789722 ATGGATGGATGGATGGATGATGG + Exonic
1136071468 16:27790214-27790236 ATGAATGGATGGATGGATAATGG + Exonic
1136290811 16:29270303-29270325 ATGGATGGATGGATGGATAAAGG + Intergenic
1136295487 16:29299164-29299186 GTGGATAGATGGATGAACAGTGG + Intergenic
1137386081 16:48043896-48043918 GTGAATGGGTGGATGGATGATGG - Intergenic
1137386085 16:48043911-48043933 GTGAATGGATTGATGGTGAATGG - Intergenic
1137386101 16:48044012-48044034 GTGAATGGATGGCTGGATGGTGG - Intergenic
1137386115 16:48044082-48044104 GTGGATGGATGGATGGATGGGGG - Intergenic
1137386128 16:48044120-48044142 GTGGATGGATGGATGGTGAATGG - Intergenic
1137386142 16:48044181-48044203 ATGAATGGATGGATGGATGATGG - Intergenic
1137386165 16:48044316-48044338 GTGGATCAATGGATGGATGATGG - Intergenic
1137397974 16:48130360-48130382 GTGAATAAATGAATGAATAAAGG + Intronic
1137601623 16:49760170-49760192 ATGGATGGATGGATGGATGAGGG + Intronic
1137625611 16:49906099-49906121 ATGGATGGATGGATGGATGATGG + Intergenic
1137765040 16:50971538-50971560 GTGTATAAATGGATAGGTAATGG - Intergenic
1137789765 16:51165196-51165218 GTGAATGGAGGGTTGGAGAAAGG + Intergenic
1137811185 16:51354326-51354348 ATGGATAGATGAATGGATAGAGG - Intergenic
1137977047 16:53040906-53040928 GTGGATGGATGGAGGGATAATGG + Intergenic
1137977060 16:53040985-53041007 GTGGATGGATGGATGGATAATGG + Intergenic
1137977074 16:53041068-53041090 GTGGATGGATGCATGGATGATGG + Intergenic
1138085658 16:54131695-54131717 TTGAATACATGAATGGATACTGG + Intergenic
1138244035 16:55453097-55453119 ATGGATGGATGGATGGATAAAGG - Intronic
1138345449 16:56317470-56317492 GTGAATGGATGAGTGGATCAAGG + Intronic
1138440362 16:57030648-57030670 ATGGATGGATGGATGGATGAAGG + Intronic
1138495671 16:57407745-57407767 ATGGATGGATGGATGGATGATGG - Intronic
1138495765 16:57408309-57408331 GTGAATGGATGGATGGAGGATGG - Intronic
1138547764 16:57729691-57729713 ATGGATGGATGGATGGATGATGG + Intronic
1138547854 16:57730050-57730072 ATGGATGGATGGATGGATGATGG + Intronic
1138764099 16:59579183-59579205 ATCAACAGATGAATGGATAAAGG - Intergenic
1138800290 16:60018163-60018185 GAGAGTAGATTGATAGATAATGG - Intergenic
1138827504 16:60338179-60338201 GTGGATTGAAGGATGGAAAATGG + Intergenic
1139219595 16:65167019-65167041 ATGAATTGATGGATGGACAGAGG - Intergenic
1139247254 16:65457151-65457173 ATGAATAGATGGATAGATAAAGG - Intergenic
1139369380 16:66457207-66457229 GTGGATGGATGGATGAATGACGG + Intronic
1139867257 16:70072353-70072375 GTGAACAGCTGGGTGGATGATGG - Intergenic
1139982664 16:70872529-70872551 GTGGATGGATGAATGGATGATGG - Intronic
1139982737 16:70872795-70872817 CTGCATGGATGGATGGATGATGG - Intronic
1140238308 16:73178832-73178854 GAGGATGGATGGACGGATAATGG - Intergenic
1140246531 16:73254928-73254950 GTGGATGGATGGATGGATGGTGG - Intergenic
1140413607 16:74757172-74757194 ATCAATAGAAAGATGGATAAAGG + Intronic
1140663570 16:77210136-77210158 ATGAAGAGATGGATGGATACAGG - Intronic
1141031992 16:80597079-80597101 GTGGATAGATGGATGGATGATGG + Intergenic
1141110102 16:81265317-81265339 GTGGGTAGATGGATGGATGGAGG - Intronic
1141110175 16:81265593-81265615 GTGGATGGATGGATGAATGATGG - Intronic
1141110230 16:81265822-81265844 GTGGGTAGATGGATGAATGATGG - Intronic
1141178356 16:81735318-81735340 ATGGATAGATAGATGGATGATGG + Intergenic
1141283393 16:82649315-82649337 GAGGATGGATGGATGGATGATGG + Intronic
1141421616 16:83921379-83921401 ATGGATAGATGGATGGAGGAGGG + Exonic
1141430285 16:83967752-83967774 GTGGATGGATGGATGGATGGAGG + Intergenic
1141473642 16:84256983-84257005 ATGAACGGATGGATGGATGATGG + Intergenic
1141483715 16:84324856-84324878 GTGGATGGATGGATGGATGGTGG - Intronic
1141483897 16:84326046-84326068 ATGGATAGATGGATGGATAGTGG - Intronic
1141606498 16:85156941-85156963 ATGGATGGATGGATGGAGAAAGG - Intergenic
1141619874 16:85231476-85231498 ATGAATAGATGGATGGACGGAGG + Intergenic
1141641866 16:85346297-85346319 GTGGATGGGTGGATGGATGATGG + Intergenic
1141641943 16:85346612-85346634 ATGGATGGATGGATGGATGATGG + Intergenic
1141641988 16:85346821-85346843 ATGGATGGATGGATGGATGATGG + Intergenic
1141642254 16:85348159-85348181 GTGAATGGGTGGATGGATGATGG - Intergenic
1141650012 16:85387932-85387954 ATGGATGGATGGATGGATAAAGG + Intergenic
1141659388 16:85433784-85433806 TTGGATAGATGGATGGATTTTGG + Intergenic
1141854759 16:86673523-86673545 GTGGATGGATGAATGGATGAAGG - Intergenic
1142096683 16:88243771-88243793 ATGCAAGGATGGATGGATAAAGG + Intergenic
1142152386 16:88518401-88518423 GTGGATGGATGGATGGATGATGG + Intronic
1142152470 16:88518757-88518779 ATGGATGGATGGATGGATGATGG + Intronic
1142152563 16:88519134-88519156 ATGGATGGATGGATGGATGATGG + Intronic
1142152752 16:88519955-88519977 ATGGATGGATGGATGGATAGTGG + Intronic
1142255624 16:89012415-89012437 GTGAATGGGTGGATGGATGGTGG - Intergenic
1203141332 16_KI270728v1_random:1769017-1769039 ATGGATGGATGGATGGATAGTGG + Intergenic
1203142273 16_KI270728v1_random:1775896-1775918 ATGAATGGATGAATGGATAAAGG - Intergenic
1142956688 17:3527639-3527661 ATGGAAAGATGGTTGGATAAAGG + Intronic
1143395793 17:6594795-6594817 ATGAACTGATGGATGGATAGAGG + Intronic
1143408261 17:6692309-6692331 ATGAATAGATGCATGGATGATGG + Intronic
1144100697 17:11939828-11939850 ATGGATGGATGGATGGATGATGG + Intronic
1144482846 17:15641754-15641776 ATGAATGGATGGATGGATGATGG + Intronic
1144728573 17:17513992-17514014 GAGGATAGATGGATGGAGGAAGG - Intronic
1144767832 17:17742447-17742469 GTGAATGAATGAATGAATAAAGG + Intronic
1144839492 17:18177018-18177040 GTGGATAGATGGATGGATGAAGG + Intronic
1144910150 17:18673894-18673916 GTAAATACAGTGATGGATAAAGG + Intronic
1144915840 17:18723277-18723299 ATGAATGGATGGATGGATGATGG - Intronic
1145262410 17:21362340-21362362 ATGAATGGATGGATGGATGATGG + Intergenic
1145262425 17:21362479-21362501 ATGCATGGATGGATGGATGATGG + Intergenic
1145271569 17:21407568-21407590 GTGGATGGATGGATGGGTAATGG - Intronic
1145271658 17:21407990-21408012 ATGGATGGATGGATGGATGATGG - Intronic
1145358539 17:22187710-22187732 ATCAATAGATGAATGGACAAAGG - Intergenic
1145898168 17:28472861-28472883 ATGGATGGATGGATGGATGATGG + Intronic
1146460711 17:33044231-33044253 ATGAACAGATGGACAGATAATGG - Intronic
1146489233 17:33268319-33268341 ATGGAAAGATGGATGGATGATGG - Intronic
1146489236 17:33268338-33268360 ATGGATGGATGGATGGATGATGG - Intronic
1146805545 17:35862332-35862354 CTGAATAAATGGATGAATGATGG + Intronic
1146820919 17:35983065-35983087 ATGGATGGATGGATGGATGAAGG - Intergenic
1146924147 17:36732476-36732498 ATGAATGGATGGATGGATGGTGG - Intergenic
1148005714 17:44427912-44427934 ATGGATGGATGGATGGATATAGG - Intronic
1149420174 17:56502887-56502909 GGGAGTAGGTGGATGGAGAATGG + Intronic
1150361464 17:64538608-64538630 GAGAAGAGATAGATAGATAAAGG + Intronic
1150634543 17:66903803-66903825 GTGGATAGATGGATGGTGGAGGG + Intergenic
1151317763 17:73334635-73334657 GAGTCTAGATGGATGGAGAAAGG + Exonic
1151353381 17:73544618-73544640 ATGGATGGATGGATGGATAGTGG + Intronic
1151943281 17:77305924-77305946 GTGGATGGATGGATGGATGATGG + Intronic
1152038018 17:77885221-77885243 ATGAATGGATGGATGGATGGAGG + Intergenic
1152312524 17:79559695-79559717 GTGGATGGATGGGTGGATGATGG + Intergenic
1152473497 17:80503294-80503316 GTGGATAGATGGAGGGATGGAGG + Intergenic
1152473602 17:80503677-80503699 ATGAACAGATGTGTGGATAAAGG + Intergenic
1152473668 17:80503934-80503956 ATGAATAGATGGGTGGATAAGGG + Intergenic
1152473737 17:80504196-80504218 ATGAATATATGGGTGGATGAAGG + Intergenic
1152984642 18:310716-310738 ATGAATGGATGGATGGATGCAGG - Intergenic
1153777660 18:8467842-8467864 GGGCGTATATGGATGGATAAGGG - Intergenic
1153974167 18:10252359-10252381 GTGAATAGATAGATGGATTCTGG - Intergenic
1154077048 18:11213653-11213675 ATGGATGGATGGATGGATAGAGG - Intergenic
1154307813 18:13243522-13243544 ATGAGTGGATGGATGGATGATGG - Intronic
1154307969 18:13244153-13244175 GTGGATGAATGGATGGATAGAGG - Intronic
1154439870 18:14379936-14379958 ATGGATAGTTAGATGGATAAGGG - Intergenic
1155302780 18:24447143-24447165 TTGAGTGGATGGATGGATGAAGG + Intronic
1155318621 18:24596561-24596583 ATGAGCAGATGGATGGATAGAGG - Intergenic
1155417132 18:25611192-25611214 ATCAACAGATGAATGGATAAAGG + Intergenic
1155539319 18:26850728-26850750 ATGGATGGATGGATGGATGATGG - Intergenic
1155608912 18:27640741-27640763 GAGAATACATGGATGCATGATGG + Intergenic
1156135171 18:34028986-34029008 CTCAATAGAAGGATGGAAAAAGG - Intronic
1156471604 18:37380535-37380557 ATGGATAGATGGATGGAGAATGG - Intronic
1156471614 18:37380602-37380624 ATGAATAGATGGATGAATGGTGG - Intronic
1156471658 18:37380889-37380911 GTGGATGGATGGATGAATGATGG - Intronic
1156471675 18:37380999-37381021 ATGGATAGATGGATGGATGGTGG - Intronic
1156471694 18:37381107-37381129 ATGGATGGATGGATGGATGATGG - Intronic
1157012305 18:43665415-43665437 ATGAATAAATGGATAAATAATGG + Intergenic
1157062442 18:44307060-44307082 GTGTATAGATAGATAGATATAGG - Intergenic
1157113141 18:44839803-44839825 ATGAATAGATGGACAGATAAAGG + Intronic
1157177590 18:45465569-45465591 ATGCATGGATGGATGGATGAAGG - Intronic
1157554313 18:48603246-48603268 ATGAATGGATGGATGGATGCAGG + Intronic
1158049262 18:53195713-53195735 TTGCATAGATGGATGAATGAAGG - Intronic
1158509135 18:58074975-58074997 GTGAAGAGTTGGATGGACAGTGG + Intronic
1159210448 18:65314503-65314525 ATGAAAAGATGAATGGATAAAGG + Intergenic
1159300269 18:66555798-66555820 GTGCATAGAAGGATAGTTAAAGG - Intronic
1159361430 18:67409173-67409195 GTGAATAGAGAGATGGAAACTGG + Intergenic
1159591203 18:70337133-70337155 GTGGAGAGATGGAGAGATAAAGG + Intronic
1159963383 18:74573252-74573274 GATGATAGATGGATAGATAATGG - Intronic
1160315090 18:77836131-77836153 ATGAATAGATGGATGAATTGGGG + Intergenic
1160502561 18:79409525-79409547 GTGGATGAATGGATGGATGATGG - Intronic
1160526551 18:79542048-79542070 GTGGGTGGATGGATGGATGAAGG - Intergenic
1160526602 18:79542258-79542280 GTGGGTGGATGGATGGATAAGGG - Intergenic
1160526609 18:79542289-79542311 ATGGATGGATGGATGAATAATGG - Intergenic
1160526669 18:79542604-79542626 GTAAATACATGGATGGATAATGG - Intergenic
1160526677 18:79542647-79542669 ATGAGTGGGTGGATGGATAATGG - Intergenic
1160767854 19:816392-816414 GAGAATGGGTGGATGGATGATGG - Intronic
1160767943 19:816762-816784 GAGAATGGGTGGATGGATGATGG - Intronic
1160926593 19:1549637-1549659 ATGGATGGATGGATGGATGAAGG - Intergenic
1160960226 19:1717661-1717683 GTGAGTGGATGGATGGACAGAGG + Intergenic
1161018778 19:1997777-1997799 GTGAATAAATGCATGCATATGGG - Intronic
1161049782 19:2157095-2157117 ATGGATGGATGGATGGATGATGG - Intronic
1161105242 19:2440544-2440566 GTGGATGGATGGATGGATGATGG - Intronic
1161105248 19:2440567-2440589 GTGGATGGATGGATGGATGATGG - Intronic
1161105257 19:2440614-2440636 GTAGATGGATGGATGGATGATGG - Intronic
1161105282 19:2440782-2440804 ATGAGTAGATGGATGGATGATGG - Intronic
1161227654 19:3154557-3154579 GTGGACAGGTGGATGGATGATGG + Intronic
1161242772 19:3231708-3231730 ATGAATAGATTGGTGGATGATGG + Intronic
1161242807 19:3231874-3231896 ATGAATAGATGGATGGATGATGG + Intronic
1161242828 19:3231988-3232010 ATGAATGGATGGATGGATGATGG + Intronic
1161258516 19:3322891-3322913 GTGGATGGATAGATGGATAAAGG + Intergenic
1161258539 19:3322991-3323013 GTGGATGGATAGATGGACAAAGG + Intergenic
1161258549 19:3323035-3323057 ATGGATGGATGGATGGATAGAGG + Intergenic
1161258563 19:3323091-3323113 GTGGATAGATAGATGGATAAAGG + Intergenic
1161287320 19:3475548-3475570 GTGGATAGATGGATGATGAATGG + Intronic
1161287624 19:3477108-3477130 ATGGATGGATGGATGGATCATGG + Intronic
1161329110 19:3678034-3678056 GAGAATGGAGGGATGGAGAATGG + Intronic
1161347844 19:3776970-3776992 GTGGATGGATGGGTGGATGATGG + Intergenic
1161449092 19:4334667-4334689 ATGGATAGATGGATGGATGGGGG - Intronic
1161449147 19:4334921-4334943 GTGGATGGATGGATGGATTATGG - Intronic
1161449198 19:4335151-4335173 ATGAGTAGGTGGATGGATGATGG - Intronic
1161449207 19:4335193-4335215 ATGAGTGGATGGATGGATGATGG - Intronic
1161449213 19:4335220-4335242 ATGAGTAGGTGGATGGATGATGG - Intronic
1161449218 19:4335247-4335269 ATGAATGCATGGATGGATGATGG - Intronic
1161498906 19:4602542-4602564 GTGGATGGATGAATGGATTATGG + Intergenic
1161632874 19:5367756-5367778 ATGAATGGATGGATGAATGAGGG + Intergenic
1161632895 19:5367876-5367898 ATGAATGGATGGATGGGTTACGG + Intergenic
1161768977 19:6221247-6221269 ATGAATGAATGGATGGATGAGGG - Intronic
1161934503 19:7363323-7363345 GTGAATGGATAAATGGATGATGG + Intronic
1162085858 19:8248753-8248775 TTGGATGGATGGATGGATGATGG + Intronic
1162180783 19:8867388-8867410 AAGGATAGATGGATGGATGATGG + Intronic
1162203342 19:9037175-9037197 GTGAATAGATGAATAGAAGATGG + Intergenic
1162311573 19:9910873-9910895 GTGAATGGATGGAGAGAAAATGG + Intronic
1162424746 19:10587715-10587737 ATGGATGGATGAATGGATAATGG - Intergenic
1162755807 19:12858972-12858994 AAGGATAGATGGATGGATAATGG - Intronic
1162791824 19:13066960-13066982 GTGGATAGATGGGGGGCTAAGGG - Intronic
1163218175 19:15895988-15896010 ATGGATGGATGGATGGATGATGG - Intronic
1163238495 19:16043678-16043700 GTGGATGGATGGATGAATGAAGG + Intergenic
1163347690 19:16754245-16754267 ATGGATAGATGGATGGAAGATGG - Intronic
1163382656 19:16979048-16979070 AAGAATAGATGGATGGATAGTGG - Intronic
1163382667 19:16979097-16979119 ATGGATAGATGGATGGATAGTGG - Intronic
1163382681 19:16979163-16979185 ATGAATGGATGGATGGATAGTGG - Intronic
1163382690 19:16979213-16979235 ATGGATGGATGGATGGATAGTGG - Intronic
1163382700 19:16979263-16979285 ATGGATGGATGGATGGCTAATGG - Intronic
1163383546 19:16985272-16985294 GTGGATGAATGGATGGATGAAGG + Intronic
1163383551 19:16985299-16985321 ATGTATGGATGGATGGATGAAGG + Intronic
1163383586 19:16985456-16985478 ATGGATGGATGGATGGATGAAGG + Intronic
1163383606 19:16985538-16985560 GTGGATAGATGGGTGGAGAAAGG + Intronic
1163383619 19:16985593-16985615 GTAAATGGATGGATGGATGATGG + Intronic
1163383633 19:16985655-16985677 ATGAATAGATAGATGGAGGATGG + Intronic
1163383636 19:16985670-16985692 GAGGATGGATGGATGGATGAAGG + Intronic
1163409629 19:17145936-17145958 ATGGATGGATGGATGGATGATGG + Intronic
1163462268 19:17446181-17446203 ATGGATGGATGGATGGATGAGGG - Intronic
1163492641 19:17625802-17625824 GTGGGTAGATGGATGGATGCTGG - Intronic
1163609858 19:18295211-18295233 GTGGATGGATGGGTGGATGATGG - Intergenic
1163609885 19:18295318-18295340 GTGGGTAGATGGATGGATGGTGG - Intergenic
1163609890 19:18295337-18295359 GTGGGTAGATGGATGGATGGTGG - Intergenic
1163609998 19:18295733-18295755 GTGGATGGATGGATGGATGGTGG - Intergenic
1163675422 19:18653405-18653427 ATGAAAAGATGGGTGGATAGGGG - Intronic
1164585821 19:29475255-29475277 GTTAAAAGATAGATGGATAATGG + Intergenic
1164597775 19:29541457-29541479 ATGAATAGATGGGTGGATGATGG + Intronic
1164637921 19:29805140-29805162 GTGCATGGATGAATGGATGAGGG - Intergenic
1164670170 19:30067965-30067987 GTGAATGGAGGGATGGATGGAGG - Intergenic
1164670314 19:30068634-30068656 GTGGATGGATGGATGGAGAGAGG - Intergenic
1164706510 19:30324033-30324055 ATGGATAGATGGATGGAGGATGG - Intronic
1164718159 19:30408750-30408772 AAGGATAGATGGATGGATGATGG - Intronic
1164797296 19:31044403-31044425 ATGGATGGATGGATGGATGAAGG + Intergenic
1164872967 19:31661990-31662012 GTCAACAGATGAATGGATAAAGG + Intergenic
1165144390 19:33722093-33722115 ATGGATGGATGGATGGATGAAGG + Intronic
1165190314 19:34057442-34057464 ATGGGTAGATGGATGGATGATGG + Intergenic
1165190431 19:34058391-34058413 GTGGATGGATGGATAGATAGGGG + Intergenic
1165438598 19:35811046-35811068 ATGGATTGATGGATGGATAGAGG + Intronic
1165561500 19:36684250-36684272 GTGAATAAGTGCATGGATATAGG - Intergenic
1165787073 19:38468045-38468067 ATGGATGGATGGATGGATGATGG - Intronic
1165787101 19:38468204-38468226 ATGGATGGATGGATGGATGATGG - Intronic
1165789806 19:38484475-38484497 TTGAATGGATGAATGAATAAAGG - Intronic
1166119895 19:40679830-40679852 GTGAATTGATGAATGGAGATGGG + Intronic
1166345117 19:42160771-42160793 GTGAATGGATGGGTGGATGGAGG + Intronic
1166647678 19:44544195-44544217 ATGGATGGATGGATGGATGACGG - Intergenic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1167086853 19:47315932-47315954 ATGGATGGATGGATGGATAATGG - Intronic
1167101304 19:47405904-47405926 ATGGATGGATGGATGGATAGTGG + Intronic
1167144204 19:47672281-47672303 GTAAGTAGATGGATAGATGAAGG + Intronic
1167161417 19:47769727-47769749 ATGGATGGATGGATGGATGATGG - Intergenic
1167161425 19:47769762-47769784 ATGGATGGATGGATGGATGATGG - Intergenic
1167168964 19:47818337-47818359 ATGGATGGATGGATGGATGATGG - Intronic
1167191960 19:47996692-47996714 GTTGATGGATGGATGGATGAGGG + Intronic
1167233818 19:48301943-48301965 CTGGATAGATAGATGGATATGGG + Intronic
1167233848 19:48302112-48302134 ATGAATGGATGGATGGATATAGG + Intronic
1167233864 19:48302196-48302218 CTGGATAGATAGATGGATATGGG + Intronic
1167233883 19:48302322-48302344 CTGAATGGATGGATGGATATAGG + Intronic
1167233897 19:48302396-48302418 ATGGATGGATGGATGGATATGGG + Intronic
1167339035 19:48903962-48903984 GTGGATGGATGGATGGATGATGG + Intronic
1167387540 19:49172697-49172719 GTGAGAAGATGGATGGATGGAGG - Intronic
1167387610 19:49173241-49173263 GTGAGAAGATGGATGGATGGAGG - Intronic
1167387621 19:49173315-49173337 GTGAGAAGATGGATGGATGGAGG - Intronic
1167556041 19:50196364-50196386 ATAAATGGATGGATGGATGAAGG - Intronic
1167556046 19:50196394-50196416 ATGGATGGATGGATGGATGATGG - Intronic
1167598194 19:50438270-50438292 ATGGGTAGGTGGATGGATAACGG + Intronic
1167601287 19:50456289-50456311 ATGGATGGATGGATGGATGATGG - Intronic
1167634190 19:50644458-50644480 GTGAATGGCTGGATGGATAGAGG + Intronic
1167634195 19:50644489-50644511 GTGGATAGATGGATGGATGTTGG + Intronic
1167704851 19:51075345-51075367 GTTGATGGATGAATGGATAAAGG + Intergenic
1168028621 19:53662324-53662346 TTGAATAGATGCAAGGATATTGG + Intergenic
1168330880 19:55567779-55567801 GTGAATGGATGGATGGATGATGG + Intergenic
1168330890 19:55567830-55567852 GTGAATGGATGGATGGATGATGG + Intergenic
1168330930 19:55568082-55568104 ATGCATAGATGGATGGATGATGG + Intergenic
1168330950 19:55568188-55568210 GTAGATAGATGGATGGATGATGG + Intergenic
1168330961 19:55568266-55568288 ATGAATAGATGGATGGATTATGG + Intergenic
1168330965 19:55568293-55568315 ATGTATAGATGGATGGCTGATGG + Intergenic
1168330970 19:55568324-55568346 GTGAATGGATGAATGGATAATGG + Intergenic
1168414312 19:56159055-56159077 GTGGATGGATGGACGGATGATGG - Intronic
1168508248 19:56954479-56954501 GATAATGGATGGATGGATAGTGG - Intergenic
1168508251 19:56954494-56954516 ATGGATGGATGAATGGATAATGG - Intergenic
1168508267 19:56954585-56954607 ATGGATGGATGGATGGATAAGGG - Intergenic
925119316 2:1405158-1405180 GTGGATGGGTGGGTGGATAATGG - Intronic
925260219 2:2522138-2522160 GTAGATAGTTGGATGGATGAAGG - Intergenic
925541185 2:4969547-4969569 ATGGATGGATGGATGGATGATGG - Intergenic
925735841 2:6962947-6962969 TTTAAAAGATGGATGAATAAGGG + Intronic
925745306 2:7038866-7038888 GTGGATGGATGCATGGATGATGG + Intronic
925745313 2:7038911-7038933 GTGGATGGATAGATGGATGATGG + Intronic
925925605 2:8667993-8668015 ATGAATGGATGGATGGATGAAGG + Intergenic
925925677 2:8668372-8668394 ATGGATGGATGGATGGATGAAGG + Intergenic
925932154 2:8717007-8717029 GCAATTAAATGGATGGATAAAGG - Intergenic
925978373 2:9156734-9156756 GTGGAAGGATGGATGGATGATGG + Intergenic
926038259 2:9652216-9652238 GTGGATGGGTGGATGGATGATGG - Intergenic
926159433 2:10477308-10477330 TTGAAGAGATGAATGGATGAAGG - Intergenic
926159708 2:10478775-10478797 TCGAATAGATGGAGGAATAAAGG + Intergenic
926223254 2:10949970-10949992 ATGGATGGATGGATGGGTAAAGG + Intergenic
926267584 2:11339233-11339255 ATGTATTGATAGATGGATAAAGG + Intronic
926289133 2:11514955-11514977 ATGGATGGATGGATGGATAGTGG - Intergenic
926676365 2:15625541-15625563 ATGAGTTGATGGATGGATACAGG + Intronic
927103264 2:19804196-19804218 ATGCATAGATGGATGATTAAAGG + Intergenic
