ID: 1184702451

View in Genome Browser
Species Human (GRCh38)
Location 22:46185185-46185207
Sequence GAGTGAAAACAGATGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 371}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184702451_1184702456 24 Left 1184702451 22:46185185-46185207 CCATGTTCCATCTGTTTTCACTC 0: 1
1: 0
2: 1
3: 39
4: 371
Right 1184702456 22:46185232-46185254 TATCTTCCAACCCTTCTATTAGG 0: 1
1: 0
2: 3
3: 15
4: 157
1184702451_1184702453 -4 Left 1184702451 22:46185185-46185207 CCATGTTCCATCTGTTTTCACTC 0: 1
1: 0
2: 1
3: 39
4: 371
Right 1184702453 22:46185204-46185226 ACTCTACTTTCTGTGAGATCAGG 0: 1
1: 0
2: 4
3: 7
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184702451 Original CRISPR GAGTGAAAACAGATGGAACA TGG (reversed) Intronic
903087780 1:20878700-20878722 AAGAGAAAACAGATGATACATGG + Intronic
903537463 1:24076474-24076496 GAAATAAAACAGATGGAACCTGG - Intronic
905291902 1:36927632-36927654 GAGGGAAAAAAGAGGGAAAAGGG + Intronic
905820558 1:40986966-40986988 AACTGGAAACATATGGAACAGGG + Intronic
906259745 1:44377986-44378008 TAGAGAGAACAGATGGAAGATGG + Intergenic
906510582 1:46408433-46408455 GAGGGAAAACACAGGGGACAGGG - Intronic
907029546 1:51157529-51157551 GAGAGGAAACAGCTGGCACAGGG + Intergenic
907454953 1:54569485-54569507 AGGGGAAAACAGAGGGAACAAGG - Intronic
907617151 1:55937274-55937296 GGGTGAAAGGAGATGGGACAGGG - Intergenic
907827260 1:58030745-58030767 GAGTGAACACATATGGAAATAGG + Intronic
907909365 1:58813640-58813662 GAGTGTAGAAAGATGGAAGAAGG + Intergenic
907953331 1:59204972-59204994 AAGAGAAAACAGCTTGAACATGG - Intergenic
908100296 1:60784183-60784205 AATTGTAAACAGAAGGAACAAGG - Intergenic
909127701 1:71695519-71695541 GAGGGAAAACAGTAGGAAAAAGG - Intronic
909219877 1:72943835-72943857 CAGTGAAAACTGCTGGAATATGG - Intergenic
909559497 1:76993820-76993842 AATTGAAAACAGAAGGAATATGG - Intronic
910538341 1:88325608-88325630 GAGTGAAAACAGAAGCTTCATGG - Intergenic
911107982 1:94152362-94152384 GAGTGAGAAAACATGGACCATGG - Intronic
912312501 1:108637872-108637894 GAGTGTAAACTGATGGCTCAGGG - Exonic
912370235 1:109168062-109168084 AAGTGAAGACAGAAGGAACTTGG - Intronic
912749916 1:112278376-112278398 GAGTGAAAATAAAGGAAACATGG + Intergenic
913287257 1:117237944-117237966 GAGTGAAAACAAATGGGAGGTGG - Intergenic
913721269 1:121598389-121598411 CAATGAGAACAGATGGAAAAAGG - Intergenic
916155367 1:161840121-161840143 ATGAGACAACAGATGGAACATGG - Intronic
917040975 1:170806015-170806037 AAATCAAAAAAGATGGAACAAGG + Intergenic
918206672 1:182315632-182315654 AACTCAAAACAGATGGAACAGGG + Intergenic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918769365 1:188534666-188534688 GACTGAAATTAAATGGAACAAGG - Intergenic
919888099 1:201949738-201949760 CACTGAAACCAGATGGTACAGGG - Intergenic
921316034 1:213891941-213891963 GAGTGAAAAGAGATAGCTCAAGG + Intergenic
921567572 1:216738462-216738484 GAGTAAAAACAGATGTGAAATGG + Intronic
922370786 1:224908781-224908803 GAGTAAAAAGAGATAGAAAAAGG - Intronic
923089796 1:230731332-230731354 GTGTGATAACAGATGGAAGGGGG - Intergenic
1062886045 10:1016776-1016798 AAGAGAAAAGAGATGTAACAGGG + Intronic
1062886049 10:1016816-1016838 AAGAGAAAAGAGATGTAACAGGG + Intronic
