ID: 1184659158

View in Genome Browser
Species Human (GRCh38)
Location 22:45957946-45957968
Sequence GCCTCTCTGGACCCTGAATG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 161}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184659143_1184659158 21 Left 1184659143 22:45957902-45957924 CCCAGCCTGTGCCCATCAGCCAG 0: 1
1: 0
2: 6
3: 42
4: 305
Right 1184659158 22:45957946-45957968 GCCTCTCTGGACCCTGAATGCGG 0: 1
1: 0
2: 2
3: 11
4: 161
1184659153_1184659158 -9 Left 1184659153 22:45957932-45957954 CCACCAGGCCCTCAGCCTCTCTG 0: 1
1: 0
2: 9
3: 66
4: 732
Right 1184659158 22:45957946-45957968 GCCTCTCTGGACCCTGAATGCGG 0: 1
1: 0
2: 2
3: 11
4: 161
1184659152_1184659158 -8 Left 1184659152 22:45957931-45957953 CCCACCAGGCCCTCAGCCTCTCT 0: 1
1: 0
2: 7
3: 72
4: 541
Right 1184659158 22:45957946-45957968 GCCTCTCTGGACCCTGAATGCGG 0: 1
1: 0
2: 2
3: 11
4: 161
1184659142_1184659158 22 Left 1184659142 22:45957901-45957923 CCCCAGCCTGTGCCCATCAGCCA 0: 1
1: 0
2: 5
3: 40
4: 360
Right 1184659158 22:45957946-45957968 GCCTCTCTGGACCCTGAATGCGG 0: 1
1: 0
2: 2
3: 11
4: 161
1184659151_1184659158 -7 Left 1184659151 22:45957930-45957952 CCCCACCAGGCCCTCAGCCTCTC 0: 1
1: 0
2: 9
3: 81
4: 770
Right 1184659158 22:45957946-45957968 GCCTCTCTGGACCCTGAATGCGG 0: 1
1: 0
2: 2
3: 11
4: 161
1184659145_1184659158 16 Left 1184659145 22:45957907-45957929 CCTGTGCCCATCAGCCAGCCTGT 0: 1
1: 1
2: 5
3: 34
4: 449
Right 1184659158 22:45957946-45957968 GCCTCTCTGGACCCTGAATGCGG 0: 1
1: 0
2: 2
3: 11
4: 161
1184659149_1184659158 2 Left 1184659149 22:45957921-45957943 CCAGCCTGTCCCCACCAGGCCCT 0: 1
1: 1
2: 9
3: 103
4: 843
Right 1184659158 22:45957946-45957968 GCCTCTCTGGACCCTGAATGCGG 0: 1
1: 0
2: 2
3: 11
4: 161
1184659147_1184659158 9 Left 1184659147 22:45957914-45957936 CCATCAGCCAGCCTGTCCCCACC 0: 1
1: 0
2: 6
3: 84
4: 582
Right 1184659158 22:45957946-45957968 GCCTCTCTGGACCCTGAATGCGG 0: 1
1: 0
2: 2
3: 11
4: 161
1184659150_1184659158 -2 Left 1184659150 22:45957925-45957947 CCTGTCCCCACCAGGCCCTCAGC 0: 1
1: 0
2: 7
3: 60
4: 603
Right 1184659158 22:45957946-45957968 GCCTCTCTGGACCCTGAATGCGG 0: 1
1: 0
2: 2
3: 11
4: 161
1184659141_1184659158 28 Left 1184659141 22:45957895-45957917 CCTCTGCCCCAGCCTGTGCCCAT 0: 1
1: 0
2: 18
3: 120
4: 1182
Right 1184659158 22:45957946-45957968 GCCTCTCTGGACCCTGAATGCGG 0: 1
1: 0
2: 2
3: 11
4: 161
1184659144_1184659158 20 Left 1184659144 22:45957903-45957925 CCAGCCTGTGCCCATCAGCCAGC 0: 1
1: 4
2: 3
3: 40
4: 466
Right 1184659158 22:45957946-45957968 GCCTCTCTGGACCCTGAATGCGG 0: 1