927197747 2:20559732-20559754 ATGGATGGATGGATGGATGATGG + Intergenic
927848894 2:26486446-26486468 GTGAGTGGATGGATGGATACAGG + Intronic
928177512 2:29044965-29044987 ATGGATGGATGGATGGATGATGG - Intronic
929720239 2:44361097-44361119 GATGAAAGATGGATGGATAAAGG - Intronic
929926695 2:46218197-46218219 ATGGATAAATGGATGAATAATGG - Intergenic
930003740 2:46879801-46879823 GTGAATGGATGGATGGTGAGTGG + Intergenic
930261513 2:49152515-49152537 GAGAAAAGATGGAGGGAAAAAGG - Intronic
930497169 2:52160466-52160488 ATCAACAGATGGATGGATAAAGG - Intergenic
931085178 2:58822332-58822354 GTCAACAGATGAATGGATAATGG - Intergenic
931169179 2:59784511-59784533 ATGAATGGATGGATGGTGAATGG + Intergenic
931169181 2:59784538-59784560 ATGAATAGATGGATGATGAATGG + Intergenic
931479501 2:62626491-62626513 ATCAATAGATGAATGGATAAAGG - Intergenic
931972339 2:67602639-67602661 ATGGATGGATGGATGGATGATGG + Intergenic
931998851 2:67865076-67865098 GTGGCTAGATGGATGGATAAAGG + Intergenic
932625864 2:73295339-73295361 CTGAATGGATGTTTGGATAATGG - Intergenic
933413741 2:81957722-81957744 CTGAATAGAAGGATGAAAAATGG - Intergenic
933689335 2:85167507-85167529 GTCGACAGATGGATGGCTAAAGG + Intronic
934920247 2:98337875-98337897 CTGGATGGATGGATGGATGATGG - Intronic
935023299 2:99252577-99252599 ATGGATAGTTGGATGGATGAAGG + Intronic
935264079 2:101380065-101380087 ATGAATAGATAGATGAATGATGG - Intronic
935384825 2:102488922-102488944 ATGAATGGATGGATGGATGGAGG - Intronic
935529050 2:104210524-104210546 ATAAATAAATGAATGGATAAAGG - Intergenic
935627384 2:105182610-105182632 ATCAACAGATGAATGGATAAAGG - Intergenic
935782322 2:106519059-106519081 ATGGATGGATGGATGGATGATGG - Intergenic
936243980 2:110810636-110810658 ATGGATGGATGGATGGATGATGG - Intronic
936244610 2:110815958-110815980 GTGAATGGACAGATGGATGATGG + Intronic
936412027 2:112268466-112268488 ATCAACTGATGGATGGATAAAGG + Intergenic
937065820 2:119016803-119016825 ATGAATAGATAGATGGATACAGG + Intergenic
937180523 2:119991819-119991841 GTCGACAGATGAATGGATAAAGG + Intergenic
937207231 2:120244613-120244635 ATGGATGGATGGATGGATGAGGG - Intronic
937970743 2:127546885-127546907 GTGGATAGATGGATGGTGGATGG - Intronic
938108034 2:128546613-128546635 ATGGATGCATGGATGGATAATGG - Intergenic
938108054 2:128546710-128546732 GTGGCTGGATGGATGGAGAATGG - Intergenic
938108073 2:128546804-128546826 ATGGATGGATGGATGGAGAATGG - Intergenic
938108082 2:128546855-128546877 ATGAATGAATGGGTGGATAATGG - Intergenic
938108099 2:128546922-128546944 GTGGGTGGATGGATGGATAGAGG - Intergenic
938108109 2:128546969-128546991 ATGGATGCATGGATGGATAATGG - Intergenic
938108134 2:128547078-128547100 GTGGCTGGATGGATGGAGAATGG - Intergenic
938108195 2:128547361-128547383 ATGGATGGATGGATAGATAATGG - Intergenic
938169566 2:129062963-129062985 ATGGATGGATGGATGGATGATGG - Intergenic
938182749 2:129198151-129198173 GTGCATACATGGCTTGATAATGG + Intergenic
938981009 2:136527218-136527240 GTAACTATATGGATGTATAAAGG - Intergenic
940139950 2:150483032-150483054 AGGAAGAGATGGATGGAGAAAGG + Intronic
940814758 2:158285897-158285919 TTGAATAGAAGCATTGATAAGGG - Intronic
941115694 2:161469744-161469766 CTGAATAGAAGGAGGGAAAATGG + Intronic
941170477 2:162129774-162129796 ATCAACAGATGAATGGATAAAGG - Intergenic
941298183 2:163767003-163767025 GTGAATAATTGGATAGAGAAAGG - Intergenic
941639123 2:167968682-167968704 CTGAATAGATTGATGCAGAAAGG + Intronic
941750662 2:169132087-169132109 ATGAATAGATGGATGATGAATGG + Intronic
941965158 2:171293352-171293374 GTGAGTAGATGAATGAATATGGG + Intergenic
942464798 2:176196462-176196484 GGGAAAAGATGGCTGGATACAGG - Intergenic
942507488 2:176658802-176658824 GAGAATAGATGGTAGGAGAAGGG + Intergenic
942991661 2:182209280-182209302 GAGATTTGATGGTTGGATAAGGG - Intronic
943057622 2:183001880-183001902 GAGGATGGATGGTTGGATAAAGG - Intronic
943082918 2:183278066-183278088 GTGAATGAATGGATGGATGGAGG - Intergenic
943430046 2:187788375-187788397 ATCAACAGATGGATGGATAAAGG + Intergenic
944670736 2:201992360-201992382 GTAAATAGATGAATGGATACTGG + Intergenic
945054125 2:205853201-205853223 GTGAATAGATGTGTGGTTAGGGG - Intergenic
945159532 2:206874981-206875003 ATGAATAGATGGATGAATGATGG - Intergenic
945770210 2:214033570-214033592 GTGAATGGATGGATGCATGAAGG - Intronic
945838753 2:214863592-214863614 GTCAACAGATTGAAGGATAAAGG + Intergenic
946273880 2:218616086-218616108 GTGGATACATGGGTGGATAGAGG + Intronic
946641761 2:221791316-221791338 ATCAACAGATGCATGGATAAAGG + Intergenic
946888912 2:224253538-224253560 TTGAATAGATGGACAGAGAAAGG + Intergenic
947233680 2:227918168-227918190 ATGGATGGATGGATGGATGATGG - Intronic
947679835 2:232020397-232020419 GTGGATGGATGGATGGATGTGGG + Intronic
947812846 2:233015167-233015189 GTGGATGGATGGATGGGTGAAGG - Intronic
948658290 2:239490448-239490470 GTGAATGGATGAATGGATAGAGG - Intergenic
948822165 2:240555551-240555573 GTGGACAGATGGATGGATGCAGG + Intronic
949065795 2:241989759-241989781 GTGGATGGATGGATGGATAATGG - Intergenic
949065823 2:241989876-241989898 GTGGATGGATGCATGGATGATGG - Intergenic
949065854 2:241990011-241990033 ATGGATGGATGGATGGATGATGG - Intergenic
949065934 2:241990339-241990361 GTGGATGGATGGATGGATGGTGG - Intergenic
949065948 2:241990392-241990414 GTGGATAGATGGATGGTGGATGG - Intergenic
1168973174 20:1944933-1944955 GAGGATAGATGGATGGAAGAAGG + Intergenic
1169012429 20:2261544-2261566 ATGAAATAATGGATGGATAAGGG - Intergenic
1170655045 20:18278714-18278736 ATGAACTGATGGATGGATAGAGG + Intergenic
1170729532 20:18961162-18961184 GTGAATAGGTGGATGCTGAAGGG + Intergenic
1172184935 20:33025636-33025658 GTAGATGGATGGATGGATGATGG - Intergenic
1172203981 20:33148922-33148944 ATGGATGGATGGATGGATGATGG + Intergenic
1172486129 20:35298764-35298786 GAGAAGAGATGGAGGGATACTGG - Intergenic
1172919510 20:38469413-38469435 ATGGATGGATGGATGGATGAGGG - Intergenic
1173168507 20:40703430-40703452 ATGAACCGATGGATGGATGATGG - Intergenic
1173465084 20:43274275-43274297 ACGGATGGATGGATGGATAAAGG + Intergenic
1173839056 20:46145216-46145238 ATCAACAGATGGATGTATAACGG - Intergenic
1173871501 20:46344909-46344931 ATGGATGGATGGATGGATGATGG - Intergenic
1173974756 20:47178821-47178843 GTGGGTGGATGGATGGATATTGG + Intronic
1173974794 20:47179203-47179225 ATGCATGGATGGATGGATATGGG + Intronic
1173974868 20:47179444-47179466 GTGGATGGATGGATGGATATTGG + Intronic
1174125625 20:48303018-48303040 ATGAATGGATGGATGAAGAATGG - Intergenic
1174175350 20:48641033-48641055 GTGGATAGATGGATAGACAGTGG + Intronic
1174279726 20:49430471-49430493 ATGAGTGGATGGATGGATGATGG - Intronic
1174619211 20:51861448-51861470 GTGGATGGATGGATAGATAGAGG - Intergenic
1174747037 20:53073293-53073315 ATGGATGGATGGATGGATGAAGG - Intronic
1174747068 20:53073433-53073455 ATGAATGGATGGATGGATGGAGG - Intronic
1175165266 20:57039088-57039110 ATGAATAAATGGATGGATAATGG + Intergenic
1175165282 20:57039176-57039198 TTGGATGGATGGATGGATGATGG + Intergenic
1175165322 20:57039411-57039433 ATGGATGGATGGATGGATGATGG + Intergenic
1175245051 20:57577172-57577194 GTGGATGGATGGATGAATAATGG + Intergenic
1175245060 20:57577215-57577237 GAGAATAGACAGATGGATAGTGG + Intergenic
1175301910 20:57948898-57948920 ATGGATGGATGGATGGATAGTGG + Intergenic
1175301912 20:57948917-57948939 GTGGATAGATGGATGAATAGTGG + Intergenic
1175301966 20:57949176-57949198 ATGGATGGATGGATGGATAGTGG + Intergenic
1175301973 20:57949230-57949252 ATTAATGGATGGATGGATAGTGG + Intergenic
1175301975 20:57949249-57949271 GTGGATAGATGGATGAATAGTGG + Intergenic
1175486664 20:59351852-59351874 ATGGATAGATGGATGATTAATGG - Intergenic
1175515895 20:59569560-59569582 GTGGATGGACGGATGGATGATGG + Intergenic
1175526576 20:59638647-59638669 GTGAATGGATTGACGGATGATGG + Intronic
1175526648 20:59638959-59638981 GTGAATGGATTGATGGATGACGG + Intronic
1175544177 20:59767475-59767497 GTGAATAAATAGATAGATGATGG - Intronic
1175574368 20:60049677-60049699 GTGGAGAGATGGAGGGACAATGG + Intergenic
1175676463 20:60950341-60950363 ATGAATAAATGTGTGGATAAGGG + Intergenic
1175745797 20:61456104-61456126 ATGGATAGATGGATGGAGAGTGG + Intronic
1175770498 20:61620398-61620420 ATGGATAGATAGATGGATGATGG + Intronic
1175770505 20:61620469-61620491 ATGGATAGATAGATGGATGATGG + Intronic
1175779243 20:61671858-61671880 ATGAATGGATGGATGGATGGTGG + Intronic
1175780288 20:61677853-61677875 GATAATAGATGGATAGATGATGG + Intronic
1175781069 20:61682388-61682410 ATGGATAGATGGATGGACAGAGG + Intronic
1175798467 20:61787080-61787102 GATGATGGATGGATGGATAATGG - Intronic
1175798470 20:61787095-61787117 ATGGATGGATGGATGGATGATGG - Intronic
1175817230 20:61889585-61889607 GTTAGTGGATGGATGGATGATGG + Intronic
1175817274 20:61889817-61889839 GTGGATGGATGGTTGGATGATGG + Intronic
1175817295 20:61889940-61889962 GTGAGTGGATGGTTGGATGATGG + Intronic
1175817338 20:61890161-61890183 GTGAATGGATGGTTGGATGATGG + Intronic
1175817369 20:61890345-61890367 ATGTATGGATAGATGGATAATGG + Intronic
1175817381 20:61890398-61890420 GTGGATGGATGGATGGATGATGG + Intronic
1175817396 20:61890471-61890493 GTGAGTGGATGGATGGATGATGG + Intronic
1175817421 20:61890599-61890621 ATGGATGGATGGATGGGTAAGGG + Intronic
1175817960 20:61893389-61893411 GTGAATAGAGGGATGGTGGATGG + Intronic
1175818038 20:61893710-61893732 GTGAATAGAGGGATGGTGGATGG + Intronic
1175818052 20:61893761-61893783 GTGAATAGAGGGATGGTGGATGG + Intronic
1176047135 20:63098574-63098596 ATGGACAGATGGATGGATGATGG + Intergenic
1176047147 20:63098679-63098701 ATGAATTGATGGATGGATGATGG + Intergenic
1176047158 20:63098773-63098795 GTGAATGCATGGATGGATCATGG + Intergenic
1176047174 20:63098894-63098916 GTGAATGCATGGATGGAACATGG + Intergenic
1176047190 20:63099015-63099037 GTGAATGCATGGATGGATCATGG + Intergenic
1176130059 20:63492977-63492999 GTGGATGGATGGATGGATGTGGG + Intronic
1176292162 21:5052226-5052248 ATGAATGGATGGAAGGATACAGG - Intergenic