1062886054 10:1016856-1016878 AAGAGAAAAGAGATGTAACAGGG + Intronic
1062886059 10:1016896-1016918 AAGAGAAAAGAGATGTAACAGGG + Intronic
1062886063 10:1016936-1016958 AAGAGAAAAGAGATGTAACAGGG + Intronic
1063180771 10:3597703-3597725 GAGAGAAGACAGAAGGAAAAGGG + Intergenic
1063282923 10:4650558-4650580 GAGTCAAAACAGATTTCACAGGG + Intergenic
1063311614 10:4957822-4957844 GATGGAAAGCAGATGGAAGATGG - Intronic
1064140902 10:12789379-12789401 GAGTGAAAAGAGCTGCAACAAGG + Intronic
1065021546 10:21506052-21506074 GAGAGAAAACAGAAGATACAGGG + Intergenic
1065805512 10:29390440-29390462 GCGTGGAAGCAGATGGCACAGGG + Intergenic
1067525597 10:47036510-47036532 AAGTGATAACAGATGGGAAAAGG - Intergenic
1067928062 10:50530965-50530987 GACTGAAAACATATTGAGCAGGG + Intronic
1068880883 10:62047730-62047752 GAGTGAAAACAGGTGCATTATGG - Intronic
1069628012 10:69880305-69880327 GAGTCAACACAGAGGGCACAGGG - Intronic
1069878619 10:71578162-71578184 GAGTGAAGGCAGGAGGAACAGGG + Intronic
1071163195 10:82776521-82776543 GAGGGTAAAGAGATGGAAAAAGG - Intronic
1071414488 10:85428491-85428513 CAATGAGAACACATGGAACATGG - Intergenic
1072871878 10:99128628-99128650 CAGTGAGAACACCTGGAACAGGG + Intronic
1072997343 10:100257113-100257135 AAGTGAAAATTGATGGAGCAAGG - Intronic
1073628036 10:105119546-105119568 CTGTGAAAACAGTTGGAACGGGG + Intronic
1073959083 10:108905142-108905164 GAGTAAAAACAGAGAGAAGAGGG + Intergenic
1073959602 10:108911706-108911728 GTGTGTAAACAGATGAAAGATGG - Intergenic
1074324194 10:112431867-112431889 CACTGAAAACAGATGGAGCTAGG - Intronic
1074736632 10:116441251-116441273 GATGGAAAACAGATGGCAGATGG + Intronic
1074736775 10:116443134-116443156 GATGGAAAACAGATGGCAAATGG + Exonic
1075258105 10:120940938-120940960 AAGGGAAAACAGAAAGAACAAGG - Intergenic
1076657360 10:132033603-132033625 GCGTGGAAACAGATGGATGATGG + Intergenic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1079517573 11:21287342-21287364 TTGTGAAAATAGATTGAACAGGG - Intronic
1080308049 11:30858088-30858110 GGGAGAAAACAAATGAAACAGGG - Intronic
1080817114 11:35769238-35769260 GAGTGATCACAGACGGAAAATGG - Intronic
1082631556 11:55548361-55548383 TAGAGAAAACTGATGTAACATGG + Intergenic
1083538019 11:63490072-63490094 GGGTGATAACAGATGGTACTGGG - Intronic
1084144278 11:67255885-67255907 GAATGAAGACACATGGAAAAGGG - Exonic
1084734593 11:71096338-71096360 GATTGAGACCAGTTGGAACATGG + Intronic
1085054985 11:73398234-73398256 GAGTGACACCTGATGGAACCTGG + Intergenic
1087347496 11:96990342-96990364 GTGAAAAAACAGATGGATCAGGG + Intergenic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1089178641 11:116565875-116565897 GAGTGTAAACAACTGGGACAAGG + Intergenic
1090816439 11:130301082-130301104 GGGTGATAACAGATGGTATAAGG + Intronic
1090851665 11:130576043-130576065 GTGTGAAAACAGCTGGCACAGGG - Intergenic
1090989752 11:131805387-131805409 GAATGAAAACAGATCAAACAAGG - Intronic
1091204782 11:133812729-133812751 GTGTAAAAACAGAAGGAAAATGG + Intergenic
1091851068 12:3697277-3697299 GATTGAAAGGAGATGGAATAGGG + Intronic
1091967366 12:4755895-4755917 GAGTGAACACATGTGGAACACGG - Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1093426667 12:19035715-19035737 GAATGAAAACACATGGAGTATGG + Intergenic
