ID: 1184692389

View in Genome Browser
Species Human (GRCh38)
Location 22:46123186-46123208
Sequence CTCTGCAGGCGGCCCTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184692389_1184692406 26 Left 1184692389 22:46123186-46123208 CCCCACCAGGGCCGCCTGCAGAG No data
Right 1184692406 22:46123235-46123257 GCAGAAGGTCGTGTGGCCCGAGG No data
1184692389_1184692399 11 Left 1184692389 22:46123186-46123208 CCCCACCAGGGCCGCCTGCAGAG No data
Right 1184692399 22:46123220-46123242 GCCCCATGCCCGGCTGCAGAAGG No data
1184692389_1184692404 19 Left 1184692389 22:46123186-46123208 CCCCACCAGGGCCGCCTGCAGAG No data
Right 1184692404 22:46123228-46123250 CCCGGCTGCAGAAGGTCGTGTGG No data
1184692389_1184692398 1 Left 1184692389 22:46123186-46123208 CCCCACCAGGGCCGCCTGCAGAG No data
Right 1184692398 22:46123210-46123232 GGAGGGTGCTGCCCCATGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184692389 Original CRISPR CTCTGCAGGCGGCCCTGGTG GGG (reversed) Intergenic
No off target data available for this crispr