ID: 1184688279

View in Genome Browser
Species Human (GRCh38)
Location 22:46106156-46106178
Sequence GGATTCTCCCCACAGCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 8, 3: 40, 4: 277}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184688270_1184688279 18 Left 1184688270 22:46106115-46106137 CCTGTTTGCGTAACCCGGGAGCA 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1184688279 22:46106156-46106178 GGATTCTCCCCACAGCCCTGGGG 0: 1
1: 0
2: 8
3: 40
4: 277
1184688271_1184688279 5 Left 1184688271 22:46106128-46106150 CCCGGGAGCATTAAAGAGCAGCT 0: 1
1: 0
2: 1
3: 15
4: 153
Right 1184688279 22:46106156-46106178 GGATTCTCCCCACAGCCCTGGGG 0: 1
1: 0
2: 8
3: 40
4: 277
1184688267_1184688279 27 Left 1184688267 22:46106106-46106128 CCAAGCAAGCCTGTTTGCGTAAC 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1184688279 22:46106156-46106178 GGATTCTCCCCACAGCCCTGGGG 0: 1
1: 0
2: 8
3: 40
4: 277
1184688272_1184688279 4 Left 1184688272 22:46106129-46106151 CCGGGAGCATTAAAGAGCAGCTT 0: 1
1: 0
2: 2
3: 8
4: 125
Right 1184688279 22:46106156-46106178 GGATTCTCCCCACAGCCCTGGGG 0: 1
1: 0
2: 8
3: 40
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184688279 Original CRISPR GGATTCTCCCCACAGCCCTG GGG Intronic