1093913280 12:24771541-24771563 GAGTGAAAGCAGTTTGAAAACGG + Intergenic
1094269905 12:28601857-28601879 GAGTGAAAATGGATGTCACATGG - Intergenic
1094479005 12:30865491-30865513 GAATGAAAAAAGCTGCAACAGGG - Intergenic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1094793682 12:33945278-33945300 GAGTGATAACAGATGGATCAGGG + Intergenic
1095104952 12:38222087-38222109 GAGTGATAACAGATGGATCCGGG + Intergenic
1095886124 12:47190342-47190364 GGGTTAGAACAGATGGAACTTGG - Intronic
1096456667 12:51793047-51793069 GATTTAAAACAAATGGATCATGG - Intronic
1096783444 12:54003899-54003921 GAGAGAGAAGAGATGGGACATGG + Intronic
1097410774 12:59250077-59250099 TAGAGAAATCAGAGGGAACATGG - Intergenic
1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG + Intronic
1098829653 12:75345573-75345595 GAGTGAACATAAAGGGAACATGG - Intronic
1100254931 12:92873618-92873640 GACTGAAAACAGATGCCAGATGG + Intronic
1100658346 12:96670843-96670865 AAGAGAAAACAGCTAGAACAAGG - Intronic
1101900085 12:108785445-108785467 GCATGTAAACAGATGGCACATGG - Exonic
1102653549 12:114461172-114461194 GAGTGATGACCAATGGAACATGG + Intergenic
1105847064 13:24302566-24302588 GAGGGGAGAGAGATGGAACAGGG - Intronic
1106352273 13:28943684-28943706 GAGTGAAAACACAGTGAACCAGG + Intronic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1106439890 13:29757020-29757042 GAGAGAGAACAGGTGGACCAGGG - Intergenic
1106988315 13:35383380-35383402 GAGAGTGAACAGATGGAATAGGG + Intronic
1107962189 13:45568322-45568344 AAGTGAAAACAGATGGAAACTGG - Exonic
1108073408 13:46653219-46653241 GGGAGAAAACAGATGCAACCAGG - Intronic
1108575432 13:51786375-51786397 GAGTGAAGACAGATGGGAGAGGG - Intronic
1108694889 13:52894297-52894319 GAATGAAACCATATGGAAGATGG - Intergenic
1110897558 13:80773958-80773980 TACTGAAAATAGATGGAAAAAGG - Intergenic
1112677909 13:101725125-101725147 GAGTGAAAAGAGATAAAGCACGG + Intronic
1113350809 13:109527379-109527401 GAGGGAAAAAAGAAGGAAAAGGG - Intergenic
1113993341 14:16045988-16046010 CAGTGAAAACCAATGAAACAGGG - Intergenic
1114342700 14:21761516-21761538 GAGTGAAAAGAAATGAAAAAAGG + Intergenic
1116528710 14:45939076-45939098 GAATGAGAGCAGATGGAAAATGG - Intergenic
1118139012 14:63059385-63059407 CAGTGGAAACAGATAGAAGATGG + Intronic
1120020144 14:79520488-79520510 CAATGAGAACACATGGAACAGGG - Intronic
1120430323 14:84404938-84404960 GAATCACAACAGATGAAACACGG + Intergenic
1120790772 14:88579542-88579564 GAGTGGAATCAGATGGAGCAGGG + Intronic
1120941447 14:89954372-89954394 GAGAGAAAGGAGATGGAACTTGG + Intronic
1121868720 14:97387407-97387429 GAGTGAAAAGGGATGGCAGAGGG - Intergenic
1124608756 15:31193266-31193288 GAGGGAAAGCAGATGGAAGAGGG - Intergenic
1125301119 15:38253526-38253548 GAGTGAAAAAGGACGGGACAGGG - Intronic
1125442063 15:39713821-39713843 CAGTGAAAACAGCTGGAGCCAGG + Intronic
1126074990 15:44900571-44900593 GAGTGAAAGAAGTTGCAACAAGG - Intergenic
1126083374 15:44987245-44987267 GAGTGAAAGAAGTTGCAACAAGG + Intergenic
1126266574 15:46761958-46761980 GAGAGAAAGAAGATGAAACAGGG + Intergenic
1127892313 15:63264859-63264881 GAACCAAAACAGATGGAACTGGG - Exonic
1128058277 15:64717036-64717058 GAGGGAATACACAGGGAACAGGG - Intergenic
