ID: 1184680765

View in Genome Browser
Species Human (GRCh38)
Location 22:46071259-46071281
Sequence CCCCGCGTGCGCGTCCCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 117}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184680765_1184680772 -5 Left 1184680765 22:46071259-46071281 CCCGCGGGGACGCGCACGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1184680772 22:46071277-46071299 CGGGGCTGCGGGGCGAGGCGCGG 0: 1
1: 1
2: 11
3: 133
4: 1139
1184680765_1184680774 -3 Left 1184680765 22:46071259-46071281 CCCGCGGGGACGCGCACGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1184680774 22:46071279-46071301 GGGCTGCGGGGCGAGGCGCGGGG 0: 1
1: 0
2: 16
3: 89
4: 825
1184680765_1184680773 -4 Left 1184680765 22:46071259-46071281 CCCGCGGGGACGCGCACGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1184680773 22:46071278-46071300 GGGGCTGCGGGGCGAGGCGCGGG 0: 1
1: 0
2: 7
3: 122
4: 1005
1184680765_1184680777 6 Left 1184680765 22:46071259-46071281 CCCGCGGGGACGCGCACGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1184680777 22:46071288-46071310 GGCGAGGCGCGGGGCCCGGGCGG 0: 1
1: 0
2: 9
3: 112
4: 909
1184680765_1184680771 -10 Left 1184680765 22:46071259-46071281 CCCGCGGGGACGCGCACGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1184680771 22:46071272-46071294 GCACGCGGGGCTGCGGGGCGAGG 0: 1
1: 1
2: 6
3: 55
4: 504
1184680765_1184680776 3 Left 1184680765 22:46071259-46071281 CCCGCGGGGACGCGCACGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1184680776 22:46071285-46071307 CGGGGCGAGGCGCGGGGCCCGGG 0: 1
1: 0
2: 14
3: 121
4: 906
1184680765_1184680775 2 Left 1184680765 22:46071259-46071281 CCCGCGGGGACGCGCACGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1184680775 22:46071284-46071306 GCGGGGCGAGGCGCGGGGCCCGG 0: 1
1: 0
2: 27
3: 286
4: 1370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184680765 Original CRISPR CCCCGCGTGCGCGTCCCCGC GGG (reversed) Intronic
900149959 1:1173986-1174008 CCCTGCCTGCGGGTCCCCTCGGG + Intronic
900457798 1:2785882-2785904 CCCCGCCTGGCCGTGCCCGCAGG + Exonic
900633818 1:3652240-3652262 CCCTGCGTGGGCGGCCTCGCCGG + Intronic
901109603 1:6784837-6784859 CCCCGCGTCCGGCTCCCCACCGG + Intergenic
901242863 1:7704951-7704973 CGCCCCGCGCGCGCCCCCGCCGG - Intronic
901526113 1:9824186-9824208 CACCCCAGGCGCGTCCCCGCGGG - Exonic
904751100 1:32741866-32741888 CTCCGGGCGCGCGTCCCCGGCGG + Exonic
921010264 1:211134054-211134076 CCCTGCCTGCGGATCCCCGCCGG - Intronic
1066697940 10:38095015-38095037 CTCCGCGTGCGCGGCCTCACAGG - Intronic
1067474395 10:46556506-46556528 CCCCGCCTGCGCGGCCCCGGCGG - Intergenic
1069695511 10:70382628-70382650 CCCCGCGCGCCCCGCCCCGCCGG - Intronic
1072021719 10:91409857-91409879 CCCCGAGGGCGCTTGCCCGCGGG + Intergenic
