ID: 1184688898

View in Genome Browser
Species Human (GRCh38)
Location 22:46108628-46108650
Sequence GCACTCCTGCCAGAATGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 138}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184688887_1184688898 11 Left 1184688887 22:46108594-46108616 CCTGGCCTTTGCACCCCGTGCGC 0: 1
1: 0
2: 0
3: 3
4: 112
Right 1184688898 22:46108628-46108650 GCACTCCTGCCAGAATGGGCTGG 0: 1
1: 0
2: 2
3: 8
4: 138
1184688892_1184688898 -3 Left 1184688892 22:46108608-46108630 CCCGTGCGCACCCTGCAAGGGCA 0: 1
1: 0
2: 1
3: 19
4: 110
Right 1184688898 22:46108628-46108650 GCACTCCTGCCAGAATGGGCTGG 0: 1
1: 0
2: 2
3: 8
4: 138
1184688886_1184688898 12 Left 1184688886 22:46108593-46108615 CCCTGGCCTTTGCACCCCGTGCG No data
Right 1184688898 22:46108628-46108650 GCACTCCTGCCAGAATGGGCTGG 0: 1
1: 0
2: 2
3: 8
4: 138
1184688884_1184688898 25 Left 1184688884 22:46108580-46108602 CCTGGATGCACCTCCCTGGCCTT No data
Right 1184688898 22:46108628-46108650 GCACTCCTGCCAGAATGGGCTGG 0: 1
1: 0
2: 2
3: 8
4: 138
1184688882_1184688898 29 Left 1184688882 22:46108576-46108598 CCTGCCTGGATGCACCTCCCTGG 0: 1
1: 0
2: 6
3: 41
4: 347
Right 1184688898 22:46108628-46108650 GCACTCCTGCCAGAATGGGCTGG 0: 1
1: 0
2: 2
3: 8
4: 138
1184688893_1184688898 -4 Left 1184688893 22:46108609-46108631 CCGTGCGCACCCTGCAAGGGCAC 0: 1
1: 0
2: 0
3: 13
4: 132
Right 1184688898 22:46108628-46108650 GCACTCCTGCCAGAATGGGCTGG 0: 1
1: 0
2: 2
3: 8
4: 138
1184688888_1184688898 6 Left 1184688888 22:46108599-46108621 CCTTTGCACCCCGTGCGCACCCT 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1184688898 22:46108628-46108650 GCACTCCTGCCAGAATGGGCTGG 0: 1
1: 0
2: 2
3: 8
4: 138
1184688885_1184688898 15 Left 1184688885 22:46108590-46108612 CCTCCCTGGCCTTTGCACCCCGT 0: 1
1: 0
2: 2
3: 23
4: 223
Right 1184688898 22:46108628-46108650 GCACTCCTGCCAGAATGGGCTGG 0: 1
1: 0
2: 2
3: 8
4: 138
1184688891_1184688898 -2 Left 1184688891 22:46108607-46108629 CCCCGTGCGCACCCTGCAAGGGC 0: 1
1: 0
2: 3
3: 7
4: 92
Right 1184688898 22:46108628-46108650 GCACTCCTGCCAGAATGGGCTGG 0: 1
1: 0
2: 2
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184688898 Original CRISPR GCACTCCTGCCAGAATGGGC TGG Intronic
900350520 1:2232342-2232364 GGTCTCCTGCCTGAGTGGGCTGG + Intronic
902086839 1:13869123-13869145 TCCCTCCTTCCAGAAAGGGCTGG - Intergenic
904349033 1:29893134-29893156 GCACTACTGCTATGATGGGCAGG + Intergenic
904349053 1:29893238-29893260 GTACTGCTGCCATGATGGGCGGG + Intergenic
905824373 1:41017546-41017568 GCACTCCTGCCAGGCAGTGCTGG - Intronic
907726482 1:57025153-57025175 GCCCTCCTCCGGGAATGGGCAGG + Intronic
908423624 1:63983610-63983632 GCAATCCCTCCAGAATGGTCTGG + Intronic
913403486 1:118462211-118462233 GCCCTGCTGCCAGGAAGGGCAGG + Intergenic
914952232 1:152126413-152126435 GCCCTTCTGTCAGACTGGGCTGG - Intergenic
918283094 1:183024076-183024098 GCACCCCGGCCAGCATGGTCTGG - Exonic
920583840 1:207138212-207138234 GCACTCCTGCCATAGTGGCTGGG + Intronic
921432914 1:215083484-215083506 GCAGTCCTCCCAGAAAAGGCTGG - Intronic
923382924 1:233439717-233439739 GCACAGCTGCCAGAAAGGGGAGG + Intergenic
923453106 1:234138352-234138374 CCTCCTCTGCCAGAATGGGCTGG - Intronic