1130112529 15:80977501-80977523 AAGTGGAAACAGAAGGTACAGGG + Exonic
1130764621 15:86857435-86857457 ATGTGAAAACAGATGAAAGAAGG - Intronic
1130929678 15:88414718-88414740 GAGCAAAAACAGATGATACAAGG + Intergenic
1131571771 15:93544793-93544815 GAGTGGAAACAGAGGGGACTAGG - Intergenic
1132932308 16:2464890-2464912 GAGAGAAAACAGAGGGAGCCAGG - Exonic
1133482926 16:6189123-6189145 GCATGACAACAGATGGAAAATGG - Intronic
1134129780 16:11641319-11641341 GAGTAAAGAGAGCTGGAACAAGG + Intergenic
1134864221 16:17590465-17590487 GAGAGAAAACAGAAGCACCAAGG + Intergenic
1135002057 16:18785032-18785054 GCATGCAAAGAGATGGAACAAGG + Intronic
1135273999 16:21095300-21095322 GAGTGAAAACAGTGGGTAAATGG + Intronic
1135588087 16:23686387-23686409 TAGTAAAAATAGATGAAACATGG - Intronic
1136912704 16:34157707-34157729 CAGTGAAAACCAATGAAACAGGG - Intergenic
1138291877 16:55854866-55854888 GACTGAGAACAGAAGGAAGAAGG - Intronic
1139104143 16:63805682-63805704 GAGTGAGAGAAGATAGAACAGGG - Intergenic
1140423617 16:74842020-74842042 AAGAGAACACAGATGAAACAAGG + Intergenic
1142013646 16:87731459-87731481 GGGGGAAAAAAGATGGAAAAAGG + Intronic
1142330268 16:89447610-89447632 GAGTGAGAACAGGTGGAATGTGG - Intronic
1145253557 17:21310411-21310433 GAAGGAAAACAGCAGGAACAAGG - Intronic
1146453713 17:32993857-32993879 GAGGGACAACGGATGGAGCAAGG + Intronic
1146757457 17:35445907-35445929 GAGGGAAAACACATTGAATAGGG + Intronic
1147549185 17:41426675-41426697 GAGGGAAACCAGAAGGACCATGG + Intergenic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1149419801 17:56498899-56498921 GCGTGAAATGAGATGGATCATGG + Intronic
1150869614 17:68892107-68892129 GAGTAACAACAGATGGAACTAGG - Intronic
1150959832 17:69901167-69901189 GACTCAAAAGAGATGGAGCAAGG - Intergenic
1151257832 17:72893160-72893182 GAATGAAAACATATGGACCAGGG + Intronic
1152053230 17:77999170-77999192 GAGAGAAATCAGCTGGAAAAGGG - Intergenic
1153279501 18:3401070-3401092 GATGGAAAACAGATGGCCCAAGG + Intergenic
1154510186 18:15091037-15091059 GCTTGAAAAGAGGTGGAACATGG + Intergenic
1157918433 18:51692427-51692449 GAGAGAAAACATGGGGAACAGGG + Intergenic
1157921492 18:51717614-51717636 GAGTGAAATAAGATAGCACATGG - Intergenic
1159583427 18:70260768-70260790 AAGGGAAAACAGATGGAAAGTGG + Intergenic
1159655367 18:71025964-71025986 TTGTGAAAACAGATGGTTCAAGG + Intergenic
1160898722 19:1415990-1416012 TAGGGAAAAAAGAAGGAACAGGG + Intronic
1161412941 19:4126954-4126976 TAGGCAAAACAGAAGGAACATGG - Intergenic
1162109616 19:8393078-8393100 GAAGGAAAACAAATGGCACACGG - Intronic
1163962920 19:20714112-20714134 CAATGAGAACACATGGAACAGGG + Intronic
1165374336 19:35431249-35431271 GAGGGAAAACACATGGTGCAGGG - Intergenic
1165765755 19:38350000-38350022 GAGAGAAAATGGAAGGAACAAGG - Intronic
1166212740 19:41317746-41317768 GGATGAAAACAGAAGGAAGATGG + Intronic
1167692409 19:50994502-50994524 GATTGAAGACAGCTGGAACAGGG + Intergenic
924998949 2:388459-388481 GAGTGAAAGAAGGTGGGACAAGG - Intergenic
925036262 2:688802-688824 GAGAGAACACAAATGGACCACGG + Intergenic
925532564 2:4881045-4881067 AATTGTAAACAAATGGAACATGG - Intergenic
925960649 2:9012151-9012173 GAATGAGAAAAGATAGAACAGGG - Intergenic
927995217 2:27480414-27480436 GAGCAAAAAAATATGGAACAAGG + Intronic