1: 0
2: 2
3: 11
4: 161
1184659146_1184659158 10 Left 1184659146 22:45957913-45957935 CCCATCAGCCAGCCTGTCCCCAC 0: 1
1: 0
2: 1
3: 31
4: 321
Right 1184659158 22:45957946-45957968 GCCTCTCTGGACCCTGAATGCGG 0: 1
1: 0
2: 2
3: 11
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184659158 Original CRISPR GCCTCTCTGGACCCTGAATG CGG Intronic
900562008 1:3311860-3311882 GCCCCTCTGGACCCAGGGTGGGG - Intronic
901438784 1:9264985-9265007 CCCTCTCTGGGGCCTGACTGTGG - Exonic
901680523 1:10910219-10910241 GCTTCTCTGGGCCCTGTTTGGGG + Intergenic
902611402 1:17599644-17599666 GCTTCTCTGGACCAGGAAGGTGG - Intronic
902639994 1:17761022-17761044 CCCTCTCTGGGCCCAGAATGTGG + Intronic
904001640 1:27342174-27342196 GCGTCTCTGGACCCTGGCAGGGG - Intronic
912688413 1:111785265-111785287 GGGTCTCTGGTTCCTGAATGTGG + Intronic
913986432 1:143569994-143570016 GCCTCTCTGGACCAGGCCTGGGG + Intergenic
918493637 1:185109908-185109930 GCCTCCATGGACCCAGAGTGTGG - Intergenic
923132775 1:231091928-231091950 TACGCTCTGGTCCCTGAATGTGG + Intergenic
1062845094 10:697453-697475 GCCTCTCTGGATGCTCACTGAGG + Intergenic
1065592939 10:27284104-27284126 TGCTCTCTGGACCCTGGAAGAGG - Intergenic
1065657429 10:27966182-27966204 TGCTCTCTGGACCCTGGAAGAGG + Intronic
1067429269 10:46232337-46232359 ACCTCTCTGGACCCTGCCTATGG + Intergenic
1069873511 10:71547593-71547615 GCCTCTCTGGCCCTGCAATGTGG - Intronic
1070810905 10:79297768-79297790 GCCTCTCTGGACATTCAAAGGGG + Intronic
1075068264 10:119304027-119304049 GCCTTTCTGGATCCAGAAGGCGG + Intronic
1075125564 10:119696406-119696428 TCCTCTTTAGACCCTGGATGTGG + Intergenic
1076209655 10:128629969-128629991 GCCTCTCGGGTCCCTGAGTCAGG - Intergenic
1076375058 10:129978099-129978121 GCCTTGCTAGACCCTGAATAGGG + Intergenic
1076434065 10:130427565-130427587 GCCTCTCTGGACCTGGATTCTGG - Intergenic
1076634197 10:131872165-131872187 GTCTCTGTGGTCCCTGAAGGCGG + Intergenic
1077018846 11:408556-408578 GCCTCTGTGGACCCAGACGGAGG - Intronic
1077226230 11:1440183-1440205 GCCCCTCAGGACCCTCCATGTGG + Intronic
1077372491 11:2189997-2190019 GCCTCTGTGCACGCTGACTGCGG - Intergenic
1077560782 11:3258830-3258852 GCCTATCTGGGCCGTGAGTGTGG - Intergenic
1077566678 11:3304658-3304680 GCCTATCTGGGCCGTGAGTGTGG - Intergenic
1081800964 11:45859058-45859080 GCCTCTCTGCCACCTCAATGGGG - Intronic
1083378022 11:62242091-62242113 GCCTCCCTGCACTCTGACTGGGG - Intergenic
1085466087 11:76724214-76724236 CCCTCTCAGGAGCCTGAATAAGG + Intergenic
1087006858 11:93479734-93479756 GGCTCTCTGCAGCCTTAATGAGG - Intronic
1089487674 11:118859611-118859633 GCTTCTCAGGAGGCTGAATGAGG - Intergenic
1090803403 11:130188381-130188403 GCCTCTCTGGAACCCTGATGGGG + Intronic
1091225528 11:133954856-133954878 ACCCCTCTGCACCCTGAAAGAGG + Intronic
1091588306 12:1828301-1828323 GCCTCCCTGCAGCCTGAGTGTGG - Intronic
1092106131 12:5922744-5922766 CCCCCTCTGGACCCTGCCTGAGG + Exonic
1095530909 12:43185093-43185115 GCCTCTCTGGGCCTTGAAGATGG - Intergenic
1096618693 12:52848898-52848920 GCCCCTCTGGGCCCGGCATGGGG + Exonic
1097331724 12:58338846-58338868 CCCTCTCTGGAGTCTGAATTGGG - Intergenic
1098189683 12:67935205-67935227 GCCTCCCTGTAAGCTGAATGTGG + Intergenic
1103938629 12:124489891-124489913 CCCTCTCTGGCCCCTGCATAGGG + Intronic
1105684983 13:22771618-22771640 GTTTCTCTGGACTCAGAATGGGG + Intergenic
1106713537 13:32364339-32364361 GCCTCTTGGGACCATGAATGAGG - Intronic
1112286765 13:98111590-98111612 GCCTCTCTGGAGCCTCTAAGAGG - Intergenic
1113603687 13:111589573-111589595 GGCTGCCTGGACCCTGAGTGAGG + Intronic
1124233509 15:27967189-27967211 CCCTCCCTGGACCCTGACTCAGG - Intronic
1124423478 15:29542122-29542144 GCTACTCTGGAGGCTGAATGAGG - Intronic
1130907230 15:88249348-88249370 GCCTCTGGGGACCCTGAATTTGG + Intronic
1133424288 16:5674259-5674281 GCTTCTCTGAACCCTAAATCAGG - Intergenic
1133643486 16:7740672-7740694 CCCTCTCTGGACCTTGAGTGAGG - Intergenic
1133860556 16:9591025-9591047 GCCTCTCTGGAAGATGCATGTGG - Intergenic
1135925630 16:26691282-26691304 GTCTCTCTGGGCCTTGAATGAGG - Intergenic
1140417693 16:74787879-74787901 GCCTTTCTGGAGCTTGAAAGAGG - Intergenic
1141484682 16:84330796-84330818 GGCTGTCTGGAGCCTGAGTGTGG - Intergenic
1141956582 16:87375940-87375962 GCCTCTCTGGCCCCTGCATGTGG - Intronic
1142486844 17:253078-253100 TCCTCTGTGGACCCTGATCGGGG + Intronic
1143681177 17:8477101-8477123 GCCTCTCTGTACCCCGAGCGTGG + Intronic
1148146077 17:45365951-45365973 GCCTCTCTGGATCCTGGGAGTGG + Intergenic
1148913101 17:50953863-50953885 GCCTCCCTGGAGCTTGAAGGAGG - Intergenic
1149456799 17:56794747-56794769 CTCTCTCTGGACCCCAAATGTGG - Intronic
1149519284 17:57306145-57306167 GCCTCTGGGGACGCTGAATCAGG + Intronic
1150259285 17:63774749-63774771 GCCTCTCAGGACCCCAAATTCGG - Intronic
1150289242 17:63972137-63972159 GCCTCCCTGGTCCAAGAATGTGG - Exonic
1150773573 17:68061668-68061690 GCCTCTCCGGACACAGAATGAGG + Intergenic
1152871105 17:82753383-82753405 GCTTCACTGGTCCCTGGATGAGG - Intronic
1153512693 18:5872774-5872796 GCCTTTCTGCACCCTGCAGGAGG - Intergenic