1073542678 10:104326001-104326023 CCCCGCGTGTACTTCCCCACCGG - Intronic
1074085611 10:110207463-110207485 CCGCCCCTGCCCGTCCCCGCAGG - Intergenic
1076792923 10:132786253-132786275 CCCCGCCCGCGCGCCCCCGCCGG + Intergenic
1076821621 10:132942594-132942616 CCCCGCGTCCGCGTCCCTTTCGG - Intronic
1076858603 10:133129215-133129237 GCCAGCGTGTGTGTCCCCGCCGG - Exonic
1077301166 11:1847571-1847593 CCCCGCCTGCAGGTCCCAGCCGG + Intergenic
1084070231 11:66728660-66728682 CCCCGCCTTCCCGTCCTCGCTGG + Intronic
1085560999 11:77473331-77473353 CCCCCTGTGCGCGTACCGGCGGG - Intronic
1085666329 11:78418004-78418026 CCCCGCGTCCGCGTGCGCGGCGG - Intronic
1101592834 12:106139011-106139033 CCCCGTCTGCGCGTCCTCCCGGG - Exonic
1103488234 12:121296876-121296898 CGCCCCCTGCGCGCCCCCGCCGG + Intronic
1104358021 12:128105709-128105731 CCCCGTGGGCGCATCCCCGTGGG - Intergenic
1104558123 12:129820441-129820463 CTCAGCGTGCGCATCCCCTCTGG + Intronic
1118874065 14:69767755-69767777 CCTCGCGGGCGCGTCACAGCGGG - Intronic
1123630713 15:22258136-22258158 CCCCGCGCGCGCCCGCCCGCCGG + Intergenic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1127752596 15:62060482-62060504 CGCCGCGCGCGTGACCCCGCCGG + Intergenic
1127753486 15:62068151-62068173 CGCCTCCTGCGCGTCCCCGACGG + Exonic
1127763571 15:62164440-62164462 CGCCTCCTGCGCGTCCCCGACGG - Exonic
1131092028 15:89630493-89630515 CCACGCGTGCCCGTCTCTGCAGG - Exonic
1132398085 15:101489130-101489152 TCCCGCGTGGGCGCCCACGCAGG - Intronic
1132409667 15:101567387-101567409 CCCTGCATGTGGGTCCCCGCGGG - Intergenic
1132519869 16:382043-382065 CCCGGCGTCCGCGCCCCCCCCGG - Intronic
1132522293 16:397333-397355 CCTCCCCTCCGCGTCCCCGCCGG - Intronic
1132579987 16:680358-680380 CCCCACGCGTGCGTCCCCGCTGG + Exonic
1133011024 16:2911968-2911990 GACCGCGCGCGCGACCCCGCCGG - Intronic
1136719751 16:32310538-32310560 AACCGCGCGCGCGCCCCCGCGGG + Intergenic
1139390801 16:66605363-66605385 CCCCGCCGGCTCGGCCCCGCAGG - Intronic
1140462248 16:75148961-75148983 TCCCGCGCGCGCGCGCCCGCCGG - Intronic
1141972338 16:87492443-87492465 CCCCGCGCGCGCCCGCCCGCCGG - Intergenic
1142367438 16:89657541-89657563 CCCCGCGCGCGAGTCCCCGGAGG + Intronic
1203006680 16_KI270728v1_random:207231-207253 AACCGCGCGCGCGCCCCCGCGGG - Intergenic
1203148297 16_KI270728v1_random:1817098-1817120 AACCGCGCGCGCGCCCCCGCGGG + Intergenic
1142631544 17:1229316-1229338 CCCGGCGGGCAGGTCCCCGCGGG + Intergenic
1143321149 17:6070227-6070249 CCCCGCGCGCGTGTTCTCGCGGG + Intronic
1143554496 17:7651880-7651902 CTCCGCCTGCGTGTCCGCGCCGG + Intronic
1143599043 17:7932090-7932112 CCGCGCGTGCGCGGCTCCGGTGG - Intronic
1143750170 17:9021894-9021916 CCCCCCGATCGCGTCCCCGCCGG - Intronic
1147110438 17:38257355-38257377 GGCTGCGTGCGCGGCCCCGCCGG + Intergenic
