ID: 1184654264

View in Genome Browser
Species Human (GRCh38)
Location 22:45933247-45933269
Sequence GTCTCGGACCTTGCTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184654264_1184654270 7 Left 1184654264 22:45933247-45933269 CCCTCCCCAGCAAGGTCCGAGAC 0: 1
1: 0
2: 0
3: 15
4: 139
Right 1184654270 22:45933277-45933299 ATCAGCCTCCTCTGAGCTGCAGG 0: 1
1: 1
2: 0
3: 44
4: 659

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184654264 Original CRISPR GTCTCGGACCTTGCTGGGGA GGG (reversed) Intronic
900470465 1:2851820-2851842 GTCTGGGTCCTTGCAGTGGATGG - Intergenic
900919792 1:5662915-5662937 GTCTCGGAATTTGCTGTTGAAGG - Intergenic
901650767 1:10741945-10741967 GTCTCGGCGCTTGCTGGGTTAGG - Intronic
901842986 1:11965401-11965423 GTCTGGGAGCGTGCAGGGGAGGG + Intronic
902645655 1:17796178-17796200 GACACGGACTCTGCTGGGGATGG + Intronic
902822932 1:18954604-18954626 ATCTCAGGCCTGGCTGGGGAAGG - Intronic
902834127 1:19035847-19035869 GATTCTGACCTTGCTGGGGCTGG - Intergenic
904319876 1:29689774-29689796 GTCTGGGACCCTGGTGGGGATGG + Intergenic
905303579 1:37002349-37002371 GAGTCAGACCTTGCTGGGGATGG + Intronic
905326306 1:37154521-37154543 GTCTTGCAGCTAGCTGGGGATGG - Intergenic
905398781 1:37686428-37686450 GTCTCGCACCTTGAGGAGGATGG + Exonic
906209205 1:44002822-44002844 GGCACAGACCCTGCTGGGGAGGG + Intronic
906651225 1:47514325-47514347 GTCTGGCACCTTGTTGGGGATGG - Intergenic
910800354 1:91138779-91138801 GTCTTGGATCTTGAAGGGGAGGG + Intergenic
912951921 1:114126164-114126186 GTCTCACACCTTGCTTGGGGTGG - Intronic
924237603 1:242012226-242012248 GTCTGGAAGCTGGCTGGGGAAGG + Intergenic
1062854650 10:773875-773897 GTGACGGGCCCTGCTGGGGAGGG + Intergenic
1062854660 10:773897-773919 GTGGCGGGCCCTGCTGGGGAGGG + Intergenic
1063117858 10:3084849-3084871 GTGGGGGACCGTGCTGGGGAGGG - Intronic
1063117892 10:3084947-3084969 GTGGGGGACCGTGCTGGGGAGGG - Intronic
1063117902 10:3084971-3084993 GTGGGGGACCGTGCTGGGGAGGG - Intronic
1063117912 10:3084995-3085017 GTGGGGGACCGTGCTGGGGAGGG - Intronic
1063117922 10:3085019-3085041 GTGGGGGACCGTGCTGGGGAGGG - Intronic
1063117932 10:3085043-3085065 GTGGGGGACCGTGCTGGGGAGGG - Intronic
1063117942 10:3085067-3085089 GTGGGGGACCGTGCTGGGGAGGG - Intronic
1063117952 10:3085091-3085113 GTGGCGGACCGTGCTGGGGAGGG - Intronic
1063593172 10:7411210-7411232 GGCGCGGAGCTGGCTGGGGAAGG - Intronic
1064261226 10:13788117-13788139 GTCTGTGACCTTGCTGGGCCTGG + Intronic
1067474820 10:46558035-46558057 CTCTCAGACCTCGCTGGAGAGGG - Intergenic
1068082896 10:52341840-52341862 TTCTCAGACCTTACTGGGTAGGG - Intergenic
1071486438 10:86105590-86105612 GCCCCGGACACTGCTGGGGAGGG - Intronic
1072649383 10:97282637-97282659 GTTCCAGACCTTGCTGGAGATGG - Intronic
1074369295 10:112886648-112886670 GTCTCTCACCTGGCTGAGGAGGG - Intergenic
1075946177 10:126435239-126435261 CTCTCAGACCTTTCTGGTGAAGG + Intronic