923519664 1:234725876-234725898 GCATTCCAGCCAGCAAGGGCGGG - Intergenic
1064033069 10:11895010-11895032 GCACGCCAGCCAGAAGGGGGAGG + Intergenic
1066262924 10:33746415-33746437 GCACTCCAGCCAACAGGGGCTGG + Intergenic
1067088486 10:43254952-43254974 GCACTCCTGACACACTCGGCTGG + Intronic
1071474113 10:86010454-86010476 CCACTCCTGCCAACATGGTCTGG - Intronic
1071554455 10:86591705-86591727 GCACTCCTCCCAGGTGGGGCTGG + Intergenic
1071566573 10:86674331-86674353 GCACAGGTGCCAGTATGGGCCGG - Intronic
1072607878 10:96999272-96999294 GGACACCTGCCACATTGGGCAGG + Exonic
1072744662 10:97931765-97931787 GCACTCCCGCCCGCATGAGCTGG - Intronic
1073357545 10:102869439-102869461 GCAAGCCTGCCAGCCTGGGCGGG + Intronic
1073643998 10:105280912-105280934 TGACTCCTTCCAGCATGGGCTGG - Intergenic
1075552638 10:123403320-123403342 TCACTCCTGCCAGGATGCCCAGG + Intergenic
1079248081 11:18767880-18767902 GCACTCCAGCCACACTGGGAAGG + Intronic
1085249271 11:75131481-75131503 GTACTACTGCTGGAATGGGCAGG + Intronic
1085294144 11:75421216-75421238 TTACTCCTGCCATGATGGGCCGG + Intronic
1086911982 11:92483199-92483221 GCACTCCTTCCAGATTGCCCAGG - Intronic
1090466725 11:126941709-126941731 GCAGTCTTCCCAGAGTGGGCTGG + Intronic
1091114317 11:132999142-132999164 GAGCTCCTGCCAGATAGGGCAGG - Intronic
1094852954 12:34390413-34390435 GCATTCCTGCCTCATTGGGCTGG - Intergenic
1094856213 12:34403984-34404006 GAACTCCTGCCACCCTGGGCTGG - Intergenic
1094856997 12:34407294-34407316 GCCTTCCTGCCAGTTTGGGCTGG - Intergenic
1096226448 12:49869541-49869563 GGACTCCTTCCAGATGGGGCTGG + Exonic
1104414318 12:128585291-128585313 ACACTCCTGCAAGAATGGTTGGG - Intronic
1104414328 12:128585356-128585378 ACACTCCTGCAAGAATGGCTGGG - Intronic
1104414338 12:128585421-128585443 ACACTCCTGCAAGAATGGTTGGG - Intronic
1105383704 13:19911089-19911111 GCACTCCAGCCAAAATTAGCTGG - Intergenic
1107776526 13:43849730-43849752 ACACTCATGCCAGCAAGGGCTGG + Intronic
1109170610 13:59092749-59092771 TCACCCCTGCCAAAATGAGCAGG + Intergenic
1115593161 14:34883836-34883858 GCTCTCCTTCCATAATGGCCAGG - Intergenic
1121090376 14:91177337-91177359 GTCCTCCTGCTAGAATGGGCTGG - Intronic
1122695563 14:103550561-103550583 ACACCCCTGCCAGGAAGGGCCGG - Intergenic
1126098244 15:45104302-45104324 GGACTCCTCCCAGAAGGTGCGGG - Exonic
1126105981 15:45147474-45147496 GGACTCCTCCCAGAAGGTGCGGG + Exonic
1127683439 15:61319120-61319142 GCACTCATGCCTGAAATGGCAGG - Intergenic
1129177434 15:73849948-73849970 GGATTCATGCCAGAAAGGGCTGG + Intergenic
1135920001 16:26641330-26641352 GCACTCCAGCCAAAATAGCCTGG - Intergenic
1140089714 16:71827622-71827644 GCACTCCAGCCTGGATGGGTAGG + Intergenic
1142071416 16:88092849-88092871 GCAGGCCTGCAAGAATGGCCAGG - Intronic
1142351386 16:89582415-89582437 GCTCTCCTGCCAGAAAGGGGAGG + Intronic
1142970698 17:3609650-3609672 AGACTCCTGCCAGATGGGGCAGG - Exonic
1143184649 17:5002932-5002954 GCACTCAACCCAGCATGGGCAGG - Intronic
1148804199 17:50256113-50256135 GCATTCCTGCAGGAGTGGGCAGG - Intergenic
1154376742 18:13817129-13817151 GCACTCCACCCAGAGTGGGGAGG - Intergenic
1158108383 18:53911378-53911400 GCACGAGTGCCAGAATGAGCAGG + Intergenic
1159667678 18:71182594-71182616 TCACCCTTGCCAAAATGGGCAGG - Intergenic
1160365479 18:78321839-78321861 GCACTCCTGTGTGACTGGGCTGG + Intergenic
1161405761 19:4090408-4090430 GCACCCCGGCCAGGACGGGCAGG + Exonic
1163521698 19:17795462-17795484 GCGCCCCTCCCAGATTGGGCGGG + Intronic
1167301625 19:48680982-48681004 GCCTTCCTGCCAGAGTGGGTGGG + Intergenic
926137367 2:10346315-10346337 GCCCTCATGCCAGAATTGGGAGG + Intronic
927889405 2:26738882-26738904 GCTCTGCTGCCACAATGGGCTGG + Intergenic
928086843 2:28351212-28351234 TCCCTCCTGCCAGAGGGGGCAGG - Intergenic
929587564 2:43126032-43126054 GCACTGCTGACATATTGGGCTGG + Intergenic
929872250 2:45769017-45769039 GCTCTGCTGCCAAAATGGCCCGG - Intronic
930025374 2:47026195-47026217 GTACTCTTGGCAGGATGGGCTGG - Intronic
930845073 2:55895113-55895135 GCACTCCTTGCAGGATTGGCAGG + Intronic
933083373 2:78023395-78023417 GCACTACTGCCACTAAGGGCTGG - Intergenic
946050772 2:216860539-216860561 GCACTGTTGACACAATGGGCAGG + Intergenic
947801258 2:232929490-232929512 GCCCTGGTGCCAGAACGGGCAGG + Intronic
1168773400 20:430232-430254 GTCCTCCTGCAAGAATGGCCTGG - Intronic
1170451562 20:16489172-16489194 GAACTGCTACCACAATGGGCTGG + Intronic
1172066618 20:32225521-32225543 GCACTCCAGCCAGGGTGGGAGGG - Intronic
1176413932 21:6463949-6463971 GCACGCCTCCCAGAGGGGGCCGG - Intergenic
1179483366 21:41692724-41692746 GCAATCAGGCCAGAATGGTCAGG - Intergenic
1179689430 21:43072271-43072293 GCACGCCTCCCAGAGGGGGCCGG - Intronic
1179828992 21:43984216-43984238 GCACAGCTGCCCGAGTGGGCGGG - Exonic
1180132170 21:45833827-45833849 GCAGTCCTGCCTGCCTGGGCAGG + Intronic
1181361466 22:22340633-22340655 ACACTGCTGCCAGACTGGGTTGG + Intergenic
1183099350 22:35574447-35574469 GCCCTCCTCCCAGAATGTGCTGG + Intergenic
1183229160 22:36570159-36570181 GCCCTCCTGCCAGCAGGGGGAGG + Intronic
1183322725 22:37175027-37175049 GCTCTCCTGCCAGCATGTGAAGG - Intronic
1184688898 22:46108628-46108650 GCACTCCTGCCAGAATGGGCTGG + Intronic
950247145 3:11431364-11431386 GCACTCCAGCCTGCAAGGGCGGG + Intronic
950988756 3:17407832-17407854 GCATTTCTTCCAGCATGGGCTGG - Intronic
951462622 3:22967762-22967784 GCACTTCTCCCAGAATGAGCAGG - Intergenic
955107791 3:55916077-55916099 GCACTCCTCTCAGAATGGCCTGG - Intronic
955543759 3:60005395-60005417 GCTCTCCAGGCAGAAGGGGCTGG - Intronic
963449077 3:145454482-145454504 GCATTACTGCCAGGATGGCCAGG - Intergenic
968768009 4:2484606-2484628 ACACTCCTGCTAGAGTGGGGGGG + Intronic
970590953 4:17560403-17560425 GCCCTCCTTCCAGACAGGGCTGG + Intergenic
970732232 4:19119658-19119680 ACACTCCTGCCAGAACGAGACGG + Intergenic
971785728 4:31099880-31099902 ACCCTCCTACCAGAAGGGGCAGG - Intronic
973705150 4:53573670-53573692 GCAGTGCTCCCTGAATGGGCAGG + Exonic
974372472 4:61035237-61035259 GCACTACTGCCAATTTGGGCTGG - Intergenic
978510988 4:109517847-109517869 GCACTGATGACAGAATGAGCTGG + Intronic
979382705 4:120027332-120027354 GCACTCCTGCCTGGATTGGAAGG + Intergenic
981339478 4:143604174-143604196 CCACTCCTGGCAGAAGGGGAAGG - Intronic
985539022 5:479252-479274 GCCCACCTGCCATAGTGGGCAGG + Intronic
985631076 5:1014415-1014437 GCAGTTGTGCCAGAAAGGGCAGG + Intronic
986038359 5:3962337-3962359 GCACTTCTCCCACCATGGGCTGG - Intergenic
991638275 5:68728148-68728170 GCACTCCAGCAAGAATGGAGAGG + Intergenic
995550625 5:113277502-113277524 GGACTCCTTACAGAAAGGGCAGG - Intronic
996087542 5:119320457-119320479 GCAGTTCTGCCAGAATGGGCAGG - Intronic
997410610 5:133687952-133687974 GCATTCCTGACAAAATGGGAAGG + Intergenic
1002807767 6:593810-593832 TCACTACTGGAAGAATGGGCTGG - Intronic
1003512076 6:6790095-6790117 GCACTCCTGGAAGTATGAGCAGG - Intergenic
1003550952 6:7101557-7101579 GCACTCCAGCCAGAGTGGGCAGG - Intergenic
1005189743 6:23207135-23207157 GGACTCCTGCAAGACTGGGGAGG - Intergenic
1011482442 6:87808741-87808763 CCACTCCACCCAGAAGGGGCAGG - Intergenic
1011759251 6:90542806-90542828 GCACTGCTGCCATTTTGGGCTGG + Intronic
1017563806 6:155662777-155662799 GCACTCCTGGCAGATAGGGTAGG + Intergenic
1017615612 6:156243737-156243759 GAACTCCTGCCACAAAGGACAGG - Intergenic
1019321688 7:418919-418941 GCAGTCCAGCCAGGATGGCCAGG + Intergenic
1019328965 7:453308-453330 GCTCTCCTGGCAGGATGGGGTGG + Intergenic
1019339247 7:500769-500791 GGCCTCCTGCCAGGGTGGGCGGG - Intronic
1023412746 7:39903708-39903730 ACACTCCAGCTAGACTGGGCTGG - Intergenic
1024687404 7:51761308-51761330 GCTCACCTGCCAGCATGGCCTGG - Intergenic
1029370220 7:100145410-100145432 GCACTCTAGCCAGCCTGGGCGGG + Intergenic
1034714489 7:153228611-153228633 GCACTCCAGGCAGAACTGGCTGG - Intergenic
1035344060 7:158186643-158186665 GCGCTCATGCCAGAGGGGGCAGG - Intronic
1035344081 7:158186710-158186732 GCACTCATGCCAGAGGGGGCAGG - Intronic
1036182873 8:6600196-6600218 GCACTCTTGCCAGGATGAGTAGG - Intronic
1036409874 8:8489461-8489483 ACACTCCAGCCAGAAAGGCCAGG - Intergenic
1040492155 8:47934141-47934163 GCACTGCTGCCAGAACATGCTGG + Intronic
1042592118 8:70405723-70405745 GGACTTCTGCCAAAATGGGAGGG - Intergenic
1042620066 8:70694649-70694671 GCACTCCTGGGAGGAGGGGCGGG - Intronic
1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG + Intronic
1046809573 8:118517834-118517856 CTACTACTTCCAGAATGGGCTGG + Intronic
1051236263 9:15002495-15002517 GAACTGCTGCCACAATGGGTGGG + Intergenic
1051488356 9:17633254-17633276 CCACTCCTGCCAAGAAGGGCAGG - Intronic
1053310294 9:37013953-37013975 TCACTCCTGGCAGAATGAGGTGG - Intronic
1053416150 9:37948015-37948037 GCATTTCTGTCAGGATGGGCAGG - Intronic
1053594217 9:39543711-39543733 GCATTCCTTCCAGTGTGGGCTGG - Intergenic
1053851997 9:42298757-42298779 GCATTCCTTCCAGTGTGGGCTGG - Intergenic
1054572036 9:66821246-66821268 GCATTCCTTCCAGTGTGGGCTGG + Intergenic
1055105702 9:72510948-72510970 ACACTGCTACTAGAATGGGCTGG + Intergenic
1057589082 9:96356174-96356196 GCCCTCCTGGCAGAAGGGGAAGG - Intronic
1057971960 9:99567173-99567195 CCACTCCTGGCAGAAGGGGAAGG - Intergenic
1060106369 9:120876052-120876074 GTACTCCTGTGAGACTGGGCAGG + Intronic
1060915355 9:127385710-127385732 CCAGCCCTGCCAGACTGGGCTGG + Intronic
1062151087 9:135019418-135019440 GCTCTCCTGCAAGTCTGGGCTGG - Intergenic
1062454763 9:136630192-136630214 CCACTCCTCCCAGGCTGGGCTGG + Intergenic
1185738610 X:2512444-2512466 ACACACCTGCCAGACTGGGCAGG - Intergenic
1188892349 X:35626193-35626215 ACAGTCCTGTCAGAACGGGCAGG - Intergenic
1200768676 Y:7103516-7103538 GCATTCCTGCTAGAGGGGGCTGG + Intergenic