ID: 1184689934

View in Genome Browser
Species Human (GRCh38)
Location 22:46112901-46112923
Sequence CCTTGGCAGCAGTCGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184689921_1184689934 14 Left 1184689921 22:46112864-46112886 CCTGGCTGGGAGCGGGCAGGGCC 0: 1
1: 0
2: 4
3: 79
4: 661
Right 1184689934 22:46112901-46112923 CCTTGGCAGCAGTCGGGGGCAGG 0: 1
1: 0
2: 1
3: 12
4: 211
1184689920_1184689934 15 Left 1184689920 22:46112863-46112885 CCCTGGCTGGGAGCGGGCAGGGC 0: 1
1: 0
2: 7
3: 48
4: 517
Right 1184689934 22:46112901-46112923 CCTTGGCAGCAGTCGGGGGCAGG 0: 1
1: 0
2: 1
3: 12
4: 211
1184689928_1184689934 -7 Left 1184689928 22:46112885-46112907 CCAGGTTTGGGGGCAGCCTTGGC 0: 1
1: 0
2: 0
3: 36
4: 242
Right 1184689934 22:46112901-46112923 CCTTGGCAGCAGTCGGGGGCAGG 0: 1
1: 0
2: 1
3: 12
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184689934 Original CRISPR CCTTGGCAGCAGTCGGGGGC AGG Intronic
900147802 1:1166003-1166025 ACCCGGCAGCAGGCGGGGGCGGG + Intergenic
900220089 1:1503762-1503784 CATGGGCAGCAGTGGGGTGCAGG + Intergenic
900337010 1:2169353-2169375 CCCTGGCAGCAGAGAGGGGCTGG - Intronic
900356357 1:2266665-2266687 CCTTGGCTGCAGGCGGGCCCTGG + Intronic
900580760 1:3407501-3407523 GCTGGGCAGGAGTCAGGGGCTGG + Intronic
901205572 1:7493850-7493872 ACGTGGCACCTGTCGGGGGCGGG + Intronic
902194859 1:14790985-14791007 CCTTGGAAGCCAGCGGGGGCCGG - Intronic
902471186 1:16648289-16648311 CCGTGGTAGCAGTCTGCGGCCGG - Intergenic
902487619 1:16759156-16759178 CCGTGGTAGCAGTCTGCGGCCGG + Intronic
902629703 1:17697299-17697321 TCTGGGCAGCAGTGGGAGGCAGG + Exonic
902680943 1:18043308-18043330 CCTTGGCACAAGTCTGGGGATGG - Intergenic
902797772 1:18810438-18810460 CCCTCGCAGCAGGCGGGCGCTGG - Intergenic
903876004 1:26473149-26473171 CTATGGCAGCCGTCGAGGGCGGG - Intronic
904385731 1:30140792-30140814 CCCTGCCAGCAGCCAGGGGCCGG + Intergenic
907320679 1:53600185-53600207 CCCTGGCAGCAGGTGGGGCCAGG + Exonic
908445618 1:64196675-64196697 GCTTGCCAGCAGCCTGGGGCTGG + Intergenic
908773005 1:67613105-67613127 CCTTGACAGCTGTAGGGGTCTGG + Intergenic
910981376 1:92962045-92962067 CCTTGGTGGCGGTCGGGGGAAGG + Intergenic
911084787 1:93967398-93967420 CCCTGGCAGCAGGTGGGGGAGGG + Intergenic
913486027 1:119333512-119333534 ACTTGGTAGCAGTCTGGAGCAGG - Intergenic
915333141 1:155126028-155126050 CCCTGGGAGCAGTCGGCGGGTGG + Intergenic
915341154 1:155177463-155177485 CCTGGGCTGCAGGAGGGGGCAGG + Intronic
920230219 1:204465289-204465311 CATTGGCAACAGTGTGGGGCCGG + Exonic
920315579 1:205073820-205073842 CCTTGGCAGCAGGAAGGGGCTGG - Exonic
920545016 1:206809169-206809191 CCTAGGCAGCAGACCTGGGCTGG + Intronic
920600660 1:207321266-207321288 CCTTGGCAGCACTCAAGCGCGGG + Intergenic
922772905 1:228197954-228197976 ACATGGCAGCTGTTGGGGGCAGG + Intergenic