1076611269 10:131727229-131727251 GTTTCCGCCCCTGCTGGGGAAGG + Intergenic
1076870691 10:133191823-133191845 GGCTCGGCCCTTGCTGGGCGGGG - Intronic
1076980159 11:199869-199891 GTCTCTGCCCTGGCTGGGGCTGG - Intronic
1077259903 11:1611130-1611152 CTCTCAGGCATTGCTGGGGAGGG - Intergenic
1077693168 11:4367935-4367957 GTCAGGGATCTTGCTGGTGATGG - Exonic
1081559799 11:44203339-44203361 ATCTCAGATCTAGCTGGGGAAGG - Intronic
1083325887 11:61872852-61872874 GTTTCGGACAGTTCTGGGGAGGG - Intergenic
1084860327 11:72013900-72013922 GTCTTGTACCTTGGTGCGGAAGG + Exonic
1084975346 11:72794110-72794132 GGCTAGGACCTTTCTGGGGCTGG + Intergenic
1085646784 11:78229127-78229149 GTATCAGCCCTTGCTGGGGGTGG + Intronic
1086021709 11:82238916-82238938 TTCTCTGCCCTTGCTGGAGAGGG + Intergenic
1088358845 11:108970332-108970354 GTCTGGCACCATGGTGGGGATGG - Intergenic
1090239361 11:125171202-125171224 GTGTCCTGCCTTGCTGGGGAGGG + Intronic
1090252693 11:125262699-125262721 GGCTCGGAACTAGCTGGGGGAGG + Intronic
1091268447 11:134288718-134288740 GTCTCTGAGCTTGCTGCCGAAGG - Intronic
1099202290 12:79690637-79690659 GGCGCGGACCTTGGTGGGGATGG - Intronic
1101406272 12:104432010-104432032 GTCTGGCACCATGGTGGGGATGG - Intergenic
1102009855 12:109611631-109611653 GTTTGAGACTTTGCTGGGGAAGG - Intergenic
1102188959 12:110971436-110971458 GTCTGGTACCTTGCTAGGGATGG + Intergenic
1102341639 12:112126204-112126226 ATCACCGACCTTCCTGGGGACGG + Intronic
1104854552 12:131895654-131895676 GTCTCAGACGCTGCTGGGGAAGG + Exonic
1107457259 13:40566288-40566310 GTCTGGGAGCATCCTGGGGAGGG - Intronic
1111180844 13:84662839-84662861 GCCTCTGACCTTGATGGTGAAGG - Intergenic
1112706394 13:102073966-102073988 GTCTCAGACCTTGTTGGGAAGGG - Intronic
1115806298 14:37055679-37055701 GTCTGGGGCCTTGGTGGGGATGG - Intronic
1120995578 14:90416121-90416143 GTCTGGCACCTGGATGGGGATGG - Intergenic
1121493219 14:94374837-94374859 GCCTGGGTCCCTGCTGGGGAGGG + Intergenic
1122020912 14:98837186-98837208 GCCTCTGACCTTTCTGGGCAGGG + Intergenic
1124347150 15:28930543-28930565 GTCTTGGAGCCGGCTGGGGAGGG + Intronic
1132823205 16:1887864-1887886 GTCCCAGGCCTTGCTGGGGGAGG - Intergenic
1136800133 16:33062394-33062416 GGCCCGGGCCTTGGTGGGGATGG - Intergenic
1136862839 16:33713288-33713310 GTCTAGGACAAGGCTGGGGAAGG - Intergenic
1137727213 16:50665108-50665130 GGCGCGGGCCTTACTGGGGAAGG + Intergenic
1138078444 16:54065723-54065745 CTCTTGGACCTTTCTGGGAATGG + Intronic
1138640590 16:58383161-58383183 GTCTGAGACCTTGGTTGGGATGG + Intronic
1139421212 16:66850646-66850668 GGCCCGTACCTCGCTGGGGAAGG - Exonic
1141768813 16:86076248-86076270 GTCCCTGCCCTTGGTGGGGATGG + Intergenic
1142978918 17:3660400-3660422 GCCTCGTGCCCTGCTGGGGAAGG + Intronic
1146685962 17:34841819-34841841 TTCTCCCACCTTGCTAGGGATGG - Intergenic
1150230411 17:63546577-63546599 GCCTCTGACCTGGCTGGAGATGG + Exonic
