ID: 1184691406

View in Genome Browser
Species Human (GRCh38)
Location 22:46119048-46119070
Sequence CTGGGGGGTCTGGGTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184691397_1184691406 -6 Left 1184691397 22:46119031-46119053 CCTATGGAGCAGCTGGCCTGGGG No data
Right 1184691406 22:46119048-46119070 CTGGGGGGTCTGGGTGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184691406 Original CRISPR CTGGGGGGTCTGGGTGTGGT GGG Intergenic
No off target data available for this crispr