1063219624 10:3954814-3954836 CCTTGGCAGCAGTGCTGTGCGGG + Intergenic
1064088312 10:12362355-12362377 CCTTGGTATCTGCCGGGGGCTGG + Intronic
1067340846 10:45402248-45402270 CCTTGACAGCAGTGGGTGGCTGG - Intronic
1067830811 10:49610226-49610248 CCCGGGCACCACTCGGGGGCTGG + Intronic
1068613761 10:59089172-59089194 CCTTGGCAGCAGCTGAGGGAAGG + Intergenic
1069616396 10:69809060-69809082 CCTTGGCAGCCAGCTGGGGCAGG - Intronic
1070835677 10:79445612-79445634 CCGGGGCCGCAGTCGGGGGGAGG - Exonic
1071495894 10:86167466-86167488 CCTTGGGAACAGCCAGGGGCAGG - Intronic
1073290449 10:102410736-102410758 CCGTGGCAGGAGCCGGGGGTCGG + Intronic
1077240501 11:1508112-1508134 CCATGGCAGCACCCGGGGTCAGG - Intergenic
1083894608 11:65613811-65613833 CCTTGGCAGCCAGCGGGGGTGGG - Exonic
1085254946 11:75167101-75167123 CCTTGGCAGCTGGAGGGAGCTGG + Intronic
1088145035 11:106666286-106666308 CCTTGCCAGCATTTGGGGTCAGG + Intergenic
1091749026 12:3011110-3011132 CCTTGGGAGCAGACTGGTGCTGG - Intronic
1092197041 12:6555837-6555859 CCATGGCGGCAGGCGGGGCCGGG + Exonic
1095948285 12:47766368-47766390 CCTTGGAAGCTGCCAGGGGCAGG - Intronic
1097812358 12:64032587-64032609 TGTTGTCAGCTGTCGGGGGCAGG - Intronic
1103367594 12:120394540-120394562 CCTTGGCTGCAGCTGGGAGCAGG - Intergenic
1104552751 12:129772487-129772509 CCTTTCCAGGAGTCGTGGGCTGG - Intronic
1105851607 13:24340515-24340537 CCTTCGGGGCAGTCGGGCGCAGG - Intergenic
1111951525 13:94712491-94712513 ACTTGGCAGCACGCGGCGGCGGG - Intergenic
1112061192 13:95741612-95741634 CCTGGGCAGCAGTTGTGGCCTGG + Intronic
1112368312 13:98774026-98774048 CCTTGGCAGAAGTCCAGGGCTGG - Intergenic
1113443133 13:110345436-110345458 CCTGGGAAGCAGTGGGGTGCAGG + Intronic
1114344475 14:21780928-21780950 CCAAGGCAGCAGTAAGGGGCTGG - Intergenic
1119265666 14:73262138-73262160 CTGTGGCACCAGCCGGGGGCAGG + Intronic
1119491268 14:75035750-75035772 CCTGAGCAGCAGTGGAGGGCTGG - Intronic
1120633737 14:86925658-86925680 CCTTGGCAGCATTCTGGGAAGGG + Intergenic
1121418508 14:93795879-93795901 CCATGGCAGCAGCGGGGGCCAGG + Intergenic
1122631925 14:103111215-103111237 CCCTGGCGGGAGTGGGGGGCAGG + Intergenic
1122711778 14:103663747-103663769 CCTAGGATGCAGTTGGGGGCTGG + Intronic
1122767207 14:104080976-104080998 CCGTGGCAGCAGGCCTGGGCAGG - Intergenic
1122846900 14:104505191-104505213 GCCTGGCTGCAGGCGGGGGCCGG - Intronic
1122967283 14:105137286-105137308 CCTTGCCAGCTGTCGGGGTCAGG + Intergenic
1124650267 15:31469135-31469157 CCTGGGCAGAAGTCGGGGGCGGG - Intergenic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131510057 15:93044860-93044882 CCTTGGCAGCAGGCGGTCCCTGG + Exonic
1131514442 15:93067739-93067761 GCTTGGGAAAAGTCGGGGGCCGG + Intronic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1132392442 15:101449080-101449102 CCTTGGCATCCGTGGGGGGCTGG + Intronic