1176455875 21:6909835-6909857 ATGGATAGTTAGATGGATAAGGG + Intergenic
1176834049 21:13774883-13774905 ATGGATAGTTAGATGGATAAGGG + Intergenic
1177425519 21:20917830-20917852 GATAATAGATGGATGGATGATGG - Intergenic
1177660680 21:24079042-24079064 CTCAATGGATGAATGGATAAAGG - Intergenic
1178280895 21:31281864-31281886 GTGGATAGATGGATGGTAGATGG + Intronic
1178666274 21:34549801-34549823 ATGGATGGATGGATGGATGATGG - Intronic
1178679096 21:34657116-34657138 GTGGATGGATGGGTGGATAATGG + Intergenic
1178907847 21:36651116-36651138 ATGAATGGATGGATGGACATAGG - Intergenic
1179017465 21:37605653-37605675 ATGGATGGATGGATGGATGAAGG - Intergenic
1179160859 21:38897212-38897234 GTGAATATATTCATGGATACTGG - Intergenic
1179474765 21:41636110-41636132 GTGGATGAATGGATGGATGATGG - Intergenic
1179549132 21:42132240-42132262 GTGGATAGATGGATGACCAATGG - Intronic
1179549143 21:42132333-42132355 GTGGATGGATGGATGAACAATGG - Intronic
1179549152 21:42132383-42132405 ATGAGTGGATGGATGGATGATGG - Intronic
1179549176 21:42132561-42132583 ATGAACAGATGGATGGATGATGG - Intronic
1179592410 21:42417816-42417838 GTACCTAGATGGATGGATGATGG + Intronic
1179865095 21:44211424-44211446 ATGAATGGATGGAAGGATACAGG + Intergenic
1179899449 21:44381415-44381437 GTAGATAGATGGATGGATGATGG + Intronic
1179899477 21:44381518-44381540 GTGGATGGATGGATGGATGGAGG + Intronic
1180024957 21:45155819-45155841 GTGGATGGATGGATGGATGATGG - Intronic
1180025082 21:45156292-45156314 GTGGATGGATGGATGGATGATGG - Intronic
1180025094 21:45156336-45156358 GTGGATGGATAGATGGATGATGG - Intronic
1180025105 21:45156380-45156402 ATGGATGGATGGATGGATGATGG - Intronic
1180025128 21:45156476-45156498 GTGGATGGATGAATGGATGATGG - Intronic
1180182394 21:46123816-46123838 ATGAATGGATGGGTGCATAAAGG + Intronic
1181958979 22:26609466-26609488 ATGAATGGATGCATGGATAAAGG + Intronic
1181993487 22:26856568-26856590 ATGGATGGATGGATGGATATAGG - Intergenic
1182031620 22:27163453-27163475 AAGAAAAGCTGGATGGATAATGG + Intergenic
1182047390 22:27285991-27286013 ATGAATGGATGAATGGATGATGG + Intergenic
1182048503 22:27295734-27295756 ATGGATGGATGGATGGATAATGG + Intergenic
1182052766 22:27325622-27325644 GTGGATGGATGGATGGAAGATGG + Intergenic
1182072018 22:27470361-27470383 GTGGATGGATGGATGGATGATGG + Intergenic
1182086638 22:27565500-27565522 ATGGATAGATGGATGGATGATGG + Intergenic
1182099733 22:27649414-27649436 ATGGATGGATGGATGGATGATGG + Intergenic
1182862079 22:33568868-33568890 ATGGATGGATGGATGGATGATGG + Intronic
1183082125 22:35463338-35463360 GTGGGTAGATGGATGGATGGTGG - Intergenic
1183082165 22:35463486-35463508 ATGGATGGATGGATGGATAGTGG - Intergenic
1183262319 22:36803617-36803639 ATGGATAGAGGGATGGATAAAGG + Intronic
1183266752 22:36831993-36832015 GTGCATGGATGGATGGATGACGG + Intergenic
1183270000 22:36855953-36855975 GTGAATAAATGAATGAATGAGGG + Intergenic
1183303919 22:37071914-37071936 GTAGATGGATGGATGGATGATGG + Intronic
1183303932 22:37071974-37071996 ATGGATGGATGGATGGATGATGG + Intronic
1183303975 22:37072197-37072219 ATGAATGGATGGATGGATGATGG + Intronic
1183303979 22:37072216-37072238 ATGGATGGATGGATGGATGATGG + Intronic
1183303990 22:37072273-37072295 TTGCATGGATGGATGGATGATGG + Intronic
1183304003 22:37072341-37072363 ATGGATGGATGGATGGATGATGG + Intronic
1183304009 22:37072368-37072390 GTGCATGGATGGATGGATGATGG + Intronic
1183304027 22:37072467-37072489 ATGGATGGATGGATGGATGATGG + Intronic
1183304042 22:37072561-37072583 ATGGATGGATGGATGGATGATGG + Intronic
1183304049 22:37072595-37072617 ATGGATGGATGGATGGATGATGG + Intronic
1183304090 22:37072798-37072820 ATGGATGGATGGATGGATGATGG + Intronic
1183304098 22:37072840-37072862 ATGGATGGATGGATGGATGATGG + Intronic
1183304128 22:37073010-37073032 ATGGATGGATGGATGGATGATGG + Intronic
1183321888 22:37169940-37169962 GTGGATAGAAGGGTGGTTAATGG + Intronic
1183321929 22:37170114-37170136 ATGGATGGATGGATGGATGAAGG + Intronic
1183543801 22:38444831-38444853 ATGAATGGATGGATGGATGGGGG - Intronic
1183600024 22:38834597-38834619 ATGGATGGATGGATGGATGATGG - Intronic
1183744076 22:39683533-39683555 GTAAATAAATGGTTGGCTAAAGG - Intronic
1183983346 22:41555465-41555487 GTGAATGGATGGATGGCTGAGGG + Intergenic
1184262019 22:43323322-43323344 GTGAGTAGATGGATGGATAGTGG - Intronic
1184285714 22:43470185-43470207 ATGGATAGATGGATGGTTTATGG - Intronic
1184293186 22:43508968-43508990 ATGGATAGATGGATGGATGGGGG - Intergenic
1184321309 22:43744139-43744161 GTAGATGGATGGATGGATGATGG + Intronic
1184434281 22:44460604-44460626 GTGGGTAGATGGATGGATGAGGG - Intergenic
1184444555 22:44539712-44539734 GTGGATGGATGGATGGATGATGG + Intergenic
1184460756 22:44636631-44636653 ATGGATAGATGGATGGATATAGG + Intergenic
1184460763 22:44636661-44636683 ATGGATGGATGGATGGATATAGG + Intergenic
1184460774 22:44636701-44636723 GTGGGTGGATGGATGGATGATGG + Intergenic
1184460828 22:44636923-44636945 GTGGATGGATAGATGGATGATGG + Intergenic
1184460850 22:44637030-44637052 GTGAATGGATAGATGGATGATGG + Intergenic
1184460873 22:44637129-44637151 GTGAATGGATAGATGGATGATGG + Intergenic
1184653345 22:45929349-45929371 GTGAATAGATGGATGGATAAAGG - Intronic
1184731145 22:46371829-46371851 ATGAATAGGTGGATGGATGGAGG - Intronic
1184731222 22:46372173-46372195 GTGAGTAGATGGATGGGTGAGGG - Intronic
1184731229 22:46372201-46372223 GTGAGTAGATGGATGGTTGGAGG - Intronic
1184731288 22:46372436-46372458 GTGAGTGGATGGATGGATGGGGG - Intronic
1184731304 22:46372486-46372508 GTGAGTGGATGGATGGATGGGGG - Intronic
1184744654 22:46449279-46449301 GTGGATAGATGGATGAATGGTGG - Intronic
1184744698 22:46449482-46449504 GTGGATAGATGGATGAATGATGG - Intronic
1184780000 22:46643224-46643246 ATGGATAGATGGATGGATCCAGG - Intronic
1184930765 22:47679633-47679655 ATGGATGGATGGATGGATGATGG - Intergenic
1184930769 22:47679652-47679674 ATGGATGGATGGATGGATGATGG - Intergenic
1184996753 22:48212786-48212808 ATGAATGGATGAATGGATGATGG - Intergenic
1184996757 22:48212821-48212843 ATGAATGGATGGGTGGATGATGG - Intergenic
1184996768 22:48212928-48212950 ATGAATGGATGGGTGGATGATGG - Intergenic
1184996775 22:48212978-48213000 ATGGATGGATGGATGGATGATGG - Intergenic
1185005498 22:48274179-48274201 ATGAATGGATGGATGGATGAAGG - Intergenic
1185027171 22:48421564-48421586 GTGGATAGATGGATGGGTGAAGG + Intergenic
1185053514 22:48566062-48566084 ATGGATGGATGGATGGATGATGG + Intronic
1185103657 22:48855167-48855189 GTGAATGCATGGATGGATGATGG - Intergenic
1185104360 22:48858915-48858937 ATGAATGGATGAATGGATGATGG - Intergenic
1185104449 22:48859291-48859313 ATGAATGGATGGATGGATGATGG - Intergenic
1185108458 22:48887386-48887408 GGGGATGGATGGATGAATAATGG - Intergenic
1185196809 22:49476843-49476865 GTGGATGGATGGATGGATGGTGG + Intronic
1185196815 22:49476870-49476892 ATGGATGGATGGATGGATGATGG + Intronic
1185196825 22:49476908-49476930 GTGGATGGATGGATGGATGGTGG + Intronic
1185196851 22:49477040-49477062 ATGAATAGATGGATGGTAAATGG + Intronic
1185196874 22:49477140-49477162 GTGGATGGATGGATGGTGAATGG + Intronic
1185196931 22:49477381-49477403 GTGGATGGATGGATGGATGGTGG + Intronic
1185196956 22:49477475-49477497 GTGGATGGATGGATGGATGGTGG + Intronic
1185196987 22:49477589-49477611 GTGGATGGATGGATGGATGGTGG + Intronic
1185196996 22:49477630-49477652 ATGGATGGATGGATGGATGATGG + Intronic
1185197005 22:49477664-49477686 GTGGATGGATGGATGGATGGTGG + Intronic
1185197052 22:49477832-49477854 GTGGATGGATGGATGGATGGTGG + Intronic
949845357 3:8364686-8364708 ATGAATGAATGGATGGATGAAGG - Intergenic
950009600 3:9713414-9713436 GTGAATTGATGGGTGGGTAGAGG + Intronic
950443782 3:13024561-13024583 GTGGATGGATGGATGAATTAAGG - Intronic
950474230 3:13205631-13205653 GTGAAGAGATGGATGGATGGAGG - Intergenic
950526920 3:13529589-13529611 TTGAATAAATAAATGGATAAAGG - Intergenic
950541286 3:13614801-13614823 ATAAATGGATGGATGGATGAGGG - Intronic
950573508 3:13816770-13816792 ATGGGTAGATGGATGGATGAAGG - Exonic
950657651 3:14446987-14447009 ATGGATAGATGGATGGAAAATGG - Intronic
951108884 3:18777648-18777670 TAGAATAGATAGATAGATAATGG - Intergenic
951707701 3:25559806-25559828 GTGGATCAATGGATGGAAAATGG + Intronic
951798695 3:26571146-26571168 ATGAATGGATGAATGGATAAAGG - Intergenic
952109496 3:30106289-30106311 ATCAATAGATGAATGGATAAAGG - Intergenic
952307686 3:32160367-32160389 ATGGATGGATGGATGGATTATGG + Intronic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953715380 3:45312938-45312960 ATGAATATATGAATGGATAATGG + Intergenic
954240074 3:49286770-49286792 ATGGATAGATGGATGGATGATGG - Intronic
954623659 3:52010319-52010341 ATGGATGGATGGATGGATAGAGG - Intergenic
954750188 3:52809221-52809243 GTGAATGGATGGATGGGTGGAGG - Intergenic
954900037 3:54011225-54011247 ATGAATACATGAATGAATAAAGG - Intergenic
954954869 3:54510234-54510256 ATGAATGGATGAATGGATGAAGG + Intronic
955026154 3:55169609-55169631 GTGAGTGAATGGATGGATGAAGG - Intergenic
955369131 3:58335903-58335925 GTGAAGAGATGGAGGGAGGAAGG - Intronic
956575046 3:70743390-70743412 GTGAAAAGATGGATGATTAAAGG - Intergenic
956916329 3:73875602-73875624 GTCAATAGAATGATGGAAAAAGG - Intergenic
958811505 3:98865220-98865242 ATCAGTAGATGAATGGATAAAGG + Intronic
959386662 3:105717353-105717375 GTTATTGAATGGATGGATAATGG - Intronic
959790721 3:110357970-110357992 GTAAATAAATGGATATATAAGGG + Intergenic
959797636 3:110450895-110450917 GTCAACAGATCAATGGATAAAGG - Intergenic
960367728 3:116794155-116794177 ATGGATGGATGGATGGATGAAGG + Intronic
962203399 3:133417181-133417203 GTGACTAGAGGGGTGGATAGAGG - Intronic
963313193 3:143730760-143730782 ATAAATGGATGGATTGATAATGG + Intronic
963500253 3:146116595-146116617 ATCAACAGATGAATGGATAAAGG + Intronic
963608420 3:147434635-147434657 GTGAATTTATGGAGAGATAAAGG - Intronic
963704353 3:148666985-148667007 ATGGATAGTTGGATGGATGAAGG + Intergenic
964136754 3:153352962-153352984 GAGAATAAAAGGTTGGATAAGGG + Intergenic
