ID: 1184670108

View in Genome Browser
Species Human (GRCh38)
Location 22:46007859-46007881
Sequence CAGCCTGCCAGGCCCTTGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184670097_1184670108 25 Left 1184670097 22:46007811-46007833 CCAGAGTGAGGCCGCCAAGCCTC No data
Right 1184670108 22:46007859-46007881 CAGCCTGCCAGGCCCTTGTGCGG No data
1184670105_1184670108 -9 Left 1184670105 22:46007845-46007867 CCGGCTCCTGTTCTCAGCCTGCC No data
Right 1184670108 22:46007859-46007881 CAGCCTGCCAGGCCCTTGTGCGG No data
1184670100_1184670108 11 Left 1184670100 22:46007825-46007847 CCAAGCCTCCGGCCTGAAGTCCG No data
Right 1184670108 22:46007859-46007881 CAGCCTGCCAGGCCCTTGTGCGG No data
1184670103_1184670108 3 Left 1184670103 22:46007833-46007855 CCGGCCTGAAGTCCGGCTCCTGT No data
Right 1184670108 22:46007859-46007881 CAGCCTGCCAGGCCCTTGTGCGG No data
1184670104_1184670108 -1 Left 1184670104 22:46007837-46007859 CCTGAAGTCCGGCTCCTGTTCTC No data
Right 1184670108 22:46007859-46007881 CAGCCTGCCAGGCCCTTGTGCGG No data
1184670102_1184670108 6 Left 1184670102 22:46007830-46007852 CCTCCGGCCTGAAGTCCGGCTCC No data
Right 1184670108 22:46007859-46007881 CAGCCTGCCAGGCCCTTGTGCGG No data
1184670096_1184670108 30 Left 1184670096 22:46007806-46007828 CCACTCCAGAGTGAGGCCGCCAA No data
Right 1184670108 22:46007859-46007881 CAGCCTGCCAGGCCCTTGTGCGG No data
1184670099_1184670108 14 Left 1184670099 22:46007822-46007844 CCGCCAAGCCTCCGGCCTGAAGT No data
Right 1184670108 22:46007859-46007881 CAGCCTGCCAGGCCCTTGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184670108 Original CRISPR CAGCCTGCCAGGCCCTTGTG CGG Intergenic