1132559445 16:586772-586794 CCTTGGCAGCAGGCCAGGACTGG + Intergenic
1133207497 16:4242119-4242141 CCGTGGCAGCAGGCGGTGGAGGG + Intergenic
1133237186 16:4392781-4392803 CCTGGGCGGAAGTGGGGGGCAGG + Intronic
1133745384 16:8682598-8682620 GGTTGGCAGGGGTCGGGGGCTGG - Intronic
1137564510 16:49524792-49524814 TCTGGGCAGCAGGAGGGGGCCGG + Intronic
1139418545 16:66833657-66833679 TTTTGGCAGCAGTGGGGGACAGG + Intronic
1144465374 17:15492974-15492996 CCCTGGCAGCAGCCTGGGGCAGG - Intronic
1144672019 17:17138214-17138236 CTCTGGCAGCACTAGGGGGCGGG + Intronic
1146477531 17:33174973-33174995 TTTTGGCAGGAGTAGGGGGCAGG - Intronic
1146887975 17:36485143-36485165 CCTGGGCAGAAGTTGGAGGCTGG + Intergenic
1147188567 17:38725910-38725932 CCATGGCAGAAGTAGGGGGTTGG + Exonic
1148327347 17:46790800-46790822 CCTTGGCAGAAATCAGAGGCCGG + Intronic
1148738831 17:49880563-49880585 CCTCGGCAGCATTCCGGGGGCGG - Intergenic
1151239896 17:72749611-72749633 CCTGGGCAGCAGAGGTGGGCAGG + Intronic
1151291916 17:73156600-73156622 CGTTGGCAGGAGTTGGGGGTGGG - Intergenic
1151313066 17:73305968-73305990 CTCTGCCAGCAGTCGGGGGCAGG + Intronic
1151574511 17:74945654-74945676 CCTTAGCAGCACTCAGGGTCAGG - Intronic
1152037534 17:77882709-77882731 CCTTGACAGCAATCAGGGGAGGG - Intergenic
1152154205 17:78622361-78622383 CCTCTGCAGATGTCGGGGGCAGG - Intergenic
1152154484 17:78623792-78623814 CCTCTGCAGATGTCGGGGGCAGG - Intergenic
1152154805 17:78625955-78625977 CCTTCGCTGGAGTTGGGGGCTGG + Intergenic
1152243063 17:79170207-79170229 CCTTGGCTGCAGTAGGGCTCAGG + Intronic
1152720870 17:81923313-81923335 CCTGGACAGCAGGCTGGGGCGGG - Intronic
1153805212 18:8705056-8705078 CCTTGGGAGCAGGCGCAGGCTGG - Intergenic
1156756287 18:40530742-40530764 CCTTAGCAGCATTCTGTGGCAGG - Intergenic
1157300180 18:46473436-46473458 CAATGGCAGCAGTCCAGGGCAGG - Intergenic
1157492875 18:48136471-48136493 ACTTGGCAAAAGTCGAGGGCCGG - Intronic
1158403133 18:57139132-57139154 CCTTGGCTGGAGGCGGGTGCAGG + Intergenic
1159357822 18:67359142-67359164 CCTTGAAAGCAGCCAGGGGCGGG + Intergenic
1161597205 19:5156581-5156603 CCTTGGCACCAGCCCGGGGAGGG + Intergenic
1163639200 19:18451814-18451836 CTTTGGGTGAAGTCGGGGGCAGG - Intronic
1163723716 19:18910784-18910806 CCTGCACAGCAGTGGGGGGCTGG - Intronic
1163758431 19:19120415-19120437 TCTTGGCAGGAGGCGGGGCCTGG - Intronic
1165892454 19:39122115-39122137 CCTTGTCAGCACTGGGGGCCAGG - Intergenic
1167080401 19:47273603-47273625 CCAGGGCAGTAGTCGGGTGCAGG + Intergenic
1167377465 19:49119622-49119644 CCCTGGCAGCGGCCGGGGCCCGG - Exonic
1167888133 19:52518676-52518698 ACTAGGCAGCAGTGGGGAGCTGG - Intergenic
1167920458 19:52779128-52779150 ACTAGGCAGCAGTGGGGAGCTGG + Intronic
1168243440 19:55098461-55098483 CCTTGGCAGCAGCCATGTGCAGG - Intronic
