ID: 1184678723

View in Genome Browser
Species Human (GRCh38)
Location 22:46057967-46057989
Sequence CGGGTCCCTTAACCATTCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 14}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184678723 Original CRISPR CGGGTCCCTTAACCATTCGA GGG (reversed) Intronic
903582132 1:24379087-24379109 CAAGTCCCTTAACCTTTCCAGGG - Intronic
912084930 1:105988100-105988122 TGTGTACCTTAACCATTCCAAGG - Intergenic
916845226 1:168643597-168643619 GGGGTCCCTTAACCACTTCATGG - Intergenic
1087989406 11:104729685-104729707 CGGCTCCCTTAACCAGTTGTTGG + Intergenic
1109194664 13:59365051-59365073 CTGTTCCCTTAACCATTTGGCGG + Intergenic
1126801493 15:52301785-52301807 AGAGTGCCATAACCATTCGATGG - Intergenic
1136531742 16:30874696-30874718 CGGGTCTCTGAACCATTCGGAGG + Intronic
947432755 2:230045131-230045153 CGGGCTCCTTACCCATTTGAAGG - Intronic
1184678723 22:46057967-46057989 CGGGTCCCTTAACCATTCGAGGG - Intronic
1185350116 22:50331191-50331213 CGTGTCCATTTACCATTTGAAGG + Intergenic
988525687 5:31985285-31985307 TGGCTCCCTTAATCATTTGAAGG + Intronic
993859504 5:93118198-93118220 GGGGTCACATAACCATTCGATGG + Intergenic
1004100645 6:12606884-12606906 AGGGTCCCTTCAGCAATCGATGG + Intergenic
1027267696 7:76503339-76503361 CGGGGCCCTTTACCATCTGACGG + Intronic
1027319508 7:77003202-77003224 CGGGGCCCTTTACCATCTGATGG + Intergenic
1046380013 8:113437908-113437930 AGGGTCCCTTATACATGCGAAGG - Intergenic
1195800394 X:108702362-108702384 GGGGTCAGTTAACCATTCCAAGG - Intergenic