1153684503 18:7532010-7532032 GTCTCTCTGGTCCTTGCATGTGG + Intergenic
1153775938 18:8453953-8453975 GTCTCTCTGGACCCTGGAGCAGG - Intergenic
1156352009 18:36309893-36309915 TCCTCTCATGACCCTGAAAGAGG + Intronic
1159792878 18:72805744-72805766 GCCTGTCTGGACTCTCCATGTGG + Intronic
1160728628 19:630225-630247 GTCTCTCTGGACCCTGAGCCAGG + Intronic
1162178432 19:8848878-8848900 GCTTCTTTGGACCCTGGCTGGGG + Exonic
1163249143 19:16115876-16115898 GCCTCTCTGAACCCAGGGTGGGG - Intronic
1163817431 19:19475421-19475443 CCCTGTCTGGACCCTGACTCTGG - Intronic
1164736472 19:30545048-30545070 CCCTCTGTGGATCCTGAGTGGGG - Intronic
1164763030 19:30742603-30742625 GCCTCTCTGGATCCTTTCTGTGG + Intergenic
1165725420 19:38109526-38109548 CCTTCCCTGGACCCTGACTGAGG - Intronic
926045892 2:9709424-9709446 GCCTCTCAGAACTCTGACTGTGG + Intergenic
926933378 2:18062777-18062799 CCCTCCCTGGATCCTAAATGAGG + Intronic
930651205 2:53966654-53966676 GCCTTTCTGGACCTTTCATGAGG - Intronic
932141329 2:69280871-69280893 GCCACCCTGGAACCTGAATAAGG + Intergenic
934567512 2:95348703-95348725 GCCTCATGGGAGCCTGAATGGGG - Intronic
935874990 2:107496813-107496835 GCTTCTCTGTACCTTGACTGTGG - Intergenic
937990184 2:127657787-127657809 GACTCTCTGGTCCCTGAAGAAGG - Intronic
943343161 2:186705542-186705564 GCATCTCTGACCCCTGAAAGGGG + Intronic
943578893 2:189661655-189661677 GCGCCACTGGACCCTGAAGGTGG + Intronic
943585567 2:189735231-189735253 CACTCTCTGGACCCTGCATTTGG + Intronic
946158799 2:217823570-217823592 GCCTCTCTAGACCCCGGAAGAGG + Intronic
948281387 2:236750188-236750210 GCCTCTCTCCACCCAGCATGGGG - Intergenic
948353611 2:237360314-237360336 GCCTCTTGGGCCCCTGCATGAGG + Intronic
948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG + Intronic
948641281 2:239377466-239377488 GCCTCTCTGGACCCTCCTGGAGG + Intronic
948897098 2:240932683-240932705 TCCTCTCTGCACCTTGAAGGTGG + Intronic
1169060840 20:2659435-2659457 CCCTCTGGGGAACCTGAATGGGG - Intronic
1170003822 20:11645012-11645034 GGCTCTCTGCAGCCTGAAAGAGG + Intergenic
1170649969 20:18230316-18230338 GCCTCTCTGGACCTGGTCTGAGG - Intergenic
1171273461 20:23834707-23834729 CCCTCTCTGGACCCCACATGGGG + Intergenic
1171430787 20:25082121-25082143 GCCTCTCTGGATCCCGTTTGCGG + Exonic
1174683630 20:52432148-52432170 CTCTTTCTGGACCCTGAATATGG - Intergenic
1175258834 20:57662662-57662684 CCCTGTGTGTACCCTGAATGCGG - Intronic
1175960481 20:62634097-62634119 GCCTCTCTCAAGCCTGAATTTGG - Intergenic
1176386560 21:6141003-6141025 CCCTCTGTGGGCCCTGAAGGGGG + Intergenic
1177860423 21:26446429-26446451 TGCTCTCTGGTCCCTGCATGTGG - Intergenic