1151656627 17:75499249-75499271 GACTCGGACCCTGGTGGGGCAGG - Exonic
1151943138 17:77305221-77305243 GTCACGGACATGGCTGGGGCAGG + Intronic
1154517927 18:15195228-15195250 GGCTCGGGCCTTGGTGGGGGTGG + Intergenic
1155552676 18:26982548-26982570 GTTCCAGACCTTACTGGGGACGG + Intronic
1158212628 18:55068133-55068155 GTCTGGTGCCTTGGTGGGGACGG - Intergenic
1159915912 18:74187602-74187624 GTCTGGGGCCTGGGTGGGGAGGG - Intergenic
1161026290 19:2038832-2038854 GTCTCAGGCCTTGGTGTGGAGGG + Exonic
1161118193 19:2511165-2511187 GGCCCGGGCCTTGCTGGGGAGGG - Intergenic
1161173865 19:2828167-2828189 GTCTGGCACCATGCTGGGAATGG + Intronic
1161626632 19:5330763-5330785 GACTCCGGCCCTGCTGGGGAAGG - Intronic
1165427972 19:35756127-35756149 GTTCCTGACCTTGCAGGGGAAGG - Intronic
1167010097 19:46801587-46801609 GGCTGGGACCTTGCTGTGGTAGG - Intergenic
1167510414 19:49892848-49892870 GGCTCTGACCTGGGTGGGGAGGG + Intronic
924988279 2:289466-289488 GGCGCGGTCCTTGCCGGGGAGGG - Intergenic
925292486 2:2756826-2756848 GTCTCTGACCTGCCTGGGAAGGG + Intergenic
929386607 2:41415092-41415114 GTTTCAGACCTTGTTGGGGAAGG - Intergenic
930888747 2:56358435-56358457 GTCTGGGACATTTCTGGAGAAGG - Intronic
930916091 2:56690193-56690215 ATCTCAGATCTTGCTGTGGAGGG - Intergenic
932715638 2:74099439-74099461 GCGTCGGACCTCGCGGGGGAAGG - Exonic
939508701 2:143080060-143080082 GTCTAGTACCTTGGTGCGGATGG - Intergenic
944193502 2:197027980-197028002 TTCTCAGACCTGGCTGGGCACGG - Intronic
944465814 2:199998335-199998357 GCCTCTGACCATGCTGTGGAAGG - Intronic
946040006 2:216775072-216775094 TTCTCTGGCCTTGCTGAGGATGG + Intergenic
948580697 2:238985864-238985886 GTCTCGGAGCTTTCTTGGGAGGG - Intergenic
1168980974 20:2003222-2003244 GTCTGGGGCCTGGCTGGAGATGG + Intergenic
1169023748 20:2349862-2349884 GTCCCTGCCCTGGCTGGGGAGGG - Intergenic
1170298579 20:14856761-14856783 GTCTAGGACCTTGCTGCTCAAGG - Intronic
1171256314 20:23691244-23691266 GGCTCGGACATGTCTGGGGATGG + Intergenic
1175995400 20:62810002-62810024 GTCTCGGACTCAGCTGGGGCAGG + Intronic
1176105101 20:63382187-63382209 ATCTAGGTCCATGCTGGGGACGG + Intergenic
1179303729 21:40136016-40136038 GGCTGGGGCTTTGCTGGGGAGGG + Intronic
1180255099 21:46621487-46621509 GCCCCGGGCCTTGCTGGGGCTGG + Intergenic
1182073865 22:27481558-27481580 CTCCCGGGCCATGCTGGGGACGG - Intergenic
1184654264 22:45933247-45933269 GTCTCGGACCTTGCTGGGGAGGG - Intronic
1185220442 22:49626789-49626811 CTCTCCGACCTTGCTGTGGATGG - Intronic
1185384388 22:50525204-50525226 GGCGCTGGCCTTGCTGGGGAGGG - Intronic
950711865 3:14819030-14819052 CTCTCGGGCCTGGCTGAGGAAGG - Exonic
953255063 3:41282250-41282272 GTCTGGTAGCTTGATGGGGATGG - Intronic
956749906 3:72337093-72337115 GTCGCCGCCCTTGCTGGGGTAGG - Intergenic
961213895 3:125144946-125144968 GCCTCAGAACTTGGTGGGGAAGG - Intronic