1168244295 19:55103428-55103450 CCTTGGCAGCAGCCACGTGCAGG + Exonic
1168274459 19:55269428-55269450 TCTGTGCAGCAGTTGGGGGCAGG + Intronic
1202703581 1_KI270713v1_random:5084-5106 CCGTGGTAGCAGTCTGCGGCCGG - Intergenic
926197897 2:10774669-10774691 CCATGGCAGCAGCTGAGGGCTGG - Intronic
926532448 2:14066734-14066756 CCTTGACTGCAGTCAGAGGCTGG - Intergenic
929101948 2:38323861-38323883 GCTTGCCAGCAGTCAGGAGCGGG - Intronic
929691664 2:44079956-44079978 CCTGGCCAGCAGTCCAGGGCTGG + Intergenic
929824782 2:45301774-45301796 ACCTGGCAGCAGCCAGGGGCAGG + Intergenic
932268741 2:70390482-70390504 CCTGGGCAGCAGACTAGGGCTGG + Intergenic
933937635 2:87219186-87219208 CCTTGGGAAGAGTTGGGGGCAGG + Intergenic
935701783 2:105819101-105819123 CCTGGTCGGCAGTCGGGGGTTGG + Intronic
936355504 2:111746587-111746609 CCTTGGGAAGAGTTGGGGGCAGG - Intergenic
937894740 2:126970321-126970343 CATTGCCTGCTGTCGGGGGCAGG - Intergenic
939705507 2:145447739-145447761 CCCTGTCAGCAGTGGGGGGTAGG - Intergenic
942965765 2:181891612-181891634 CGCGGGCAGTAGTCGGGGGCTGG + Intergenic
946180011 2:217943302-217943324 CCTTGGCTGCAGGGAGGGGCTGG - Intronic
947882311 2:233528341-233528363 CCTTGGCAGCAGCCTGGTGTTGG + Intronic
948399547 2:237673694-237673716 CATTGGCAGCAGTGGCGGGGAGG + Intronic
1168782612 20:506522-506544 CATTGGAAGCAGGCAGGGGCAGG - Intronic
1170064780 20:12299327-12299349 CAGTGGCAGCAGCTGGGGGCTGG + Intergenic
1170759874 20:19239850-19239872 CCTTGGCACTAGTCCAGGGCTGG + Intronic
1172601562 20:36187472-36187494 CTTTGGCAGAAGTTGGGGGTTGG + Intronic
1172914692 20:38434870-38434892 CAATGCCAGGAGTCGGGGGCGGG + Intergenic
1173402355 20:42736747-42736769 CCTTGGCAGGGGAAGGGGGCAGG + Intronic
1173923809 20:46765640-46765662 CCTTGGCAGCAGGCGGTGGGAGG + Intergenic
1175544145 20:59767330-59767352 AGTGGGCAGCAGTGGGGGGCTGG - Exonic
1176020935 20:62962042-62962064 CCTCAGCAGCAGATGGGGGCTGG + Intronic
1176249793 20:64115036-64115058 CCTTGGCAGCAGCCAGGAGGGGG + Intergenic
1176344807 21:5733601-5733623 CCTTGGCAGGAGTGGGGGAGAGG + Intergenic
1176351621 21:5854185-5854207 CCTTGGCAGGAGTGGGGGAGAGG + Intergenic
1176500020 21:7590854-7590876 CCTTGGCAGGAGTGGGGGAGAGG - Intergenic
1176539128 21:8131671-8131693 CCTTGGCAGGAGTGGGGGAGAGG + Intergenic
1176558079 21:8314716-8314738 CCTTGGCAGGAGTGGGGGAGAGG + Intergenic
1177115306 21:17078374-17078396 TCTTGGCAGGAGTTGGGGGTGGG + Intergenic
1177801708 21:25834520-25834542 CCTTGGCAGAGATGGGGGGCAGG - Intergenic
1179886628 21:44316929-44316951 ACGTGGCAGCAGTCAGGGCCAGG + Intronic
1180639927 22:17290331-17290353 CCTTGGCTCCAGTCAGAGGCTGG + Intergenic
1180964909 22:19783053-19783075 CCTTGGCTTCATTCAGGGGCTGG - Intronic
1181307618 22:21925926-21925948 CCTGGGCAGCATTCTGGGTCAGG + Intronic