1178232218 21:30799100-30799122 GCTTCTCTGGAGACTGAGTGAGG + Intergenic
1179736913 21:43397249-43397271 CCCTCTGTGGGCCCTGAAGGGGG - Intergenic
1180996707 22:19969459-19969481 GCCTCCCTGGCCCATGAGTGAGG + Exonic
1181402976 22:22662581-22662603 GCATCTGTGGTCCCTGCATGGGG - Intergenic
1181419905 22:22790491-22790513 GCATCTGTGGTCCCTGCATGGGG - Intronic
1181423953 22:22820787-22820809 GCATCTGTGGTCCCTGCATGGGG - Intronic
1183466136 22:37981309-37981331 GGCTCCCTGGACCCTGGAGGGGG - Intronic
1184659158 22:45957946-45957968 GCCTCTCTGGACCCTGAATGCGG + Intronic
1185218747 22:49618257-49618279 GGCTCTCAGGACTCTGCATGAGG - Intronic
953235491 3:41102821-41102843 GCCTTTCTGAACCCTGAAGCTGG - Intergenic
954543912 3:51416497-51416519 GCCTTTATGGACCCTCATTGGGG - Intronic
955371034 3:58352193-58352215 GCCCTTCTGGAACCTGAAGGAGG - Intronic
957039714 3:75327778-75327800 TTTTCTCTGGACCCTGAATTTGG - Intergenic
966159918 3:176957177-176957199 GCCTCTCTGCACACTGAGTCGGG + Intergenic
967449004 3:189601325-189601347 GCCTCTCTGAACGCTAGATGTGG - Intergenic
968954948 4:3713514-3713536 GGCTCACTGGACCCTGGAGGTGG + Intergenic
969613397 4:8239001-8239023 ACCTCTCTGGGCCCTGGATCCGG - Intronic
971093365 4:23370976-23370998 CCCTCTCAGGACCATGAGTGGGG - Intergenic
974036182 4:56820558-56820580 GCCTCTCTGATCCCTCAATTTGG - Exonic
978116374 4:105024511-105024533 GCATCTCTGGACCCTGGGGGAGG + Intergenic
980153533 4:129078601-129078623 GACTCTGTGGACTCTGAATCTGG + Intronic
981332672 4:143530925-143530947 GCTACTCTAGACGCTGAATGGGG - Intronic
982578760 4:157151878-157151900 GTCTCCCTTGACACTGAATGAGG + Intronic
987807656 5:22791116-22791138 GCCTCTTTGCACACTTAATGTGG + Intronic
988275044 5:29069701-29069723 GCCTCAGTGGACCCTGAATTAGG + Intergenic
988344269 5:30017920-30017942 GCATTCCTGGAGCCTGAATGTGG - Intergenic
990826141 5:59900126-59900148 GCCTCTCTGGAGCCTGAGGCAGG + Intronic
991292059 5:65042722-65042744 TCCTGCCTGGATCCTGAATGGGG - Intergenic
992217029 5:74536308-74536330 GCCTCTCTGCAGCATTAATGTGG - Intergenic
996761797 5:126993481-126993503 GCCTATCTGGAACCTGAAGATGG - Intronic
1002928468 6:1618557-1618579 GCCTCTCTAGGCCCTGCCTGGGG - Intergenic
1004982880 6:21046154-21046176 GCCTCTCTGAACCAAGAATGTGG - Intronic
1005013490 6:21357354-21357376 GCCTCCCTGGATCCTGACGGGGG + Intergenic
1007478233 6:42133417-42133439 GCCTCTGTGGTCCATGCATGTGG - Intronic
1010445283 6:75942579-75942601 GTCTCTCAGGACCCTGGATCCGG - Intronic
1017853091 6:158323010-158323032 GCCTCTCTAAAGCCAGAATGTGG - Intronic
