ID: 1184663730

View in Genome Browser
Species Human (GRCh38)
Location 22:45976999-45977021
Sequence GGGGTCCACGGTCGCTCAAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 27}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184663730_1184663741 1 Left 1184663730 22:45976999-45977021 CCGGTTGAGCGACCGTGGACCCC 0: 1
1: 0
2: 1
3: 1
4: 27
Right 1184663741 22:45977023-45977045 GCAAGCGCGGGCCGGGGGCCCGG 0: 1
1: 0
2: 1
3: 48
4: 425
1184663730_1184663743 7 Left 1184663730 22:45976999-45977021 CCGGTTGAGCGACCGTGGACCCC 0: 1
1: 0
2: 1
3: 1
4: 27
Right 1184663743 22:45977029-45977051 GCGGGCCGGGGGCCCGGGCGCGG 0: 1
1: 2
2: 23
3: 228
4: 1534
1184663730_1184663744 11 Left 1184663730 22:45976999-45977021 CCGGTTGAGCGACCGTGGACCCC 0: 1
1: 0
2: 1
3: 1
4: 27
Right 1184663744 22:45977033-45977055 GCCGGGGGCCCGGGCGCGGCTGG 0: 1
1: 1
2: 16
3: 166
4: 992
1184663730_1184663736 -5 Left 1184663730 22:45976999-45977021 CCGGTTGAGCGACCGTGGACCCC 0: 1
1: 0
2: 1
3: 1
4: 27
Right 1184663736 22:45977017-45977039 ACCCCTGCAAGCGCGGGCCGGGG 0: 1
1: 0
2: 0
3: 3
4: 69
1184663730_1184663746 14 Left 1184663730 22:45976999-45977021 CCGGTTGAGCGACCGTGGACCCC 0: 1
1: 0
2: 1
3: 1
4: 27
Right 1184663746 22:45977036-45977058 GGGGGCCCGGGCGCGGCTGGCGG 0: 1
1: 1
2: 12
3: 111
4: 922
1184663730_1184663738 -4 Left 1184663730 22:45976999-45977021 CCGGTTGAGCGACCGTGGACCCC 0: 1
1: 0
2: 1
3: 1
4: 27
Right 1184663738 22:45977018-45977040 CCCCTGCAAGCGCGGGCCGGGGG 0: 1
1: 0
2: 0
3: 10
4: 89
1184663730_1184663735 -6 Left 1184663730 22:45976999-45977021 CCGGTTGAGCGACCGTGGACCCC 0: 1
1: 0
2: 1
3: 1
4: 27
Right 1184663735 22:45977016-45977038 GACCCCTGCAAGCGCGGGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 94
1184663730_1184663742 2 Left 1184663730 22:45976999-45977021 CCGGTTGAGCGACCGTGGACCCC 0: 1
1: 0
2: 1
3: 1
4: 27
Right 1184663742 22:45977024-45977046 CAAGCGCGGGCCGGGGGCCCGGG 0: 1
1: 0
2: 3
3: 30
4: 315
1184663730_1184663734 -7 Left 1184663730 22:45976999-45977021 CCGGTTGAGCGACCGTGGACCCC 0: 1
1: 0
2: 1
3: 1
4: 27
Right 1184663734 22:45977015-45977037 GGACCCCTGCAAGCGCGGGCCGG 0: 1
1: 0
2: 1
3: 5
4: 92
1184663730_1184663748 18 Left 1184663730 22:45976999-45977021 CCGGTTGAGCGACCGTGGACCCC 0: 1
1: 0
2: 1
3: 1
4: 27
Right 1184663748 22:45977040-45977062 GCCCGGGCGCGGCTGGCGGGCGG 0: 1
1: 0
2: 4
3: 61
4: 521
1184663730_1184663747 15 Left 1184663730 22:45976999-45977021 CCGGTTGAGCGACCGTGGACCCC 0: 1
1: 0
2: 1
3: 1
4: 27
Right 1184663747 22:45977037-45977059 GGGGCCCGGGCGCGGCTGGCGGG 0: 1
1: 1
2: 10
3: 68
4: 735
1184663730_1184663750 19 Left 1184663730 22:45976999-45977021 CCGGTTGAGCGACCGTGGACCCC 0: 1
1: 0
2: 1
3: 1
4: 27
Right 1184663750 22:45977041-45977063 CCCGGGCGCGGCTGGCGGGCGGG 0: 1
1: 1
2: 2
3: 57
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184663730 Original CRISPR GGGGTCCACGGTCGCTCAAC CGG (reversed) Exonic