ID: 1184684068

View in Genome Browser
Species Human (GRCh38)
Location 22:46088100-46088122
Sequence CCCCCCACCGTGGTTTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184684068_1184684074 -5 Left 1184684068 22:46088100-46088122 CCCATGGAAACCACGGTGGGGGG No data
Right 1184684074 22:46088118-46088140 GGGGGGGCTCCTCCTGCATTTGG 0: 1
1: 0
2: 0
3: 10
4: 139
1184684068_1184684080 23 Left 1184684068 22:46088100-46088122 CCCATGGAAACCACGGTGGGGGG No data
Right 1184684080 22:46088146-46088168 TGACTGGTTTCCATTAGAGCCGG 0: 1
1: 1
2: 1
3: 7
4: 115
1184684068_1184684077 7 Left 1184684068 22:46088100-46088122 CCCATGGAAACCACGGTGGGGGG No data
Right 1184684077 22:46088130-46088152 CCTGCATTTGGCCCGCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184684068 Original CRISPR CCCCCCACCGTGGTTTCCAT GGG (reversed) Intronic
No off target data available for this crispr