964653591 3:159041357-159041379 GTGAAAAGATGTAGGGATGAGGG + Intronic
964697256 3:159523680-159523702 GTGAATGGATGGGTGGATGACGG - Intronic
964804316 3:160590235-160590257 GAAAATAAATGGATGGAAAAAGG + Intergenic
965026599 3:163310161-163310183 ATGAACAGATGAATGTATAAAGG + Intergenic
965129699 3:164681264-164681286 ATGAATGTATGGATGAATAAAGG + Intergenic
965215786 3:165862917-165862939 GTGGATGGATGGATAGATATGGG - Intergenic
965356563 3:167681487-167681509 ATGAATGAATGGATGGATCAGGG + Intergenic
965409164 3:168307767-168307789 ATGGATAGATGGATGGGTAGGGG + Intergenic
965428503 3:168557703-168557725 ATCAATGGATTGATGGATAAAGG + Intergenic
965468137 3:169057997-169058019 GTGGATAGATAGAGAGATAATGG + Intergenic
965624281 3:170671576-170671598 GTGAATAAATGAATGGACTAAGG + Intronic
965732037 3:171782523-171782545 TTGAATTGATGAAAGGATAAAGG + Intronic
966014852 3:175129703-175129725 GTCAACGGATGAATGGATAAAGG - Intronic
966556121 3:181262040-181262062 ATCAACAGATGAATGGATAAAGG - Intergenic
967038259 3:185664496-185664518 GTGAATTAATGGAGGGAGAAGGG + Intronic
967222796 3:187262354-187262376 ATGAATTGCTGGATGGATAGAGG + Intronic
967275007 3:187765856-187765878 ATGTACAGATGGATGGATACAGG - Intergenic
968594520 4:1475443-1475465 GTGGATAGATGGGTGGGGAATGG + Intergenic
968594574 4:1475729-1475751 ATGAATGGATGGAAGGATGATGG + Intergenic
968594604 4:1475937-1475959 ATGAATAGATGGGTGGATGATGG + Intergenic
968598371 4:1496920-1496942 ATGGATGGATGGATGGATAATGG + Intergenic
968598414 4:1497207-1497229 ATAGATGGATGGATGGATAATGG + Intergenic
968598424 4:1497280-1497302 ATGGATGGATGGATGGATAATGG + Intergenic
968598444 4:1497412-1497434 ATGGACGGATGGATGGATAATGG + Intergenic
968924797 4:3541562-3541584 GGGAATAGATGGATGCTGAATGG + Intergenic
968931034 4:3578936-3578958 ATGGATAGATGGGTGGATAGAGG - Intronic
968935834 4:3609949-3609971 GTGAATGGGTGGGTGTATAATGG - Intergenic
968935884 4:3610161-3610183 GATAATAGATGGATGGATGATGG - Intergenic
968946136 4:3665478-3665500 ATGAATGGATGAATGGATAGAGG - Intergenic
969324673 4:6434903-6434925 TTCAATAGAAGAATGGATAAAGG - Intronic
969424831 4:7118103-7118125 GTGGATAGATGCATGGATGATGG + Intergenic
969424921 4:7118550-7118572 ATGAGTGGATGGATGGATGATGG + Intergenic
969424929 4:7118593-7118615 GTGGATGGATGGATGGATGATGG + Intergenic
969424950 4:7118679-7118701 GTGGATGGATGGATGGATGGAGG + Intergenic
969424962 4:7118741-7118763 ATGAGTGGATGGATGGATGATGG + Intergenic
969501608 4:7556808-7556830 ATGGGTAGATGGATGGATGATGG - Intronic
969510293 4:7613866-7613888 GTGAATGAATGGATGGTGAATGG - Intronic
969510486 4:7614781-7614803 GTGGATGGATGAATGGATTATGG - Intronic
969514890 4:7641743-7641765 ATGAATAGATGTATAGATGATGG + Intronic
969523049 4:7689924-7689946 GTGAATGGATGGATGGAGGATGG + Intronic
969523128 4:7690396-7690418 CTGAATTGATGGATGGATGATGG + Intronic
969528492 4:7716520-7716542 ATGAATAGATGGATGGTGGATGG - Intronic
969612265 4:8234017-8234039 ATGAATGGATGGATGGATGATGG - Intronic
969612280 4:8234121-8234143 ATGGATAAATGGATGGATGATGG - Intronic
969674088 4:8605451-8605473 ATGAATGGATGGACGGATGATGG - Intronic
969674105 4:8605591-8605613 ATGGATGGATGGATGAATAATGG - Intronic
970469683 4:16364693-16364715 CTGATTGGATGGATGGATGAAGG + Intergenic
970805169 4:20022679-20022701 GTGAAACCATGGGTGGATAAAGG - Intergenic
971127399 4:23769385-23769407 ATGGATGGATGGATGGATGATGG - Intronic
971316150 4:25569852-25569874 TTGAATGGATGGATTGATAGAGG + Intergenic
971425011 4:26507485-26507507 GTGAATGGATGGATGGAAGAAGG + Intergenic
971892295 4:32540580-32540602 GAGTATATATGGATGGATCATGG - Intergenic
971936597 4:33157317-33157339 ATCAATAGATGAATGGATAAAGG + Intergenic
972368135 4:38394960-38394982 ATGGATAGATGGATGGATGGAGG + Intergenic
972667973 4:41185120-41185142 GGAAATATATGGATGGATGAAGG + Intronic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
975190343 4:71453115-71453137 GTGAATGGATGAATGAATGAGGG + Intronic
975375569 4:73640265-73640287 ATCAACAGATGCATGGATAAGGG - Intergenic
975401339 4:73943294-73943316 GTGAATAATTAGATGGATCAGGG - Intergenic
975675958 4:76828088-76828110 GTGAAACCATGGATGGATAAGGG - Intergenic
976075547 4:81295227-81295249 ATGGATGGATGGATGGATGATGG + Intergenic
976397038 4:84567178-84567200 ATCAATGGATGAATGGATAAAGG + Intergenic
976418235 4:84804542-84804564 GTGAAAACATGAATGGGTAAAGG - Intronic
976470533 4:85423605-85423627 TTGAATTGATAGATGAATAATGG - Intergenic
976902627 4:90197538-90197560 ATCAACAGATGAATGGATAAAGG + Intronic
977000328 4:91490349-91490371 ATCAACAGATGGATGAATAAAGG + Intronic
977064611 4:92298329-92298351 ATGAATAGATGAATGAATTAAGG - Intronic
977179117 4:93852196-93852218 GTTAATAGATGGCTGGGGAATGG - Intergenic
977426721 4:96875916-96875938 ATGAATAGATGAATGAACAAAGG + Intergenic
977470167 4:97433389-97433411 ATTAACAGATGAATGGATAAAGG + Intronic
977757435 4:100689547-100689569 GAGAATAGATGTGTTGATAAGGG - Intronic
978240872 4:106514856-106514878 ATGGATAGATAGATGGATGATGG + Intergenic
978660105 4:111115865-111115887 GTGAAGATGTGAATGGATAAAGG + Intergenic
979323797 4:119355159-119355181 GTGAATAAATGCATGGAAAATGG - Intergenic
979342361 4:119541090-119541112 GGGAATGGATGGAGTGATAATGG + Intronic
979698842 4:123644089-123644111 GTGAATGAATGGATGGGTGATGG - Intergenic
979746115 4:124215222-124215244 GTAAATAGATGCATGTATTAGGG - Intergenic
980245695 4:130238093-130238115 TTGAATGAATGCATGGATAAAGG + Intergenic
981873288 4:149511919-149511941 TTGAATAAATGAATGAATAAAGG - Intergenic
982449672 4:155539068-155539090 ATCAACAGATGGTTGGATAAAGG - Intergenic
983004110 4:162461322-162461344 GTGAGTAGAAAGATGGAAAAGGG + Intergenic
983325330 4:166248038-166248060 ATGAAGAGATGGATGTAGAATGG + Intergenic
983622127 4:169772920-169772942 CTGAATGAATGGATGGATGAAGG - Intergenic
983770244 4:171540016-171540038 ATCAATAGATAGATGGATGATGG - Intergenic
984756892 4:183332936-183332958 GTGGATGGATGGATGGATGATGG - Intergenic
984864595 4:184270930-184270952 ATGGATAGATGGATGGATAGAGG - Intergenic
984913991 4:184703770-184703792 ATTGATAGATGAATGGATAAAGG + Intronic
985547612 5:517901-517923 ATGGATGGATGGATGGATGATGG - Intronic
985709173 5:1418704-1418726 ATGGATGGATGGATGGATGATGG - Intronic
985709183 5:1418739-1418761 ATGGATGGATGGATGGATGATGG - Intronic
985709207 5:1418855-1418877 ATGGATGGATGGATGGATAATGG - Intronic
986010692 5:3712257-3712279 GAAAATAGATGCATGGATGATGG - Intergenic
987033769 5:13999573-13999595 ATCAACAGATGAATGGATAAAGG - Intergenic
987483389 5:18490348-18490370 CTGAGTGGATGGATGCATAAAGG - Intergenic
988972663 5:36485103-36485125 TTGAATAGATGAATGAATGATGG - Intergenic
989050581 5:37316167-37316189 ATCAACAGATGAATGGATAAAGG + Intronic
989142286 5:38213614-38213636 GAGAATACATGGATACATAAAGG + Intergenic
989331238 5:40261403-40261425 GTGACAAAATGGATGAATAATGG + Intergenic
989500639 5:42162939-42162961 ATCAACAGATGAATGGATAAAGG - Intergenic
989985558 5:50692874-50692896 GTGAAGAGATGAATGAATACAGG - Intronic
992285126 5:75227041-75227063 ATCAACAGATGAATGGATAAAGG + Intronic
992331974 5:75726462-75726484 ATCAACAGATGAATGGATAAGGG - Intergenic
992462086 5:76970534-76970556 ATGGATGGATGGATGGATGACGG + Intronic
993527273 5:88981062-88981084 ATGTATAGATGGATGGATAGAGG - Intergenic
995606635 5:113863706-113863728 ATGGACAGATGGATGAATAAAGG - Intergenic
995742074 5:115365797-115365819 ATGGATGGATGGATGGATAGAGG - Intergenic
995800522 5:115989001-115989023 GTGAGTGGATGGATGGATGTAGG - Intronic
995862438 5:116655583-116655605 GTGTAGAGATGGATTCATAAAGG + Intergenic
996393286 5:122986861-122986883 GTGGATGGATGGATGGATGGAGG + Intronic
996587812 5:125110544-125110566 GTGAAAAGATGTCAGGATAATGG + Intergenic
997083570 5:130769733-130769755 ATCAATAGATGAATGAATAAAGG + Intergenic
997339082 5:133128501-133128523 GTGAAAAGATGAATGAATGAAGG + Intergenic
998010424 5:138690803-138690825 ATTAACAGATGAATGGATAAAGG - Intronic
998546121 5:143029347-143029369 ATGGATGGATGGATGGATACAGG - Intronic
999085651 5:148886744-148886766 GTGATAAAATGGATGGATTAGGG + Intergenic
999316451 5:150587192-150587214 ATGGATGGATGGATGGATATAGG + Intergenic
999325150 5:150639236-150639258 GGGCAGAGATGGATGGGTAAGGG - Intronic
999402771 5:151279480-151279502 TAGAATTGATGGATGAATAATGG + Intronic
999445012 5:151632319-151632341 ATGGATGCATGGATGGATAATGG + Intergenic
999524166 5:152384212-152384234 ATGGATAGATAGATGGATGATGG - Intergenic
999580340 5:153031439-153031461 GTGAATAAAGGGATGGAGATAGG - Intergenic
999658664 5:153835446-153835468 CTGAGTTGTTGGATGGATAATGG - Intergenic
1000319547 5:160123240-160123262 GTGATTGGATGGATGGTTGATGG + Intergenic
1000645113 5:163751931-163751953 GTCAGTGGATGAATGGATAAAGG - Intergenic
1000948381 5:167450047-167450069 ATGGATGGATGGATGGATGATGG + Intronic
1001254220 5:170171347-170171369 ATGGATAGATGGATGGAGAGTGG + Intergenic
1001272567 5:170326116-170326138 ATGAATTGATGGATGGGTAAAGG + Intergenic
1001435457 5:171695939-171695961 ATGGATGGATGGATGGATGATGG + Intergenic
1001517047 5:172363201-172363223 ATGTTTGGATGGATGGATAATGG - Intronic
1001646297 5:173284563-173284585 GTGGATGGTTGGATGGATGAAGG - Intergenic
1001646376 5:173284928-173284950 GTGGATGGTTGGATGGATGAAGG - Intergenic
1001701717 5:173711632-173711654 GTGGACAGATGGATGGAAGATGG + Intergenic
1001701737 5:173711741-173711763 ATGGATGGATGGATGGATGATGG + Intergenic
1001751435 5:174134546-174134568 ATGGATGGATGGATGGATGATGG - Intronic
1001751459 5:174134668-174134690 ATGGATGGATGGATGGATAATGG - Intronic
1001751483 5:174134820-174134842 ATGGATGGATGGATGGATGATGG - Intronic
1001865677 5:175103022-175103044 ATGAATGGATAGATGGATGATGG + Intergenic
1002259076 5:177981880-177981902 ATGAATGGATGGATGGATGGTGG + Intergenic
1002298643 5:178245531-178245553 GTGAATGGATGGATGGGTGATGG - Intronic
1002303300 5:178269547-178269569 ATGGATGGATGGATGGATGATGG - Intronic