1147970869 17:44218775-44218797 CGCTGCGTCCGGGTCCCCGCCGG - Intronic
1148419068 17:47531076-47531098 GGCTGCGTGCGCGGCCCCGCCGG - Exonic
1150830318 17:68512687-68512709 CCCGGCGGGCGCCTCCCCGCAGG + Intronic
1151570911 17:74924907-74924929 GCCAGCGTGCGCGTCCCGGTAGG - Exonic
1152541919 17:80981142-80981164 CCCCGCCCCCGCGCCCCCGCGGG + Intergenic
1152628473 17:81399242-81399264 CCTCCCGTTCTCGTCCCCGCGGG - Intronic
1152631103 17:81411040-81411062 GCCCCCGTGCGCCTCCCCTCGGG + Intronic
1154241386 18:12657375-12657397 CCTCCCCTGCGGGTCCCCGCCGG + Intronic
1160719515 19:591028-591050 CCCCGGGCGCGCCTCCTCGCAGG - Intronic
1160823337 19:1068152-1068174 CCCCTCCCGCGCCTCCCCGCAGG + Intronic
1160873259 19:1286399-1286421 CCCCACGCGCGCGCCGCCGCCGG + Intronic
1161160191 19:2757457-2757479 CCCCATGTGCCCTTCCCCGCAGG - Exonic
1161203698 19:3029371-3029393 CCCCGCGCCCGCGCCCCCCCCGG + Intronic
1161468805 19:4446297-4446319 CTGCGCGTGCGCCTCCCCGATGG - Exonic
1162572407 19:11480870-11480892 CGCCCCCTGCGCGGCCCCGCGGG + Exonic
1162810750 19:13163209-13163231 CCCCGCCTCCGCCTTCCCGCTGG - Intergenic
1165477393 19:36039337-36039359 CCCGGCGTGCCCGTGCCAGCAGG + Exonic
1166111917 19:40627776-40627798 CGCTGCGTGCGCGTCCCCGAAGG + Exonic
1168343808 19:55641051-55641073 CCCCGCGTCCCCGGCGCCGCCGG + Intronic
924962411 2:46420-46442 CCACTCGAGCGCGTCTCCGCTGG - Intronic
925725370 2:6865954-6865976 CCCCAGGTGCGCGGCTCCGCGGG + Intronic
926268184 2:11344680-11344702 CCGCCGGCGCGCGTCCCCGCCGG + Intronic
938368811 2:130756198-130756220 CCTCGCCTGCCCGACCCCGCGGG + Intronic
941957079 2:171215818-171215840 CACCGCGTGCATGTACCCGCTGG - Intronic
946621878 2:221571086-221571108 CTCCGCGTCCGCTTCCACGCAGG + Intronic
1168951255 20:1803543-1803565 CGCAGCGTGCCGGTCCCCGCCGG + Intergenic
1170684173 20:18554027-18554049 CCCCGCCTGCGCATTCCCCCAGG - Intronic
1176194447 20:63830935-63830957 CCCCGGGAGGGCGCCCCCGCGGG + Intronic
1176372256 21:6069096-6069118 CCAAGCTTGCGTGTCCCCGCGGG + Intergenic
1176566816 21:8392284-8392306 CCCCGCCTGCGCGCGCCCGCGGG + Intergenic
1179751263 21:43469443-43469465 CCAAGCTTGCGTGTCCCCGCGGG - Intergenic
1179883205 21:44301962-44301984 CCCTGGGTGCCCCTCCCCGCTGG - Intronic
1179968162 21:44818488-44818510 CCCCGCGGACGGGACCCCGCGGG - Intronic
1180650213 22:17370303-17370325 CCCCCCGCGCCCGGCCCCGCCGG - Intronic
1180991787 22:19941588-19941610 CCCCGCGTGGGCACCCCCACGGG + Exonic
1182211354 22:28679848-28679870 AACCGCGCGCGCGCCCCCGCGGG + Exonic
1184384888 22:44168366-44168388 CCCCAGGTGCCTGTCCCCGCAGG + Intronic
1184680765 22:46071259-46071281 CCCCGCGTGCGCGTCCCCGCGGG - Intronic
1184753535 22:46502940-46502962 CCCCGGGAGCAGGTCCCCGCAGG + Intronic
952476714 3:33718066-33718088 CCTCCAGTGCGGGTCCCCGCGGG + Intronic
