ID: 1184670112

View in Genome Browser
Species Human (GRCh38)
Location 22:46007868-46007890
Sequence AGGCCCTTGTGCGGTGGCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184670105_1184670112 0 Left 1184670105 22:46007845-46007867 CCGGCTCCTGTTCTCAGCCTGCC No data
Right 1184670112 22:46007868-46007890 AGGCCCTTGTGCGGTGGCGTCGG No data
1184670103_1184670112 12 Left 1184670103 22:46007833-46007855 CCGGCCTGAAGTCCGGCTCCTGT No data
Right 1184670112 22:46007868-46007890 AGGCCCTTGTGCGGTGGCGTCGG No data
1184670107_1184670112 -6 Left 1184670107 22:46007851-46007873 CCTGTTCTCAGCCTGCCAGGCCC No data
Right 1184670112 22:46007868-46007890 AGGCCCTTGTGCGGTGGCGTCGG No data
1184670100_1184670112 20 Left 1184670100 22:46007825-46007847 CCAAGCCTCCGGCCTGAAGTCCG No data
Right 1184670112 22:46007868-46007890 AGGCCCTTGTGCGGTGGCGTCGG No data
1184670102_1184670112 15 Left 1184670102 22:46007830-46007852 CCTCCGGCCTGAAGTCCGGCTCC No data
Right 1184670112 22:46007868-46007890 AGGCCCTTGTGCGGTGGCGTCGG No data
1184670099_1184670112 23 Left 1184670099 22:46007822-46007844 CCGCCAAGCCTCCGGCCTGAAGT No data
Right 1184670112 22:46007868-46007890 AGGCCCTTGTGCGGTGGCGTCGG No data
1184670104_1184670112 8 Left 1184670104 22:46007837-46007859 CCTGAAGTCCGGCTCCTGTTCTC No data
Right 1184670112 22:46007868-46007890 AGGCCCTTGTGCGGTGGCGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184670112 Original CRISPR AGGCCCTTGTGCGGTGGCGT CGG Intergenic