1002341600 5:178519862-178519884 GTGAATAGATGGTCAGATGATGG + Intronic
1002439099 5:179255001-179255023 ATGGATGGATGGATGGATGATGG + Intronic
1002511329 5:179720406-179720428 ATGAAGACATGGATGGAGAATGG + Exonic
1002766994 6:249855-249877 ATCAATAGATGAATGGATAAAGG - Intergenic
1003520586 6:6855434-6855456 TTGAATGAATGGATGGAAAATGG - Intergenic
1003972550 6:11313138-11313160 ATGAATAGATGGATGGTTGGTGG + Intronic
1004088855 6:12478949-12478971 ATGAATATATAGATGGATGAAGG + Intergenic
1004344514 6:14836389-14836411 ATGGATTGATGGATGGATCAAGG - Intergenic
1004792312 6:19040385-19040407 GTGAAGAGAAGAATGGAGAAGGG + Intergenic
1005658772 6:27971610-27971632 ATCAATGGATGAATGGATAAAGG + Intergenic
1006299889 6:33188104-33188126 TTGAAAGGATGGATGGATGAGGG + Intronic
1006706141 6:36023158-36023180 ATGGATGGATGGATGGATAAGGG - Intronic
1006737427 6:36284508-36284530 TTGGATGGATGGATGGATAAAGG - Intronic
1007259617 6:40554411-40554433 GTGGATGGGTGGATGGATGATGG + Intronic
1008097471 6:47353785-47353807 GTGAATAAAGGTATGGATGATGG - Intergenic
1008483859 6:52014482-52014504 CTGGATAGATGGATGGATCATGG + Intronic
1008483883 6:52014618-52014640 CTGGATAAATGGATGGATCATGG + Intronic
1008483911 6:52014771-52014793 CTGGATAGATGGATGGATCATGG + Intronic
1009387580 6:63104554-63104576 ATCAATAGATGAAAGGATAAAGG - Intergenic
1009472833 6:64049306-64049328 GTGAAGAGATGGATGAATAGAGG - Intronic
1009552437 6:65116414-65116436 GTGGCTAGAAGGATGGAAAAAGG + Intronic
1010230832 6:73533641-73533663 ATGAATAATTGAATGGATAAAGG + Intergenic
1010448840 6:75979343-75979365 GTGTAGAGGTGGATGGAAAAGGG + Intronic
1010510128 6:76708171-76708193 ATGAATAGATAGATGAATGAAGG - Intergenic
1012456594 6:99413442-99413464 ATGGATGGATGGATGGATCATGG - Intronic
1012666342 6:101975848-101975870 TTGAATGGATGGATGGATGGAGG - Intronic
1014398325 6:120954245-120954267 GAGATTAAATGGGTGGATAAAGG - Intergenic
1014874163 6:126635490-126635512 GTGAAAACAAGGATGGATATGGG - Intergenic
1015141544 6:129939856-129939878 ATGAATGAATGGATGGATGATGG - Intergenic
1015447017 6:133317929-133317951 GAGGATGGATGGATGGATGAGGG - Intronic
1016121671 6:140350315-140350337 GTGAATAAATGCATGAATGAAGG - Intergenic
1016195224 6:141328114-141328136 ATTAATAGATAAATGGATAAAGG + Intergenic
1016317747 6:142808682-142808704 ATGAATAGAAGGATGGATGGAGG + Intronic
1016739883 6:147515545-147515567 ATGGAGAGATGGATGGGTAAAGG - Intronic
1017237807 6:152135601-152135623 GTGAATAAATGAATGAATGAAGG - Intronic
1017591061 6:155978431-155978453 CTGAGTAGATGGATGGATGTTGG + Intergenic
1017659036 6:156656056-156656078 ATGAATGAATGGATGGATGAGGG - Intergenic
1018239710 6:161761319-161761341 GTGGATGGATGGATGGATGATGG + Intronic
1018340641 6:162847525-162847547 GTGTATTGTTGAATGGATAAGGG + Intronic
1018561239 6:165102759-165102781 GTGTGTAGATGGATGGAACATGG - Intergenic
1018853066 6:167655061-167655083 ATGGATGGATGGATGGATGATGG + Intergenic
1019326834 7:442639-442661 ATGAATGGATGGATGGATGGAGG + Intergenic
1019326875 7:442831-442853 GTGGATGGATGGATGGATTGTGG + Intergenic
1019326889 7:442901-442923 ATGAATAGATGGATGGATGGTGG + Intergenic
1019326903 7:442969-442991 ATGAATAGATGGATGGATGGTGG + Intergenic
1019326922 7:443064-443086 ATGAATAGATGGATGGATGGTGG + Intergenic
1019326973 7:443292-443314 ATGGATAGATGGATGGATGGTGG + Intergenic
1019327022 7:443516-443538 GTGGATGGATGGATGGATGGTGG + Intergenic
1019327040 7:443600-443622 GTGTATGGAGGGATGGAGAATGG + Intergenic
1019327066 7:443727-443749 GTGAATAGATGGATGGTGGATGG + Intergenic
1019345542 7:528314-528336 ATGAATGGATGGATGGATTATGG + Intergenic
1019345554 7:528402-528424 ATGGATGGATGGATAGATAATGG + Intergenic
1019345578 7:528591-528613 GATGATGGATGGATGGATAATGG + Intergenic
1019345591 7:528686-528708 ATGAATGGATGGATAGACAATGG + Intergenic
1019369893 7:656509-656531 ATGACTAAATGTATGGATAAGGG + Intronic
1019479979 7:1261893-1261915 ATGGATAGATAGATGGATGATGG - Intergenic
1019503692 7:1379584-1379606 ATGGATGGATGGATGGATGATGG + Intergenic
1019555878 7:1631070-1631092 GTGGGTAGATGGGTGGATGATGG - Intergenic
1019567197 7:1690201-1690223 GTGAATGGATGGATAGTTGATGG + Intronic
1019567286 7:1690608-1690630 ATGGATAAATGGATGGATGAAGG + Intronic
1019704598 7:2491469-2491491 ATGGATGGATGGATGGATGATGG - Intergenic
1019776027 7:2912715-2912737 ATGGATGGATGGATGGATAAGGG - Intronic
1019914661 7:4125042-4125064 ATGGATGGATGGATGGGTAATGG + Intronic
1019914668 7:4125069-4125091 ATGGATGGATGGATGGATGATGG + Intronic
1019914705 7:4125246-4125268 ATGAATGGATGGATGGGTGATGG + Intronic
1019914734 7:4125396-4125418 ATGGATAGATGGATGGATGATGG + Intronic
1020365839 7:7379665-7379687 ATGAATAAATGAATGGAGAAAGG + Intronic
1021414176 7:20362866-20362888 GTTAGTGGATGGAGGGATAAAGG + Intronic
1021532385 7:21662381-21662403 ATGAATTGATGGATGGTTATAGG - Intronic
1022331059 7:29379509-29379531 TTGGATTGATGGATGGATAGAGG + Intronic
1022477237 7:30719598-30719620 ATGGATGGATGGATGGATGATGG - Intronic
1022908979 7:34882095-34882117 ATGAATGGATGGATGGATGATGG + Intergenic
1023314403 7:38920478-38920500 GTGAAAAGAAGGATGGGGAAAGG + Intronic
1023537282 7:41226607-41226629 GTGAAAAGGTGGATGGATTAGGG + Intergenic
1024960976 7:54975963-54975985 ATGAATAGATGGAAGACTAATGG + Intergenic
1025120103 7:56294618-56294640 ATGAATGGATGGATGGTTGATGG + Intergenic
1025120126 7:56294746-56294768 GTGGATGGATGGATGGTGAATGG + Intergenic
1025847456 7:65213331-65213353 GTGGACAGATGGATGAATGAAGG - Intergenic
1025897702 7:65719221-65719243 GTGGACAGATGGATGAATGAAGG - Intergenic
1026203561 7:68235896-68235918 ATGAATGAATGGATGGATGAAGG + Intergenic
1026260535 7:68751408-68751430 TTCAATGGATGAATGGATAAAGG - Intergenic
1026275176 7:68870158-68870180 GTGAGTAGATAGATGGGTAGAGG + Intergenic
1026275203 7:68870310-68870332 ATGGAAAGATGGATGGATGATGG + Intergenic
1026275208 7:68870337-68870359 CTGGATGGATGGATGGATGATGG + Intergenic
1026275413 7:68871851-68871873 GTGAGTAGATAGATGGATGGAGG - Intergenic
1026319638 7:69257610-69257632 ATGGATGGATGGATGGATGACGG + Intergenic
1026326795 7:69317569-69317591 GGAAATAAAGGGATGGATAAAGG + Intergenic
1026531329 7:71199802-71199824 TTGGATGGATGGATGGATGATGG - Intronic
1026828605 7:73598365-73598387 GTGGATGGATGGAAGGATTATGG - Intronic
1026903429 7:74049419-74049441 ATAAATGGATGGATGGATGAGGG - Intronic
1026903440 7:74049474-74049496 GGGAATAGATGGATAGATGGTGG - Intronic
1027163760 7:75820665-75820687 GTGGATGGATGGATGGATGATGG - Intronic
1027163784 7:75820756-75820778 GTGAATGGATGGATGGGTGGAGG - Intronic
1027628186 7:80570167-80570189 ATCAATAGATGAATGGATAAAGG - Intronic
1027925072 7:84449964-84449986 GTGGATGGATGAATGGATAAAGG - Intronic
1029045767 7:97626503-97626525 ATGAATGGATGGATGGATGGAGG + Intergenic
1029599728 7:101556647-101556669 ATGGATGGATGGATGGATGATGG + Intronic
1029604861 7:101592455-101592477 ATGGATGGATGGATGGATGATGG - Intergenic
1029643338 7:101835179-101835201 GAGAATAGATGAATGGTTACGGG - Intronic
1030075635 7:105733929-105733951 ATGGATGGATGGATGGATGATGG - Intronic
1030844834 7:114396377-114396399 ATCAATGGATGAATGGATAAAGG - Intronic
1031643873 7:124199632-124199654 ATCAATAGATGAATGGATAAAGG + Intergenic
1031653773 7:124325756-124325778 ATCAACAGATGGATGGATAAAGG + Intergenic
1032160069 7:129502948-129502970 GCGAAAAGATGGAGGGACAAGGG + Intronic
1033378466 7:140788519-140788541 ATAAAAATATGGATGGATAAGGG + Intronic
1033642702 7:143277563-143277585 ATGCATTGATGGATGGATAAAGG + Intergenic
1033821194 7:145135916-145135938 GAGAATAGAAGGATGGTTACCGG - Intergenic
1034883607 7:154780840-154780862 ATGAATAGATGGATGGGTGATGG + Intronic
1034883631 7:154780968-154780990 ATGAATAGATGGATGGTTGATGG + Intronic
1035058446 7:156051999-156052021 GTGGATGGATGGTTGGATAGAGG - Intergenic
1035058485 7:156052155-156052177 GTGGATGGATGGGTGGATGAAGG - Intergenic
1035063202 7:156084633-156084655 ATCAATGGATGAATGGATAAAGG - Intergenic
1035288524 7:157821985-157822007 ATGAGTAGATGGATGGATGATGG - Intronic
1035288645 7:157822826-157822848 GTGGATGGATAGATGGATAGTGG - Intronic
1035318613 7:158013917-158013939 GTGATTGGATGGATGGATAGAGG - Intronic
1035318658 7:158014109-158014131 GTGATTGGATGGATGGATAGAGG - Intronic
1035318689 7:158014257-158014279 GTGAATAGATGGGTGGATGGAGG - Intronic
1035452499 7:158987016-158987038 ATGGACAGATGCATGGATAATGG - Intergenic
1035452520 7:158987246-158987268 ATGGACAGATGCATGGATAATGG - Intergenic
1035452551 7:158987499-158987521 ATGGATGGATGCATGGATAATGG - Intergenic
1035452554 7:158987518-158987540 ATGAATGGATGCATTGATAATGG - Intergenic
1035898231 8:3428808-3428830 GTCAATCAATGGATGAATAATGG + Intronic
1035926444 8:3732936-3732958 GTAAGTAGATAGATAGATAATGG - Intronic
1036662984 8:10720297-10720319 ATGAATGGATGGATGGAGAGTGG + Intergenic
1037921262 8:22807868-22807890 ATGGATGGATGGATGGATAGAGG - Intronic
1037921302 8:22808083-22808105 CTGAATGAATGGATGGATAGAGG - Intronic
1038129727 8:24716157-24716179 GAGAAGAGATGGCTGGAGAAAGG + Intergenic
1038325130 8:26567235-26567257 GTGGATGGATAGATGGATGATGG - Intronic
1038440769 8:27569564-27569586 ATGGATGGATGGATGGATGAAGG + Intergenic
1038440910 8:27570180-27570202 ATGGATGGATGGATGGATGAAGG + Intergenic
1038440932 8:27570276-27570298 ATGGATAGCTGGATGGATAAAGG + Intergenic
1038461461 8:27720777-27720799 ATGAATGGATGGATGAATAGAGG - Intergenic
1038679426 8:29653070-29653092 ATGAGTAAATGGATGGATGATGG - Intergenic
1039411130 8:37356142-37356164 ATGAATAGATGGATGCATGTAGG + Intergenic
1039431046 8:37525270-37525292 GTGCAGAGAAGGATGGATGATGG - Intergenic
1040584521 8:48726826-48726848 GTGGATGCATGGATGGACAATGG - Intronic
1040830332 8:51668943-51668965 GTGCATGGATGGATGGATGTAGG + Intronic
1041010257 8:53534936-53534958 ATGGATGGATGGATGGATGATGG + Intergenic
1041015287 8:53587105-53587127 GTGAAAAGAAGTATGGAGAATGG + Intergenic
1041076134 8:54171778-54171800 GAAAATAAATGCATGGATAAAGG + Intergenic