1181383052 22:22522165-22522187 CCTAGGCAGTGGTCAGGGGCTGG + Intergenic
1182073405 22:27478710-27478732 ACTTGGCATCTGTCAGGGGCTGG - Intergenic
1182371568 22:29814821-29814843 CCCTGGCAGCAGCCAGGGTCAGG + Intronic
1182456436 22:30453959-30453981 CCTGGACAGCAGTTGGGGGGAGG - Intronic
1184112629 22:42404160-42404182 CCTTTGCAGAAGTCAGGTGCAGG + Intronic
1184427601 22:44422243-44422265 CCTTGGAAGCAGTGGGCAGCAGG - Intergenic
1184689934 22:46112901-46112923 CCTTGGCAGCAGTCGGGGGCAGG + Intronic
1203244078 22_KI270733v1_random:48026-48048 CCTTGGCAGGAGTGGGGGAGAGG + Intergenic
949917439 3:8975697-8975719 CCTTGGCTGCAGCCTGGGGCAGG + Intergenic
953027444 3:39153264-39153286 CCGCGGCCGGAGTCGGGGGCCGG - Intronic
954298250 3:49685950-49685972 CCGTGGTAGCAGTCTGTGGCGGG + Exonic
954406060 3:50345603-50345625 CCTGGGCAGCAGCCGGGGTGGGG + Exonic
954443766 3:50535761-50535783 CCTTGGGAGCAGGGGTGGGCTGG - Intergenic
954683920 3:52360380-52360402 CCTGGGCAACAGTGGGAGGCTGG + Exonic
958960719 3:100506999-100507021 CATTGGCAGAAGTTGGAGGCTGG + Intronic
960413612 3:117358434-117358456 ACTTGGTAGCTGTGGGGGGCGGG + Intergenic
964248686 3:154684741-154684763 CCTGGACAGGACTCGGGGGCAGG - Intergenic
966212561 3:177468450-177468472 TCTTGGCAGCATTAGGGGGCTGG + Intergenic
968556524 4:1248746-1248768 GCGTGGCCGCGGTCGGGGGCGGG - Intronic
968578659 4:1379536-1379558 CCTTGGCAGCACAGAGGGGCCGG - Intronic
969346753 4:6575107-6575129 CATTGGCTGCGGGCGGGGGCGGG - Intergenic
972985785 4:44762897-44762919 CCTTGGAAGCAGTTGGGAGTAGG + Intergenic
975127431 4:70798411-70798433 CATGGGCAGCAGTCGAAGGCGGG + Intronic
975983465 4:80183817-80183839 CCTCGGCAGCGGGCGGGGGTGGG - Intergenic
976101192 4:81565653-81565675 CCTTGGCCACAGTCCGAGGCTGG + Intronic
978591382 4:110328433-110328455 ACTTGGCAGAAGTCAGGAGCTGG - Intergenic
981760856 4:148192972-148192994 CCTTGCCAGAACTCGGGGGATGG - Intronic
982468337 4:155758842-155758864 CCTTGTCACCAGGCGGGGGCGGG + Intergenic
982762982 4:159309597-159309619 CCTTAGAAGCAGATGGGGGCAGG + Intronic
983998520 4:174214099-174214121 CCTTCTCAGCCGTCGGGTGCGGG + Intergenic
985631510 5:1016415-1016437 CCTTGGCAGCTGGAGGGGGAGGG + Intronic
985780698 5:1869399-1869421 CCTGGGCAGGAGCAGGGGGCAGG + Intergenic
987217563 5:15753118-15753140 CCTAGGGAGCAGGCGGGGGCTGG + Intronic
987770025 5:22289971-22289993 CCTTGACAGCACTCAGTGGCAGG + Intronic
990687081 5:58316641-58316663 CATTGGCTGGAGTAGGGGGCAGG + Intergenic
992191237 5:74294205-74294227 CCTTGGCAGAGGTGGGTGGCAGG - Intergenic
992680906 5:79152146-79152168 CCTTGCCAGCAGTTCGGGGAAGG + Intronic
992995644 5:82329687-82329709 CTTTGGCAGGGGTCGGGGGAGGG + Intronic
994489883 5:100427718-100427740 CCTTGGCAGCAGCAGGAGTCAGG - Intergenic
997207094 5:132056445-132056467 CCTGGGCTGCAGTCTTGGGCTGG + Intergenic