928093948 2:28392798-28392820 GAGTGAATCCACATGGTACAGGG + Intronic
928239636 2:29575348-29575370 GAATAAAAACAGATGAAACCTGG - Intronic
928334497 2:30384787-30384809 AAGGGAAATCAGATGGAAAAGGG + Intergenic
928494129 2:31814197-31814219 TGGTGAAAACTAATGGAACAAGG - Intergenic
928646782 2:33362624-33362646 AAGTTAACACAGATGGAAAATGG - Intronic
929198174 2:39207799-39207821 GAGTAAAAACAATTGGAACCTGG + Intronic
929655229 2:43724274-43724296 GAGTGAGCATAGATGGAAGAAGG + Intronic
930685186 2:54300207-54300229 GAGTGGTAATTGATGGAACAAGG - Intronic
935358456 2:102226694-102226716 GAGGGAAAACGGAGGGAAGAAGG + Intronic
936308314 2:111361776-111361798 GACTGAGAACACATGGAACCAGG - Intergenic
936914042 2:117621672-117621694 GAAAGAAAACAGATGAAAGAAGG - Intergenic
937699713 2:124850599-124850621 GAGACAAAACAGATGGTAAATGG + Intronic
937838630 2:126500670-126500692 GAGTGAAAATAAATGAAATATGG + Intergenic
938387017 2:130873826-130873848 GGATGAAATCAGATGGACCAGGG - Intronic
938505408 2:131875475-131875497 GCTTGAAAAGAGGTGGAACATGG + Intergenic
938538338 2:132264858-132264880 CAGTGAAAACCAATGAAACAGGG + Intergenic
938563328 2:132494397-132494419 ATGAGAAAACAGAAGGAACAAGG - Intronic
939412693 2:141851096-141851118 GACTGAAAACAACTAGAACAAGG - Intronic
939696915 2:145337648-145337670 GAGGGAAAACAGAGGGGACCTGG - Intergenic
940405133 2:153292700-153292722 CAGGGAAAAGAGATGGAACCAGG + Intergenic
941743224 2:169058747-169058769 CAATGAAAACAGATGGACCCAGG + Intergenic
942212865 2:173688997-173689019 GGGAGAAAAGAGAGGGAACATGG + Intergenic
942716146 2:178894650-178894672 GAATGAAAACAAAGGGAAAAAGG + Intronic
944308771 2:198208456-198208478 GAGTGTTTACAGATGGTACATGG + Intronic
944907306 2:204275333-204275355 GACTGAACAGAGATGGCACATGG + Intergenic
944928935 2:204496192-204496214 GAGATAAAAGAGATGGAGCAGGG - Intergenic
945160324 2:206883945-206883967 GAGAGAAAATAGAAGGACCAGGG - Intergenic
946472356 2:219974018-219974040 GAGTAAATACAGAAGGAAAATGG - Intergenic
946672389 2:222119475-222119497 CAATGAGAACACATGGAACATGG - Intergenic
946978148 2:225176012-225176034 GAGTGAAAAGAAATGGAGGATGG + Intergenic
947041484 2:225926281-225926303 GAGTGATGAGAGATGGAACAAGG + Intergenic
947142832 2:227035202-227035224 GAATGAAAAAATATGGAACAAGG + Intronic
947367956 2:229416154-229416176 GAGTGAAAAGACAGGAAACATGG - Intronic
947996838 2:234534996-234535018 GAGTGAAACCAGAAGGGAGAGGG - Intergenic
948259805 2:236595233-236595255 GAGAAAAAACAGATGCAGCACGG + Intergenic
948298951 2:236887762-236887784 GAGTGAAGGCAGGGGGAACACGG + Intergenic
1168919533 20:1519888-1519910 GAGTGAAATCTGATAGAACTTGG + Intergenic
1169597339 20:7215248-7215270 GAGTGAAAGAATATGGAACAAGG - Intergenic
1169930348 20:10826095-10826117 GGGTGACAACAGATGAAACGTGG - Intergenic
1170010835 20:11721896-11721918 AAGCAAAAGCAGATGGAACAAGG + Intergenic
1171370883 20:24661358-24661380 GAGGGAAAACCGAGGGAAGAGGG + Intronic
1171811680 20:29749870-29749892 CAGTGAAAACCAATGAAACAGGG + Intergenic
1171867238 20:30496655-30496677 CAGTGAAAACCAATGAAACAGGG + Intergenic
1171907991 20:30915851-30915873 CAGTGAAAACCAATGAAACAGGG - Intergenic
1171948972 20:31404117-31404139 GAATGGAAAGAGATGGAGCAAGG + Intergenic