962975068 3:140439054-140439076 GTCTCTGATCTTGCTGGTGTTGG - Intronic
963036222 3:141031500-141031522 TTCTGGCACCTTGCTGAGGATGG + Intergenic
966565866 3:181380602-181380624 GTCCAGGAGCTTGCTGGGGGAGG + Intergenic
967817988 3:193815319-193815341 GGCAAGGACATTGCTGGGGAAGG - Intergenic
968904671 4:3445749-3445771 GTCTCTGACTGTGCTGGGGCTGG + Intronic
976837670 4:89393798-89393820 GTCTGGTAGCTTGATGGGGATGG - Intergenic
982899928 4:160985956-160985978 GTCTGGCAACTTGCTTGGGAGGG - Intergenic
986466642 5:8032683-8032705 GTCTAGGCCTTTGCTGGAGAAGG + Intergenic
987195126 5:15518390-15518412 GTTTTGGACCTGGCAGGGGAAGG + Intronic
991427935 5:66510778-66510800 GCCTGGGACCTTGGTGGAGATGG - Intergenic
998147615 5:139739276-139739298 GTGTCGGACTGTGCTGGGGTAGG + Intergenic
1001959654 5:175872404-175872426 GTTTCAAACTTTGCTGGGGAAGG - Intronic
1004463522 6:15861896-15861918 GGTTCAGACCTTGCTGGAGAAGG + Intergenic
1004720377 6:18263959-18263981 GCCTCGGCCCCTGCTGCGGAGGG - Exonic
1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG + Intronic
1012213251 6:96550643-96550665 GGCCAGCACCTTGCTGGGGAAGG - Intronic
1013167689 6:107608373-107608395 GTCCCGGTCCTTTCTTGGGAAGG + Intronic
1016863469 6:148744928-148744950 GTCTCTGAACTTCCTGGGGGTGG + Intergenic
1018452152 6:163919275-163919297 TTCTTGGACCATGCTGGGAATGG - Intergenic
1019607867 7:1919046-1919068 GTCCCTGTCCTTGCTGGGGAGGG - Intronic
1024088366 7:45915852-45915874 CACTCGGTCCATGCTGGGGATGG - Intronic
1024186453 7:46952878-46952900 GTCTCGGACCCTGCAGTGGCAGG - Intergenic
1027473361 7:78599764-78599786 CCCTAGTACCTTGCTGGGGAAGG - Intronic
1035382169 7:158447133-158447155 GGCTCTGTCCTTGCTTGGGAAGG - Intronic
1035575617 8:702869-702891 GTCTCCGTCCTTGCTGCTGAGGG + Intronic
1035663111 8:1362162-1362184 GTCTCGGCACTGGCAGGGGAGGG + Intergenic
1041714628 8:60922549-60922571 GTCTGGGTCCTCGCTTGGGAGGG + Intergenic
1042655880 8:71095972-71095994 GCATCTGACCTTGTTGGGGAGGG + Intergenic
1044873272 8:96641202-96641224 TTCTGTGCCCTTGCTGGGGAGGG + Intergenic
1048971244 8:139645984-139646006 GTGTCTGAGCTTGCTGGGAATGG - Intronic
1050275629 9:3995165-3995187 GTCTTGGCTCTTGGTGGGGAAGG + Intronic
1053002766 9:34586334-34586356 TTCTCTGCCCTGGCTGGGGAGGG - Intronic
1060066002 9:120501683-120501705 GTCTGGTACCTTGTCGGGGATGG - Intronic
1060155741 9:121318665-121318687 GTCTCGGTCCTTCCTGAGGGCGG + Exonic
1061038257 9:128125367-128125389 GGCTCGGACCTTGCTGCAGAAGG + Exonic
1188810731 X:34651388-34651410 GTTTGGCACCTTGGTGGGGAAGG - Intronic
1190878520 X:54476319-54476341 ATCCAGGACCTTGCTGGGTAGGG - Intronic
1191807672 X:65152683-65152705 GTCTGGTAGCTTGATGGGGATGG - Intergenic
1193593388 X:83418521-83418543 ATTTCGGACATGGCTGGGGAGGG + Intergenic
1194694750 X:97032201-97032223 GTTTGGGACCTGGTTGGGGATGG + Intronic
1195849732 X:109270299-109270321 GTCTGGGACTTGGCTGGGCAGGG - Intergenic