ID: 1184659161

View in Genome Browser
Species Human (GRCh38)
Location 22:45957957-45957979
Sequence TGGGCTGTTGCCCGCATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 57}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184659161_1184659166 5 Left 1184659161 22:45957957-45957979 CCCTGAATGCGGGCAACAGCCCA 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1184659166 22:45957985-45958007 GCAGCTCCCACGCAGCGAGAAGG 0: 1
1: 0
2: 0
3: 13
4: 116
1184659161_1184659171 27 Left 1184659161 22:45957957-45957979 CCCTGAATGCGGGCAACAGCCCA 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1184659171 22:45958007-45958029 GTTAAGTGCAGGAGACCTCAGGG No data
1184659161_1184659169 16 Left 1184659161 22:45957957-45957979 CCCTGAATGCGGGCAACAGCCCA 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1184659169 22:45957996-45958018 GCAGCGAGAAGGTTAAGTGCAGG No data
1184659161_1184659170 26 Left 1184659161 22:45957957-45957979 CCCTGAATGCGGGCAACAGCCCA 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1184659170 22:45958006-45958028 GGTTAAGTGCAGGAGACCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184659161 Original CRISPR TGGGCTGTTGCCCGCATTCA GGG (reversed) Intronic
901833977 1:11911841-11911863 TGGGCTCTGGCCCTAATTCACGG - Intergenic
906153560 1:43601397-43601419 TGGGCTGTAGCCCACAGGCACGG - Intronic
908651229 1:66335611-66335633 TGGACTGTGGCCAGCATTAAGGG - Intronic
915078962 1:153338184-153338206 TGGGCTGATGCCTGTATTCCTGG - Intronic
916647091 1:166797105-166797127 TGGGCAGTTGCCGGCATCCAAGG - Intergenic
921179317 1:212619273-212619295 TGGGCTGCTGCCTGGATGCAGGG - Intronic
1075322976 10:121507072-121507094 TTGGCTGTTGCCCACATCGAAGG - Intronic
1078059466 11:8033899-8033921 CTGGCTGTTGCCAGCATTCTAGG + Intronic
1078594475 11:12674645-12674667 TGGGCTGCTGCCCGCGCTCCGGG - Exonic
1080231118 11:30017960-30017982 TGGGCTGTTCCTCGAAGTCAGGG + Intergenic
1083367810 11:62152049-62152071 TGGTCTGTTGCCCTCCTTCTTGG + Exonic
1089389108 11:118087929-118087951 AGGTCTCTTGACCGCATTCATGG + Intronic
1089794887 11:120972300-120972322 TGAGCTCTTGGCGGCATTCATGG + Intronic
1103057774 12:117835206-117835228 TCTGCTGTTGCCCCCTTTCATGG + Intronic
1107786369 13:43961990-43962012 TGGGTTCTTGCCAGCATTCTGGG - Intergenic
1113113931 13:106854680-106854702 TCTGCTGTTGCCCCAATTCACGG - Intergenic
1114577807 14:23729491-23729513 TGGGCTGTTGGCTGCACTCCTGG - Intergenic
1120690826 14:87590529-87590551 TCAGCTGTTGGCCCCATTCAAGG + Intergenic
1121431187 14:93889553-93889575 TGGTCTGTTGCCTGTGTTCAGGG + Intergenic
1126872234 15:53002140-53002162 TGGGCTGTTGCCTCAATTAAAGG + Intergenic
1131399393 15:92112464-92112486 TGGGCTGTGGCCCACACACAGGG - Intronic
1142871748 17:2825767-2825789 GGGTCTGGTGCCCGCATCCAAGG + Intronic
1143003499 17:3811164-3811186 TGGGCTGTTACCAGAATTCCTGG - Intergenic
1145982780 17:29023874-29023896 TGGGCTGCTGCCAGCATCCTAGG - Intronic
1148245577 17:46027786-46027808 TGGCCTGCTGCCCTCTTTCAGGG + Exonic
1152536323 17:80952143-80952165 TGTGCTGTGGTCAGCATTCACGG - Intronic
1152571832 17:81124388-81124410 TGGGGTGTTGGCTGCCTTCACGG - Intronic
1157329973 18:46696519-46696541 TGGGATGGTGCCAGGATTCAAGG - Intronic
1157605772 18:48924999-48925021 TGGGCTGTGGGCCCGATTCAGGG - Intronic
1163133872 19:15295054-15295076 TGGGCTGTTGCCCCCTTTTATGG - Intronic
1163488289 19:17602463-17602485 TGTGCTGTTTCCCCGATTCATGG + Exonic
1164586269 19:29478087-29478109 AGGGCTGCTGCCCGCATTTGTGG - Intergenic
927033449 2:19147318-19147340 TGGCCTGTGTCCCACATTCACGG - Intergenic
928375014 2:30766921-30766943 TGGGCTGTTGCCTGCACCCTTGG + Intronic
936064599 2:109320836-109320858 TGGTCTGGTGCCCGAATCCATGG - Intronic
1174572529 20:51512300-51512322 TGGGCTGATGCCTGGACTCACGG - Intronic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
1178664342 21:34533703-34533725 TGCTCTGTTGCCCACACTCAAGG - Intronic
1180594090 22:16962404-16962426 TGGGCTGTTTCCCTCAATCCTGG - Exonic
1184659161 22:45957957-45957979 TGGGCTGTTGCCCGCATTCAGGG - Intronic
1185292297 22:50033139-50033161 TGGGCTGCTGCCTGCATGCCTGG - Intronic
958526569 3:95268451-95268473 TGGTTTGTTGCACACATTCATGG - Intergenic
978016485 4:103752449-103752471 TGGGCTGCTGCCTCCATTTAGGG - Intergenic
987672974 5:21037036-21037058 TGCTCTGATGCCCACATTCAGGG - Intergenic
988475542 5:31581990-31582012 TGGGATGCTGTCAGCATTCAAGG - Intergenic
990597466 5:57325873-57325895 TGGCCTGTTGCCTGGAGTCAGGG + Intergenic
993250366 5:85513450-85513472 TGGGCTGTTGCACGGGTACATGG - Intergenic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
996990006 5:129617631-129617653 TGGGCTGTAGCCAGAATCCATGG + Intronic
1006735616 6:36270577-36270599 TGGGCTGTTTCCAGCATCCGGGG - Exonic
1018089349 6:160332177-160332199 TGGCACGTTGCCAGCATTCATGG + Intergenic
1031441385 7:121799016-121799038 TGTGGTGGTGCCAGCATTCATGG - Intergenic
1032723441 7:134569564-134569586 TGAGCTGTTGCAGGAATTCAGGG + Intronic
1035518306 8:255400-255422 TTGACTGTTGGCCGCATTCTGGG - Intergenic
1048011667 8:130462070-130462092 TGGAATGTTGCCCCCAATCAAGG - Intergenic
1051819575 9:21149350-21149372 AGTGCTGTTGCCAGCATACAAGG - Intergenic
1061169971 9:128947045-128947067 TGGCCTATTGCCCGCCTCCATGG - Exonic
1062309766 9:135929452-135929474 TGGGGTGGTGCCTGCATTCTGGG - Intergenic
1186123175 X:6384595-6384617 TTGGCTATTGCCGGCATTCCTGG + Intergenic
1192797261 X:74434398-74434420 TGGGCTGTTGCTTGGATTCTGGG + Intronic