1173689534 20:44949498-44949520 GAGAGGAAGCAGAGGGAACATGG + Intronic
1175189450 20:57201342-57201364 GACACAAAACACATGGAACAAGG + Intronic
1175626063 20:60489162-60489184 GAGTGGACACAGATGTGACATGG + Intergenic
1175655427 20:60765771-60765793 GAGTGATAAGGGATGGAACCAGG + Intergenic
1175760080 20:61556543-61556565 AATTGAGAACAAATGGAACAAGG + Intronic
1175840775 20:62025819-62025841 GACAGAAAGCAGATGGGACAAGG + Intronic
1176787685 21:13278395-13278417 GCTTGAAAAGAGGTGGAACACGG - Intergenic
1177059619 21:16354507-16354529 AAATGAAAACAGATGGTACAGGG - Intergenic
1177548870 21:22595409-22595431 GAGTGAGAAAAGAGGGAATAAGG + Intergenic
1177986850 21:27986850-27986872 GCTTGAAAAGAGGTGGAACATGG - Intergenic
1179638640 21:42732035-42732057 GAAGAAAGACAGATGGAACACGG - Intronic
1180116657 21:45710890-45710912 GAGAGAAAAAAAATGCAACATGG - Intronic
1180313927 22:11261525-11261547 CAGTGAAAACCAATGAAACAGGG + Intergenic
1181506459 22:23361582-23361604 GACTGAGAACAGAAGGAAGAAGG - Intergenic
1182792658 22:32965992-32966014 GATTAAAAACAGATGGAATCTGG - Intronic
1182842074 22:33399219-33399241 GAGTGAGAACAGGTGGTACTTGG + Intronic
1184335491 22:43850590-43850612 GAGGGAGAGCAGAGGGAACAGGG - Intronic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
949237414 3:1826652-1826674 CAGGGAAAACACATAGAACAGGG - Intergenic
949411435 3:3769383-3769405 GAGAGAATAGAGATGGAAAAGGG - Intronic
949681193 3:6516397-6516419 GAGTAACAACAGATGGAAACAGG + Intergenic
949920582 3:8997014-8997036 GAAAGAAAACAGGAGGAACAGGG + Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
950465479 3:13150904-13150926 GTGTGAAAGCAGATGGTCCAGGG + Intergenic
952018311 3:28986160-28986182 AAGTGAAAACAGTGGTAACAAGG - Intergenic
952388064 3:32857163-32857185 GAAGTAAAACAGAGGGAACAGGG - Intronic
954390553 3:50266053-50266075 GAGTGAACACAGGTGGAGGAAGG + Intergenic
956534694 3:70262794-70262816 GAGAGGAGAGAGATGGAACATGG - Intergenic
956958093 3:74364574-74364596 GAGAGAACACAGATAGAAAATGG - Exonic
959030507 3:101294286-101294308 CAGTGAGAACACATGGAAAAAGG - Intronic
960169968 3:114448452-114448474 GAGGGCAAACAGATGGATCAAGG + Intronic
961495395 3:127287727-127287749 GAGAGAAAAAAGATGGAGGATGG + Intergenic
961517894 3:127449847-127449869 GTTGGAAAAAAGATGGAACAGGG + Intergenic
961559190 3:127717205-127717227 GAGGGGAAACAAGTGGAACATGG - Intronic
961662241 3:128475543-128475565 GGGTGCAAACAGAGGGAAGAAGG + Intergenic
961728208 3:128946820-128946842 TAGTGAAATCAGATGCACCAAGG + Intronic
962205190 3:133428440-133428462 GAGTGAATGCACATGGAACGTGG + Intronic
963244917 3:143048888-143048910 AAGTGAAAATAGATGGAAAAAGG + Intronic
963509926 3:146234537-146234559 GAGAGAAAAAAAAGGGAACAGGG - Intronic
964828748 3:160859587-160859609 GAGTGAATACAGCTAGACCAGGG - Intronic
965023136 3:163261165-163261187 AAGTGATAACAGATGGTAGAAGG - Intergenic
965117368 3:164508486-164508508 GAGAGAAAACAGAAGAAAGAAGG - Intergenic
965307224 3:167081414-167081436 GTGGGAAAAGAGAAGGAACAGGG + Intergenic
965413781 3:168366724-168366746 GAGAGAAAAAAAATGGAAGATGG + Intergenic
965939289 3:174158139-174158161 GAGTGAAAACACACTTAACAAGG - Intronic
968425561 4:520711-520733 GAGTGGAAAGAGACAGAACAGGG + Intronic
970154245 4:13125516-13125538 GAATGAAAATATTTGGAACATGG + Intergenic