1017962194 6:159232613-159232635 TCCTCTGCGGCCCCTGAATGGGG - Exonic
1018055807 6:160051278-160051300 TTCTCTTTGGAGCCTGAATGAGG + Intronic
1019564180 7:1671420-1671442 GCCTCTTTGGACCCTGGCTTGGG + Intergenic
1020115298 7:5472832-5472854 GCCGTTCTGGACCCTGAACTTGG + Intronic
1022226614 7:28369920-28369942 GCTTCTGTGGAACCTGAATAGGG + Intronic
1024262805 7:47584351-47584373 GCCTCTCTGGATCCCCAATCGGG + Intergenic
1025251871 7:57356864-57356886 GCCTCTCTGGAGGCTGAAGTGGG - Intergenic
1025605751 7:63038852-63038874 GTCTCTCTGGACCTGGAGTGTGG - Intergenic
1026774650 7:73223830-73223852 GCCTCTTTGGAGGCTGAATGGGG + Intergenic
1027015509 7:74777219-74777241 GCCTCTTTGGAGGCTGAATGGGG + Intronic
1027072523 7:75168736-75168758 GCCTCTTTGGAGGCTGAATGGGG - Intergenic
1031965226 7:128023060-128023082 GGCTGGCTGGACCCTGGATGGGG - Intronic
1034678783 7:152912010-152912032 GCCTCCCAGGACCATGGATGAGG + Intergenic
1035295324 7:157864201-157864223 GCCAGGCTGGACCCTGGATGGGG - Intronic
1036103682 8:5816195-5816217 GCCTGTCTTGACCTTGAATCTGG - Intergenic
1039601986 8:38847021-38847043 TCCTCTCTGCACCCTGCCTGTGG - Intronic
1039907759 8:41798690-41798712 GCCTCCCTGGACCCTGGGGGTGG + Intronic
1040657321 8:49526666-49526688 GCTTCTCTGGCCTCAGAATGAGG - Intergenic
1041823163 8:62062782-62062804 GCCTCTCTGGGCACTGGAGGAGG + Intergenic
1043812049 8:84753111-84753133 GCATCAGTGTACCCTGAATGTGG + Intronic
1047024220 8:120809796-120809818 GCCACCCTGGACCCAGAAAGTGG - Intronic
1048297939 8:133228592-133228614 GCCTGTCTGGCCCCTGAGAGTGG + Exonic
1049855246 8:144857597-144857619 GCCACTCTGGAACATGAAAGGGG + Intergenic
1050462166 9:5886232-5886254 GCATCTCTGGCCCCTTCATGAGG + Intronic
1055807755 9:80116166-80116188 GCCTCTCTGGATGCTGGAGGAGG + Intergenic
1059768674 9:117407769-117407791 GCCTCTCTGCCCCCAGAAAGAGG - Intronic
1061044190 9:128155692-128155714 GCTTTTCTGGACTCAGAATGGGG - Intergenic
1061401528 9:130370923-130370945 CCATATCTGCACCCTGAATGTGG + Intronic
1061595203 9:131624480-131624502 CCCTCTATAGACCCTGCATGAGG + Intronic
1061720197 9:132546627-132546649 TCCTCTCTCGACCCTGTAAGTGG - Intronic
1062296103 9:135828045-135828067 GCTTCTCTAGACCCAGCATGTGG + Intronic
1187473794 X:19591772-19591794 CCCTCTCTGCACCCTGAAGTCGG - Intronic
1190794166 X:53725621-53725643 GCATCTGTGTGCCCTGAATGTGG + Intergenic
1191936658 X:66434373-66434395 GGCTCCCTGGACCCTGAGTTTGG + Intergenic
1194606518 X:95985570-95985592 GCCTCTCTGGACACTGAGTGAGG - Intergenic
1201512305 Y:14778423-14778445 GCCTCTCTGGGACTTGCATGGGG + Intronic