ID: 1184670099

View in Genome Browser
Species Human (GRCh38)
Location 22:46007822-46007844
Sequence ACTTCAGGCCGGAGGCTTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184670099_1184670112 23 Left 1184670099 22:46007822-46007844 CCGCCAAGCCTCCGGCCTGAAGT No data
Right 1184670112 22:46007868-46007890 AGGCCCTTGTGCGGTGGCGTCGG No data
1184670099_1184670116 28 Left 1184670099 22:46007822-46007844 CCGCCAAGCCTCCGGCCTGAAGT No data
Right 1184670116 22:46007873-46007895 CTTGTGCGGTGGCGTCGGGCAGG No data
1184670099_1184670110 17 Left 1184670099 22:46007822-46007844 CCGCCAAGCCTCCGGCCTGAAGT No data
Right 1184670110 22:46007862-46007884 CCTGCCAGGCCCTTGTGCGGTGG No data
1184670099_1184670108 14 Left 1184670099 22:46007822-46007844 CCGCCAAGCCTCCGGCCTGAAGT No data
Right 1184670108 22:46007859-46007881 CAGCCTGCCAGGCCCTTGTGCGG No data
1184670099_1184670106 3 Left 1184670099 22:46007822-46007844 CCGCCAAGCCTCCGGCCTGAAGT No data
Right 1184670106 22:46007848-46007870 GCTCCTGTTCTCAGCCTGCCAGG No data
1184670099_1184670113 24 Left 1184670099 22:46007822-46007844 CCGCCAAGCCTCCGGCCTGAAGT No data
Right 1184670113 22:46007869-46007891 GGCCCTTGTGCGGTGGCGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184670099 Original CRISPR ACTTCAGGCCGGAGGCTTGG CGG (reversed) Intergenic