971216333 4:24665545-24665567 GAGGGAAAAGAGAAAGAACAAGG - Intergenic
971279088 4:25226504-25226526 GAGTTAATACAGACGAAACAAGG - Intronic
971761398 4:30770768-30770790 CAGTTATAACAAATGGAACACGG - Intronic
972115692 4:35630893-35630915 TTGTGAAAACTGATGGAACTTGG + Intergenic
973733901 4:53851167-53851189 GGGTGAAAACAGATGGGACTGGG - Intronic
973824800 4:54694104-54694126 GAGTGAAACCAGATCCATCAAGG - Intronic
974306142 4:60142751-60142773 GAGTCCATACAGATGGAACCTGG + Intergenic
974331773 4:60489017-60489039 GAGTGTAAACAGGTTCAACACGG + Intergenic
974997780 4:69183537-69183559 CAGTGAAAACACATGGAAACAGG - Intronic
976275266 4:83270363-83270385 GAGTGGTAACAGAAAGAACATGG - Intronic
977073344 4:92421368-92421390 GAGGAAATACAGATGGAAAAAGG + Intronic
977272263 4:94931798-94931820 GATGGAAAACAGATGAGACAGGG - Intronic
978479912 4:109177158-109177180 AAGACAAAAAAGATGGAACATGG + Intronic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
978493996 4:109339834-109339856 AAGTGATGACAGATGGAAAATGG + Intergenic
978795117 4:112701153-112701175 GAGGGAAAATAGATGATACAGGG + Intergenic
979069830 4:116187961-116187983 CAGTGAAAACAAATGCATCATGG + Intergenic
979545855 4:121939227-121939249 GAGTGAAAAGAAAAGGATCATGG + Intronic
980904921 4:138939007-138939029 TGGTGACAACAGATGGAACAAGG + Intergenic
981348879 4:143705130-143705152 GTGTGAAAAAAGAGGGAAGAGGG + Intergenic
982597193 4:157401539-157401561 GAGGGAAAACAGAAGGCAAATGG + Intergenic
982828206 4:160026996-160027018 GAGTGAAAATAGATGGTAGCTGG - Intergenic
983217647 4:165017021-165017043 TAGTGAGGACAGATGGGACAGGG - Intergenic
983289328 4:165782002-165782024 GAGCGAAACCAGATGAATCAAGG - Intergenic
984930480 4:184842777-184842799 GAAAAAAAACAGATGGATCATGG + Intergenic
986750743 5:10785412-10785434 CAGGGGAAACAGATAGAACAGGG + Intergenic
988104190 5:26722396-26722418 GAGTTAAAACAGATAGAAATAGG - Intergenic
988219028 5:28317338-28317360 GAGTGAGAACATATGGCACTTGG + Intergenic
988652694 5:33170598-33170620 GAGTGACAACAGATTTCACATGG - Intergenic
989310417 5:40010666-40010688 GAGTGAAAGAAGATGGAAACAGG + Intergenic
989698139 5:44228440-44228462 GAGTGGAGACAGTTGGAAAAGGG + Intergenic
990032475 5:51278406-51278428 CAATGAGAACACATGGAACAGGG - Intergenic
990724596 5:58739932-58739954 GAGAGGAAAGAGATGTAACAAGG + Intronic
990791712 5:59488082-59488104 GGGTGAAAACTGAGGGAACTAGG - Intronic
992948781 5:81836252-81836274 GCGTGAAAACTGAAGGAACATGG - Intergenic
993660791 5:90631658-90631680 GAGTGGAAAGATAGGGAACACGG + Intronic
994740551 5:103612323-103612345 GAGTGAAAAAGGATGGACTATGG - Intergenic
994901676 5:105780742-105780764 GAGATAAAACATATGCAACAAGG - Intergenic
995174106 5:109154247-109154269 GTATGAAAACTGAAGGAACAGGG + Intronic
995727416 5:115196041-115196063 CAGTGAAAATAGATGGCACACGG + Intergenic
996341433 5:122443418-122443440 GAGAGAAATTTGATGGAACATGG - Intronic
996475442 5:123914602-123914624 AAGTGAGAACATATGGTACATGG - Intergenic
998965710 5:147538468-147538490 CAGAGAAAACAGAATGAACATGG - Intergenic
999648966 5:153746949-153746971 GAGTGGAATCAGATGGATCTGGG + Intronic
1001098628 5:168795939-168795961 GAGTAAAAAGAGATGGACCATGG + Intronic
