ID: 1184676846

View in Genome Browser
Species Human (GRCh38)
Location 22:46048039-46048061
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184676846_1184676858 19 Left 1184676846 22:46048039-46048061 CCCACCTCCTAACAAGGCAGCCA No data
Right 1184676858 22:46048081-46048103 ATATATGCTTTGATTTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184676846 Original CRISPR TGGCTGCCTTGTTAGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr