ID: 1184690250

View in Genome Browser
Species Human (GRCh38)
Location 22:46114196-46114218
Sequence GGGCCTTGGTGGCTGCCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184690250_1184690257 11 Left 1184690250 22:46114196-46114218 CCACGGGGCAGCCACCAAGGCCC No data
Right 1184690257 22:46114230-46114252 CTCAGAGCACTGCCAAGTCCTGG No data
1184690250_1184690258 20 Left 1184690250 22:46114196-46114218 CCACGGGGCAGCCACCAAGGCCC No data
Right 1184690258 22:46114239-46114261 CTGCCAAGTCCTGGCTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184690250 Original CRISPR GGGCCTTGGTGGCTGCCCCG TGG (reversed) Intergenic
No off target data available for this crispr