ID: 1184694094

View in Genome Browser
Species Human (GRCh38)
Location 22:46130279-46130301
Sequence GGCCCATGCATGCTCCCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184694094_1184694102 16 Left 1184694094 22:46130279-46130301 CCTACAGGGAGCATGCATGGGCC No data
Right 1184694102 22:46130318-46130340 CACCAGCCTGAGAATCACGGAGG No data
1184694094_1184694101 13 Left 1184694094 22:46130279-46130301 CCTACAGGGAGCATGCATGGGCC No data
Right 1184694101 22:46130315-46130337 CCTCACCAGCCTGAGAATCACGG No data
1184694094_1184694103 17 Left 1184694094 22:46130279-46130301 CCTACAGGGAGCATGCATGGGCC No data
Right 1184694103 22:46130319-46130341 ACCAGCCTGAGAATCACGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184694094 Original CRISPR GGCCCATGCATGCTCCCTGT AGG (reversed) Intergenic
No off target data available for this crispr