998128272 5:139638363-139638385 TCTGGGCAGCTGTCTGGGGCCGG + Intergenic
1000065489 5:157690362-157690384 CCTCGGAAGTAGTCGAGGGCCGG + Intergenic
1000999547 5:167993036-167993058 CCTGGGCAGCAGGCGGGGCGGGG - Exonic
1003490902 6:6620684-6620706 CCTGGGCAGCTGTCGAGGGGAGG - Intronic
1006473398 6:34240567-34240589 CCTTGGCAGCATCTGGGGGTGGG + Intronic
1009908287 6:69895094-69895116 CTGTGGCAGCAGTCTGTGGCTGG + Intronic
1016697556 6:147015728-147015750 ACTTGACAGAAGTTGGGGGCGGG + Intergenic
1019434955 7:1017799-1017821 CCTTGTGTGCAGTGGGGGGCGGG - Intronic
1019699550 7:2467931-2467953 CCTTGGCAGCAGACGGGTCTTGG + Intergenic
1019761289 7:2814792-2814814 GCTTGGGAGCAGTGCGGGGCAGG - Intronic
1020096875 7:5374365-5374387 CCGCGGCAGCAGCCCGGGGCCGG + Exonic
1022524235 7:31027293-31027315 CTCAGGCAGCAGGCGGGGGCTGG + Intergenic
1023841704 7:44101916-44101938 CCTGGGCTACAGTGGGGGGCTGG - Intergenic
1024249653 7:47496459-47496481 GCTTGGAAGCAGGCGGGGGGAGG + Intronic
1029580991 7:101436440-101436462 CCAGGGGAGGAGTCGGGGGCGGG + Intronic
1032087346 7:128891069-128891091 CGTGGGCAGCCGGCGGGGGCTGG + Exonic
1034198758 7:149267370-149267392 CCTGGGCAGGAGTGGGTGGCTGG + Intronic
1037386931 8:18352846-18352868 CTTTGGCAGTGGTGGGGGGCGGG - Intergenic
1037802683 8:22043988-22044010 CCTTTGAAGCAGTGGGGGGGTGG + Intronic
1045376682 8:101581270-101581292 GTTTGGCAGGAGTTGGGGGCAGG + Intronic
1048271263 8:133029926-133029948 CCCTGGCAGCAGACCGTGGCGGG + Exonic
1048987760 8:139744377-139744399 CCTTCCCAGCAGTCAGGGTCTGG - Intronic
1049685905 8:143939246-143939268 CCTTGGCACCGCTGGGGGGCTGG - Intronic
1055636166 9:78281412-78281434 CCCTGGCAGAAGTCCAGGGCTGG - Intergenic
1056565756 9:87771311-87771333 CCGAGGCAGGAGTTGGGGGCGGG - Intergenic
1057198917 9:93130123-93130145 CCTCAGCAGCACTCGGGGCCTGG + Intronic
1057353664 9:94319064-94319086 CCTGGGCAGCTGTCTGGGGTGGG + Exonic
1057654087 9:96938528-96938550 CCTGGGCAGCCGTCTGGGGTGGG - Exonic
1060799921 9:126537309-126537331 CCTAGGCAGCAGCAGGAGGCTGG - Intergenic
1060895694 9:127215741-127215763 CCTCAGCAGCAGATGGGGGCGGG + Intronic
1061290915 9:129649835-129649857 ACTTGGCATCAGTCGCTGGCAGG + Intergenic
1062558832 9:137130105-137130127 CCTTGGTAGCCGTCCTGGGCTGG + Intergenic
1203654166 Un_KI270752v1:7536-7558 CCTGGGCAGCAGTGCTGGGCAGG + Intergenic
1185722593 X:2394305-2394327 ACTTGGCAGCAGCAGGGAGCTGG + Intronic
1186349620 X:8729282-8729304 CATTTGCAGGAGTTGGGGGCGGG + Intronic
1189251198 X:39601712-39601734 AGTTGCCAGCAGGCGGGGGCTGG - Intergenic
1190496787 X:51034102-51034124 CCTTGGCTGCAATCAGGGCCTGG + Intergenic
1190509182 X:51159835-51159857 CCTTGGCTGCAATCAGGGCCTGG - Intergenic
1195845753 X:109226148-109226170 CACTGGCACCAGTTGGGGGCTGG + Intergenic
1199927189 X:152480065-152480087 GCTTGGCAACATTCAGGGGCTGG + Intergenic