954408680 3:50359523-50359545 CTGCGCCTGCGCGTCCCCGGCGG + Exonic
960582702 3:119294505-119294527 CCCCGCGTCCGCGTCGTCTCCGG + Exonic
965590591 3:170357506-170357528 CGCCGCGCGCGCGGGCCCGCCGG - Intergenic
966852733 3:184174814-184174836 CCCCGGCTGCGCGTGCGCGCCGG - Intronic
968556661 4:1249228-1249250 CCCCGCAGCCGCGTCCCGGCCGG - Intronic
971196303 4:24473467-24473489 CCCCGCGCGCGTGTCCACGCAGG + Intergenic
972321540 4:37977311-37977333 CCCCGCGGGCGCGACCTCTCGGG + Intronic
972418756 4:38867749-38867771 CCCTCCGGCCGCGTCCCCGCCGG + Intronic
972960813 4:44449111-44449133 CCCTGCCTGCCTGTCCCCGCGGG - Intergenic
976431402 4:84966489-84966511 CGCCGCGTCCTCGTCCTCGCTGG + Intergenic
984771008 4:183436298-183436320 CCCCACCGCCGCGTCCCCGCTGG - Intergenic
991952140 5:71956688-71956710 TCCCGCGTGCCCCTCCCGGCAGG + Intergenic
995106375 5:108381468-108381490 CCCGGCGCGCCCGCCCCCGCCGG - Exonic
997539352 5:134648838-134648860 CCGGGCGTTCGCGGCCCCGCCGG + Exonic
1002046221 5:176543158-176543180 CCCCGCGTGCGTTCCTCCGCCGG + Intronic
1010083100 6:71886717-71886739 CTCCGCCTGCCCGCCCCCGCCGG + Intronic
1013242798 6:108261276-108261298 CACCGCGAGCGCGCCGCCGCGGG + Intergenic
1013459005 6:110357958-110357980 CCCCGCGCGGGCGCCCCCGCCGG - Exonic
1016597104 6:145814868-145814890 GGCGGCGTGCGCGTCCCCGCCGG - Intergenic
1018956407 6:168413217-168413239 CCCCGCGTACACGCTCCCGCAGG - Intergenic
1019379253 7:712592-712614 CCCCCCGACCGCCTCCCCGCGGG + Intronic
1019563578 7:1669356-1669378 CGCAGCCCGCGCGTCCCCGCCGG - Intergenic
1019989592 7:4682410-4682432 CCCCGCGGCCGCACCCCCGCCGG + Exonic
1026522790 7:71131668-71131690 CGCCACCTGCGCGTCCCCTCCGG + Intergenic
1029188528 7:98755918-98755940 GCCCCCCAGCGCGTCCCCGCAGG + Intergenic
1031485326 7:122317021-122317043 CCCCGCGGGCCCTTCCACGCGGG + Intergenic
1034174767 7:149091306-149091328 CCCCGCCTCCGCGTCCCCGGCGG - Intergenic
1034179604 7:149126835-149126857 CCCCTCCTCCGCGTCCCCGACGG - Intronic
1035684738 8:1514932-1514954 CCCTGCGTGCTCCTGCCCGCTGG - Intronic
1049719265 8:144108128-144108150 CCCCGCGCGCCCGCGCCCGCCGG + Exonic
1049843200 8:144787244-144787266 CCCCGCGCGCCCGCCCCCGCCGG + Intronic
1057758526 9:97854763-97854785 CCCCGACGGCGCGTACCCGCAGG + Exonic
1059471209 9:114505675-114505697 CCCCGCGTCCCCTACCCCGCCGG + Intergenic
1061002405 9:127909922-127909944 CCCCGCGTGCCCGGCCTGGCCGG + Intronic
1061583961 9:131554710-131554732 CCCCGCGGCCCCGTCCTCGCTGG - Intergenic
1061608999 9:131733666-131733688 CCCCGCGGCCGCCTCGCCGCCGG - Intronic
1062004923 9:134234267-134234289 CCGCGCCTGGGCTTCCCCGCTGG + Intergenic
1203792624 EBV:159934-159956 CCCCGCCAGCGCCTCCTCGCAGG + Intergenic
1185790706 X:2926969-2926991 CCCCTCGTTCGCGTCCTCCCCGG - Intronic
1187173002 X:16870006-16870028 CCCGGCGCGCGCCGCCCCGCAGG + Intronic