1041594374 8:59629911-59629933 GGGAATAAATGAATGAATAAAGG + Intergenic
1041697169 8:60748266-60748288 GTTGAGAGAAGGATGGATAAAGG + Intronic
1041959374 8:63594920-63594942 TAGAATAGATAGTTGGATAAAGG + Intergenic
1041964699 8:63662545-63662567 TTGAAAAGGTGGATGGATAAAGG - Intergenic
1042075243 8:64986884-64986906 GAGAATAAATGACTGGATAAAGG + Intergenic
1042215343 8:66425437-66425459 ATGGATGGATGGATGGATGAAGG + Intergenic
1042272942 8:66973968-66973990 TTGGACAGATGAATGGATAAAGG - Intronic
1042964344 8:74334679-74334701 GTGTGTAGATGGGTGGATAGTGG - Intronic
1043593059 8:81852185-81852207 AAAAATAGATGAATGGATAAAGG + Intergenic
1044112707 8:88296116-88296138 ATGAATAAATGGATGAATGATGG - Intronic
1044236293 8:89834530-89834552 GTTTATAAATGAATGGATAAAGG + Intergenic
1044327745 8:90878681-90878703 ATGAATAAATGGATGAATGAAGG + Intronic
1044836776 8:96303288-96303310 GTGGATAGGTGGGTGGATGAAGG + Intronic
1045024976 8:98078238-98078260 TTGATTGGATGGATGGATGAAGG + Intronic
1045092959 8:98766058-98766080 GTGAAGAAATGGAGTGATAAGGG - Intronic
1045129125 8:99128509-99128531 GTGGGCAGATGTATGGATAATGG - Intronic
1045628598 8:104087387-104087409 ATGGATGGATGGATGGACAAGGG + Intronic
1045707115 8:104937191-104937213 AAGAATAGATGGATTGATATTGG + Intronic
1046112171 8:109738478-109738500 ATGGATGGATGGATGGATGAGGG - Intergenic
1046675348 8:117101930-117101952 ATGGATAGATGGATATATAAAGG - Intronic
1047292564 8:123542161-123542183 GTGAATAAGTGAATGGATACGGG + Intergenic
1047306784 8:123659094-123659116 ATGAATGGATGGATGGATGATGG - Intergenic
1047306805 8:123659210-123659232 GAGGATGGATGGATGGATGATGG - Intergenic
1047306897 8:123659744-123659766 ATGGATGGATGGATGGATGATGG - Intergenic
1047703913 8:127478431-127478453 GTGAATAAATGAATGAATAATGG - Intergenic
1048175374 8:132147660-132147682 GATGATAGATGGATGGATAATGG + Intronic
1048187856 8:132260774-132260796 ATAATTAAATGGATGGATAATGG - Intronic
1048187873 8:132260877-132260899 TTGGATGGATGGATGGATGATGG - Intronic
1048454736 8:134567502-134567524 GTGGATAGATGGGTGGATTATGG - Intronic
1048979739 8:139696917-139696939 GTGGATGGATAGATGGATGAAGG + Intronic
1048979784 8:139697087-139697109 GTGAACAGATGGATGGTGGATGG + Intronic
1048989273 8:139751848-139751870 GTGAGTGGATGGATGAATAGTGG - Intronic
1048989285 8:139751909-139751931 GTGGATAGATGGATGGTGGATGG - Intronic
1048989414 8:139752536-139752558 GTGGATAGATGGATGGTGGATGG - Intronic
1049042130 8:140120567-140120589 ATGAATGGATGGATGGATGTTGG - Intronic
1049042164 8:140120731-140120753 ATGAATGGATGGATGGATGTTGG - Intronic
1049042173 8:140120789-140120811 ATGAATGGATGGATGGATGTTGG - Intronic
1049042181 8:140120835-140120857 ATGGATGGATGGATGGATGATGG - Intronic
1049320653 8:141994541-141994563 ATGAATGGATGCATGGATAATGG - Intergenic
1049320685 8:141994658-141994680 ATGAATGGATGGATGGATAGTGG - Intergenic
1049320720 8:141994808-141994830 ATGAATGGATGGATGGATAGTGG - Intergenic
1049320748 8:141994905-141994927 ATGAATGGATGGATGGATAGTGG - Intergenic
1049341671 8:142115960-142115982 ATGAATAGATAAATGAATAAGGG - Intergenic
1049341743 8:142116524-142116546 ATGGATGGATGGATGGATAGAGG - Intergenic
1049348210 8:142150195-142150217 ATAAATGGATGGATGGATGATGG + Intergenic
1049348277 8:142150522-142150544 ATAAATGGATGGATGGATGATGG + Intergenic
1049350926 8:142164221-142164243 ATGGATGGATGGATGGATGAAGG + Intergenic
1049350953 8:142164375-142164397 GTAGATGGATGGATGGATGAAGG + Intergenic
1049359854 8:142207278-142207300 GTGAGTGGATGGATGGGGAATGG + Intergenic
1049359937 8:142207602-142207624 GTGGATGGATGGATGGATGGAGG + Intergenic
1049364284 8:142229217-142229239 GTGGGTGGATGGATGGATGATGG + Intronic
1049364317 8:142229364-142229386 ATGGATAGATGGATGGATGGTGG + Intronic
1049474876 8:142792436-142792458 GTGGATGGATGGATGGATGACGG - Intergenic
1049474926 8:142792728-142792750 GTGAATGGATGAATGGAGGATGG - Intergenic
1049576539 8:143392389-143392411 ATGGATAGATGGTTGGATGATGG - Intergenic
1050213136 9:3287631-3287653 ATGAATGGATGGATGAATGATGG - Intronic
1050842045 9:10162303-10162325 GTCAATGTATGAATGGATAAAGG + Intronic
1050882725 9:10722889-10722911 ATGGATGGATGCATGGATAAAGG + Intergenic
1051005955 9:12344887-12344909 ATTAATAGATGAATGGTTAAAGG + Intergenic
1051025697 9:12608015-12608037 GTGAATAGTTGGATAGAATATGG - Intergenic
1051173029 9:14338794-14338816 ATAGATAGATGGATGGATGAAGG - Intronic
1051322516 9:15923261-15923283 ATCAATGGATGGATGGATGAAGG + Intronic
1051611775 9:18968356-18968378 TTTAAGAGATGCATGGATAATGG + Intronic
1052220077 9:26010187-26010209 CTGGATAGGTGGATGGATGACGG - Intergenic
1052284760 9:26772421-26772443 ATGAATGGATGGATGGCTTATGG + Intergenic
1052472488 9:28917380-28917402 CTGAATGGATGGGTGGAAAATGG - Intergenic
1052515894 9:29479076-29479098 GAGTATAGATAGATGGAAAAAGG - Intergenic
1052721324 9:32174447-32174469 TTGAATAAGTGGTTGGATAAAGG - Intergenic
1052853148 9:33390357-33390379 GTGGATACATGGGTGGTTAATGG + Intronic
1053487468 9:38470766-38470788 ATGAATAAGTGGATGGATGAAGG - Intergenic
1053681186 9:40486531-40486553 GTGGATAGACGGGTGGTTAATGG + Intergenic
1053802980 9:41775748-41775770 ATGAATGGATGGATGGATGGTGG - Intergenic
1053839561 9:42178949-42178971 GTGGATAGGTGGATGCATACTGG + Intergenic
1053878838 9:42570443-42570465 GTGGATAGATGGATGTGTATTGG - Intergenic
1054142279 9:61539358-61539380 ATGAATGGATGGATGGATGGTGG + Intergenic
1054145341 9:61557396-61557418 GGGAATAGATGGATGCTGAATGG - Intergenic
1054188275 9:61969583-61969605 GGGAATAGATGGATGCTGAATGG + Intergenic
1054191271 9:61987058-61987080 ATGAATAGATGGATGGATGGTGG - Intergenic
1054232851 9:62531252-62531274 GTGGATAGATGGATGTGTATTGG + Intergenic
1054282528 9:63138403-63138425 GTGGATAGACGGGTGGTTAATGG - Intergenic
1054454329 9:65421802-65421824 GTGGATGGATGGGTGGATGATGG + Intergenic
1054454339 9:65421852-65421874 GATAATAGATGGATGGATGATGG + Intergenic
1054454349 9:65421899-65421921 GTGGATGGATGGATGGATGGTGG + Intergenic
1054458884 9:65451342-65451364 ATGGATGGATGGATGGATGATGG + Intergenic
1054462028 9:65470509-65470531 ATGAATGGATGGATGGATGGTGG + Intergenic
1054465097 9:65488549-65488571 GGGAATAGATGGATGCTGAATGG - Intergenic
1054647097 9:67600659-67600681 ATGAATAGATGGATGGATGGTGG + Intergenic
1054650218 9:67618917-67618939 GTGGGTGGATAGATGGATAATGG - Intergenic
1054650239 9:67618993-67619015 GGGAATAGATGGATGCTGAATGG - Intergenic
1055013863 9:71595196-71595218 ATGAATAACTGCATGGATAATGG - Intergenic
1055246597 9:74252822-74252844 ATAAATAGATGGATGGATAGAGG + Intergenic
1055641248 9:78320448-78320470 ATGAATAGATGGGTGGGTGATGG - Intronic
1055710496 9:79055725-79055747 GTAGATAGATAGATGGATGAGGG - Intergenic
1056962960 9:91142880-91142902 ATGGATGGATGGATGGATACAGG - Intergenic
1057082630 9:92184424-92184446 ATGGATAAATGGATGGATAATGG - Intergenic
1057284739 9:93742920-93742942 ATGAAGAGATGCATGGATCAAGG + Intergenic
1057885947 9:98829856-98829878 ATCAACAGATGAATGGATAAAGG - Intronic
1058248649 9:102663518-102663540 ATCAACAGATGAATGGATAAAGG - Intergenic
1058754635 9:108073034-108073056 GTGAACAGGTGGATGGCTGATGG - Intergenic
1059070110 9:111126537-111126559 CTGCATAGATGGATGGGTAAAGG - Intergenic
1059252158 9:112895531-112895553 GTGGGTAGATGGATGGATGATGG - Intergenic
1059252171 9:112895582-112895604 GTAGATAGATGGATGGATGATGG - Intergenic
1059252200 9:112895688-112895710 ATGAATAGACAGATGGATGATGG - Intergenic
1059252205 9:112895719-112895741 GTGGATGGATGGATTAATAATGG - Intergenic
1059252212 9:112895746-112895768 GTGGATGGGTAGATGGATAATGG - Intergenic
1059252230 9:112895801-112895823 ATGGGTAGATGGATGGATGATGG - Intergenic
1059252238 9:112895832-112895854 GTGGGTGGATGGATGGATGATGG - Intergenic
1059252245 9:112895855-112895877 GTGGACAGATGAATGGATGATGG - Intergenic
1059361732 9:113748015-113748037 ATGAATTTATGGATGGATAGAGG - Intergenic
1059409075 9:114120756-114120778 ATGGATAGATGAATGGATGATGG + Intergenic
1059409088 9:114120822-114120844 GTTGATGGATGGATGGATGATGG + Intergenic
1059416404 9:114165340-114165362 ATGGATGGATGGATGGATGATGG - Intronic
1059416412 9:114165379-114165401 ATGGATGGATGGATGGATATTGG - Intronic
1059416476 9:114165736-114165758 GTAGATGGATGGATGTATAATGG - Intronic
1059416513 9:114165934-114165956 ATGGATAGATGGATGGATGATGG - Intronic
1059417933 9:114173518-114173540 ATGAATGGATGGCTGAATAAGGG - Intronic
1059452414 9:114378716-114378738 GTGGGTAGATGGATGGATGTTGG - Intronic
1059498572 9:114731070-114731092 GTGGATGGGTGGATGGATAGTGG - Intergenic
1060037185 9:120265514-120265536 ATGGATGGATGGATGGAAAATGG + Intergenic
1060119994 9:120979912-120979934 ATGAATAAATGAATGAATAACGG + Intronic
1060748595 9:126154149-126154171 GTGGAAGGATGGATGGATGAAGG + Intergenic
1060989003 9:127837739-127837761 ATGAGAGGATGGATGGATAAGGG - Intronic
1061255850 9:129453915-129453937 ATTAATGGATGGATGGATAGGGG + Intergenic
1061256674 9:129457476-129457498 ATGGATGGATGGATGGATGATGG + Intergenic
1061417439 9:130454760-130454782 GTGAATGGATGGGTGGGTGATGG - Intronic
1061417446 9:130454783-130454805 ATGGATGGATGGATGGATGATGG - Intronic
1061417451 9:130454806-130454828 GTGAATGGATGGGTGGGTGATGG - Intronic
1061417458 9:130454829-130454851 ATGGATGGATGGATGGATGATGG - Intronic
1061417477 9:130454914-130454936 ATGAATGGATGGATGGATAATGG - Intronic
1061417491 9:130454991-130455013 GTGAATGGATGGATGGATGATGG - Intronic
1061417502 9:130455048-130455070 ATGGATGGATGGATGGATGATGG - Intronic
1061417516 9:130455132-130455154 ATGGATGGATGGATGGATGATGG - Intronic
1061417529 9:130455215-130455237 ATGAATAGACGGATGGATGATGG - Intronic
1061782990 9:133006834-133006856 GTGGATGGATGGATGAATGATGG + Intergenic
1061950525 9:133933504-133933526 GTGAATGGATGGATGAATGATGG + Intronic
1061950532 9:133933539-133933561 GTGGATGGATGGATGGATGGTGG + Intronic
1061950537 9:133933558-133933580 GTGGATGGATGGATGGATGGTGG + Intronic
1061950596 9:133933824-133933846 GTGGATGGATGGATGGATGGTGG + Intronic
1061950616 9:133933902-133933924 GTGGATGGATGGATGGATGATGG + Intronic
1061964039 9:134003282-134003304 GTGGATGGATGGATGGATGGAGG - Intergenic
1061980966 9:134103443-134103465 GTGGATGGATGGATGGATGGTGG - Intergenic
1061981044 9:134103805-134103827 GTGGATGGATGGATGGATGTTGG - Intergenic
1061981073 9:134103954-134103976 GTGGATGGATGGATGGATAGTGG - Intergenic
1061981078 9:134103976-134103998 GTGGATGGATGGATGGATAGTGG - Intergenic
1061981086 9:134104010-134104032 GTGGATGGATGGATGGATGGTGG - Intergenic
1061981119 9:134104152-134104174 GTGGATGGATGGATGGATGGTGG - Intergenic
1061981143 9:134104271-134104293 GTGGATGGATGGATGGATGGTGG - Intergenic
1061981161 9:134104344-134104366 GTGGATGGATGGATGGATGGTGG - Intergenic
1061981204 9:134104527-134104549 GTGGATGGATGGATGGATGGTGG - Intergenic
1061981226 9:134104620-134104642 GTGGATGGATGGATGGATGGTGG - Intergenic
1062092430 9:134685445-134685467 ATGGATGGATGGATGGATGATGG - Intronic
1062092520 9:134685868-134685890 GTGGGTGGATGGATGGATGATGG - Intronic
1062092529 9:134685899-134685921 ATGAATGGATGGATGGATGGTGG - Intronic
1062092539 9:134685938-134685960 GTGGATGGATGGATGGATGGTGG - Intronic
1062092547 9:134685973-134685995 GTGGGTGGATGGATGGCTAATGG - Intronic
1062092820 9:134687455-134687477 ATGAATGGATGGATGGATGATGG - Intronic
1062172211 9:135141154-135141176 GCGGATGGATGGATGGATGATGG + Intergenic
1062172221 9:135141217-135141239 GTGGATGGATGAATGGATGATGG + Intergenic
1062172226 9:135141240-135141262 ATGGATGGATGGATGGATGATGG + Intergenic
1062201290 9:135304186-135304208 GTGGACAGATGGATGGATGTTGG + Intergenic
1062201294 9:135304209-135304231 TTGAGTGGATGGATGGATGATGG + Intergenic
1062201329 9:135304363-135304385 GTGGATGGATGGATGGATGGTGG + Intergenic
1062201342 9:135304435-135304457 ATGAATGGATAGATGGATGATGG + Intergenic
1062201357 9:135304492-135304514 TTGAGTGGATGGATGGATGATGG + Intergenic
1062201367 9:135304522-135304544 GTGGATGGATGGATGGATGGTGG + Intergenic
1062201371 9:135304545-135304567 ATGAGTGGATGGATGGATGATGG + Intergenic
1062205470 9:135334385-135334407 TTGGATAAATGGATGGATGATGG + Intergenic
1062205489 9:135334505-135334527 TTGGATAAATGGATGGATGATGG + Intergenic
1062247979 9:135579411-135579433 GTGAATAAATGGATGGTGTATGG - Intergenic
1062248072 9:135579929-135579951 GTAAATAAATGGATGGACAATGG - Intergenic
1062281241 9:135752680-135752702 ATGAGTGGATGGGTGGATAATGG + Intronic
1062520696 9:136956669-136956691 ATGGATGGATGGATGGATGATGG + Intronic
1062520725 9:136956815-136956837 ATGGATAAATGGATGGATGAAGG + Intronic
1062520776 9:136957032-136957054 ATGGATAGATGGTTGGATGATGG + Intronic
1062520792 9:136957089-136957111 GTGGATGGATGGTTGGATGATGG + Intronic
1062520800 9:136957116-136957138 GTGGATGGATGGTTGGATATTGG + Intronic
1062520806 9:136957139-136957161 GTGGATGGATGGTTGGATGATGG + Intronic
1062520814 9:136957166-136957188 GTGGATGGATGGTTGGATATTGG + Intronic
1062520820 9:136957189-136957211 GTGGATGGATGGTTGGATGATGG + Intronic
1062520828 9:136957216-136957238 GTGGATGGATGGTTGGATGATGG + Intronic
1062520837 9:136957243-136957265 GTGGGTGGATGGATGGATGATGG + Intronic
1062520855 9:136957301-136957323 GTGGGTGGATGGTTGGATAATGG + Intronic
1062520873 9:136957358-136957380 GTGGATGGATGGTTGGATGATGG + Intronic
1062520881 9:136957385-136957407 GTGGATGGATGGTTGGATGATGG + Intronic
1062520888 9:136957412-136957434 GTGGATGGATGGTTGGATGATGG + Intronic
1062520905 9:136957466-136957488 GTGGATGGATGGTTGGATGATGG + Intronic
1062520924 9:136957524-136957546 GTGGATGGATGGTTGGATGATGG + Intronic
1062520932 9:136957551-136957573 GTGGATGGATGGTTGGATGACGG + Intronic
1062520940 9:136957578-136957600 GTGGATGGATGGTTGGATGATGG + Intronic
1062520950 9:136957609-136957631 GTGGATGGATGGTTGGATGATGG + Intronic
1062520958 9:136957636-136957658 GTGGGTGGATGGATGGATGAAGG + Intronic
1062649715 9:137569345-137569367 GTGGATTGTTGGATGGATAGTGG - Intronic
1062649818 9:137569715-137569737 ATGGATGGATGGATGGATCATGG - Intronic
1062649877 9:137569977-137569999 GTGACTGGATGGATGGATGGTGG - Intronic
1062649906 9:137570083-137570105 GTGGATGGATGGATGGATGGTGG - Intronic
1062665411 9:137668450-137668472 GTGAATAGATGGATGTGGACAGG - Intronic
1185481875 X:452319-452341 GTGGATAAATAGATAGATAATGG - Intergenic
1185495180 X:549335-549357 ATGAACAGATGAATGAATAATGG - Intergenic
1185495218 X:549578-549600 GTGGGTGGATGGATGGATGAAGG - Intergenic
1185497296 X:565277-565299 GTGGACAAATGGATGGATGATGG + Intergenic
1185497397 X:565874-565896 ATGGATAGATGGATGCATGATGG + Intergenic
1185497528 X:566566-566588 ATGAGTAGATGGATGGATGGTGG + Intergenic
1185497532 X:566589-566611 ATGGATAAATGGATGGATGATGG + Intergenic
1185503921 X:618696-618718 ATGAATGGATGAATGGATGAAGG + Intergenic
1185543694 X:924446-924468 ATAGATAGATGGATGGATGATGG + Intergenic
1185543724 X:925204-925226 ATGAATAGATGGAAGGATGGTGG + Intergenic
1185543747 X:925371-925393 GTGGATGGATGGATGGATGGTGG + Intergenic
1185546998 X:953845-953867 CTGAATGAATGGATGGATGAGGG - Intergenic
1185581124 X:1212137-1212159 AATAATAGATGGATGGATAGTGG + Intronic
1185583286 X:1227041-1227063 ATGAATGGATGGATGGATTGAGG + Intergenic
1185611409 X:1395556-1395578 GATAACGGATGGATGGATAATGG + Intergenic
1185611411 X:1395571-1395593 GATAATGGATAGATGGATAATGG + Intergenic
1185611416 X:1395598-1395620 ATGGATGGATGGATGGATGATGG + Intergenic
1185611443 X:1395726-1395748 ATGGATGGATGGATGGATAATGG + Intergenic
1185611447 X:1395745-1395767 ATGGATGGATGGATGGATAATGG + Intergenic
1185611452 X:1395783-1395805 ATGTATAGATGGATGGATGATGG + Intergenic
1185611456 X:1395802-1395824 ATGGATGGATGGATGGATAATGG + Intergenic
1185611499 X:1396038-1396060 TGGGATGGATGGATGGATAATGG + Intergenic
1185616429 X:1424687-1424709 GTGGATGACTGGATGGATAAAGG - Intronic
1185629963 X:1508678-1508700 ATGGATGGATGGATGGATGATGG - Intronic
1185630011 X:1509340-1509362 ATGGATGGATGGATGGATGATGG - Intronic
1185639257 X:1577641-1577663 ATGGATGGATGGATGGATGATGG + Intergenic
1185762670 X:2700597-2700619 GTGCATTAACGGATGGATAAAGG - Intronic
1185780599 X:2841432-2841454 ATGGATGGATGGATGGATGATGG + Intronic
1185867814 X:3639149-3639171 GTGGATGGATGGATGGATGAAGG + Intronic
1185867852 X:3639265-3639287 ATGGATGGATGGATGGATGAAGG + Intronic
1185867944 X:3639492-3639514 GTGGGTACATGGATGGATGAAGG + Intronic
1185874552 X:3691882-3691904 ATGGATGGATGGATGGACAATGG + Intronic
1185883144 X:3758684-3758706 GTGGATGGATGGATGGATGGAGG - Intergenic
1185883520 X:3761207-3761229 ATGAATGTATGGATGGATGAGGG + Intergenic
1185883813 X:3764082-3764104 GTGGACTGATGGATGGATGATGG - Intergenic
1186002030 X:5023561-5023583 ATGAATGGATGGATGGATGGTGG - Intergenic
1186055577 X:5646182-5646204 ATGGATGGATGGATGGATGATGG - Intergenic
1186178642 X:6951213-6951235 ATGGATGGATGGATGGATGATGG - Intergenic
1186338992 X:8623013-8623035 CTGGATGGATGGATGGATGATGG + Intronic
1186481888 X:9902283-9902305 GTGGATAGATGGATGGATAGAGG + Intronic
1186492824 X:9987811-9987833 ATGGATTGATGGATGGATAGAGG + Intergenic
1187211484 X:17236695-17236717 GAGAATAGATGCATGGAGCATGG - Intergenic
1187250509 X:17593869-17593891 GTGGATGGATGGATGGATGGAGG + Intronic
1187484084 X:19685601-19685623 ATGGATAGATGGATAGCTAATGG - Intronic
1187855530 X:23633108-23633130 ATCAATGGATGGTTGGATAAAGG - Intergenic
1188103989 X:26125842-26125864 ATAAATAGATAGATAGATAATGG - Intergenic
1188452458 X:30322373-30322395 GTTAATAATTGGCTGGATAATGG - Intergenic
1188810255 X:34645262-34645284 GTGAATAGATGGATAATTTAGGG - Intronic
1189063686 X:37783137-37783159 ATGAGTTGATGGATGGATACAGG + Intronic
1189986743 X:46559946-46559968 ATGAAAAGGTGGATGGATATAGG - Intergenic
1190121870 X:47667337-47667359 GTCAACAGATGAATGGATAAAGG - Intergenic
1191152248 X:57232104-57232126 CTGTATAGATGGAGGGATGAAGG + Intergenic
1191630961 X:63321790-63321812 GAGAATACATGGATGCATAGAGG + Intergenic
1191655320 X:63590735-63590757 GAGAACACATGGATGCATAAAGG - Intergenic
1192381037 X:70616631-70616653 GTCAACAGATGAATGGATAAAGG + Intronic
1193060512 X:77201529-77201551 GTCAAAAGATGAATGAATAAAGG - Intergenic
1193133124 X:77939374-77939396 GGAAATAAATGGAGGGATAATGG - Intronic
1193168232 X:78305944-78305966 ATCAACAGATGAATGGATAAAGG + Intronic
1193199897 X:78676482-78676504 GAGAACACATGGATGCATAAAGG - Intergenic
1193200047 X:78678556-78678578 GAGAACACATGGATGCATAAAGG + Intergenic
1193698693 X:84739190-84739212 GTGGAGAGATGGATGGTCAAGGG - Intergenic
1193760584 X:85461313-85461335 ATCAACAGATGAATGGATAAAGG - Intergenic
1194046982 X:89019938-89019960 GTTAACAGATGAATGGATAAAGG + Intergenic
1194809465 X:98373035-98373057 GTGAATAACTGGATGGTTAGAGG + Intergenic
1195219888 X:102736785-102736807 GGAAATATATGGATGGCTAATGG - Intronic
1195661924 X:107387300-107387322 GTGGAAAGATGTATGCATAAGGG + Intergenic
1196632176 X:117954414-117954436 ATGGATGGATGGATGGATAAAGG + Intronic
1196650126 X:118159915-118159937 ATGGATGGATGGATGGAGAATGG + Intergenic
1196753009 X:119134359-119134381 ATCAATAGATGAATGGATAAAGG - Intronic
1197045187 X:121988129-121988151 ATCAACAGATGAATGGATAAAGG - Intergenic
1197915868 X:131534389-131534411 ATCAACAGATGAATGGATAAAGG + Intergenic
1198646598 X:138813878-138813900 GAGAATATATGAATGAATAAAGG + Intronic
1198853661 X:140993020-140993042 GGGAATCGAGGCATGGATAAAGG - Intergenic
1199133724 X:144227019-144227041 ATGCATATATGGATAGATAATGG - Intergenic
1199450717 X:147976227-147976249 TTGAGTGAATGGATGGATAAAGG - Intergenic
1199784630 X:151093471-151093493 ATGGATGGATGAATGGATAAAGG - Intergenic
1200383402 X:155864355-155864377 ATCAACAGATGAATGGATAAAGG - Intergenic
1200781948 Y:7224705-7224727 GTGAATGGATAGATGGGTGATGG - Intergenic
1201747136 Y:17389176-17389198 ATAAATAGATGGATGGATGTAGG + Intergenic
1201917407 Y:19196898-19196920 ATGGATGGATGGATGGATTATGG + Intergenic