ID: 1184694701

View in Genome Browser
Species Human (GRCh38)
Location 22:46132953-46132975
Sequence CTCCTCACTCCTGTGCGACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184694696_1184694701 1 Left 1184694696 22:46132929-46132951 CCTAAAGCCACTAGGCCAAAGGG No data
Right 1184694701 22:46132953-46132975 CTCCTCACTCCTGTGCGACGTGG No data
1184694694_1184694701 2 Left 1184694694 22:46132928-46132950 CCCTAAAGCCACTAGGCCAAAGG No data
Right 1184694701 22:46132953-46132975 CTCCTCACTCCTGTGCGACGTGG No data
1184694698_1184694701 -6 Left 1184694698 22:46132936-46132958 CCACTAGGCCAAAGGGCCTCCTC No data
Right 1184694701 22:46132953-46132975 CTCCTCACTCCTGTGCGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184694701 Original CRISPR CTCCTCACTCCTGTGCGACG TGG Intergenic
No off target data available for this crispr