1001472880 5:172027524-172027546 GAGGGAAAAAAGATGGGAAAAGG - Intergenic
1002363291 5:178690865-178690887 GAGTGCAGACCAATGGAACAAGG + Intergenic
1002823546 6:752279-752301 GAGTGAGAACAGATAGATTAGGG + Intergenic
1003411640 6:5868782-5868804 CAGTCAAAACAGATTGACCAAGG + Intergenic
1005221203 6:23590989-23591011 AAGTTGTAACAGATGGAACAGGG - Intergenic
1005582226 6:27246255-27246277 GAGTGACAACAGAAGGATCAGGG + Intergenic
1005771616 6:29078854-29078876 CAATGAGAACACATGGAACAGGG + Intergenic
1005995428 6:30928225-30928247 GAGGGAAAAAGGATAGAACAAGG + Intergenic
1007041527 6:38726759-38726781 GTGAGTAAAGAGATGGAACAAGG + Intronic
1009512241 6:64567985-64568007 GTGGGAACACAAATGGAACATGG + Intronic
1010514737 6:76759577-76759599 AACTGAAGACTGATGGAACAAGG - Intergenic
1010613332 6:77983587-77983609 GGGTAAAAACAGATGGGAAAGGG - Intergenic
1011982427 6:93398596-93398618 AAAAGAAATCAGATGGAACAGGG + Intronic
1013614874 6:111833509-111833531 GAGTGAAAACAGAGAGAAACGGG + Intronic
1014472623 6:121835100-121835122 CAGAGAAAACAGCAGGAACAAGG - Intergenic
1014500555 6:122183713-122183735 GAGAGAAATCAAATAGAACATGG + Intergenic
1014939982 6:127426543-127426565 GAAAGTAAACAGATGGAAAAAGG + Intergenic
1015505844 6:133986914-133986936 GAGTGAGAAGAGTTGGAAAAGGG - Intronic
1015713627 6:136167816-136167838 GAGTGGATACAAAAGGAACAAGG + Intronic
1015798598 6:137037883-137037905 GAGTGAAAATTGAAGGATCAAGG + Intronic
1016644095 6:146384062-146384084 GAGAGAAAACAAATGGAGCTTGG + Intronic
1017702884 6:157092941-157092963 GAGTGAAAACAAACAGAACGAGG - Intronic
1018832141 6:167451336-167451358 GAGTGAAAAGAGCTGGGACTTGG + Intergenic
1018862011 6:167717821-167717843 GAGACAAGGCAGATGGAACAAGG + Intergenic
1019583845 7:1785135-1785157 GAATGAAAAAATATGGTACAGGG - Intergenic
1021772365 7:24018229-24018251 GAGGGAAAACAGATGTAAATAGG - Intergenic
1022857495 7:34329802-34329824 GAGGGAATACACATGGAGCATGG + Intergenic
1023284853 7:38608435-38608457 CAGTGAAAAAAGGTGGAAGAAGG - Intronic
1023744517 7:43310363-43310385 GTATGAAAATAGATGGACCATGG - Intronic
1027497036 7:78900640-78900662 GAGTGACAACAGTTGGCATAGGG - Intronic
1027607170 7:80314827-80314849 GAGTCAAAAGAGATGAAAGAAGG - Intergenic
1027665158 7:81035700-81035722 CAGAGAAAACAGATTGAATATGG + Intergenic
1028203666 7:87992226-87992248 CAGAGGAAAGAGATGGAACAAGG + Intronic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1028720209 7:94021753-94021775 GACTGAAAACAGATGAAAAAAGG - Intergenic
1030891343 7:115002988-115003010 GACTGAAAAGTGAGGGAACAGGG - Intronic
1031286443 7:119875526-119875548 CAGAGAAATCAGATTGAACACGG - Intergenic
1031865478 7:127034524-127034546 GAGGGAAAAGGGAAGGAACAGGG - Intronic
1033015283 7:137664688-137664710 GAGAGAAAACAGACAGAACCAGG + Intronic
1033549274 7:142431814-142431836 CAGTAAGAACAGATGGAACTGGG + Intergenic
1034135977 7:148770350-148770372 GAGTGAAGGCAGATGCAACGTGG - Intronic
1034220297 7:149439205-149439227 GATTGAAGACAGATGGGAAAAGG - Intronic
1034375039 7:150634839-150634861 CAATGAGAACACATGGAACAGGG - Intergenic
1034582126 7:152053295-152053317 TAATGAATACAGATGGATCACGG - Intronic
1035689532 8:1550715-1550737 GAGTGAAATCACATAAAACAGGG - Intronic
1036960105 8:13235558-13235580 AAATGAAAACAGATGAGACATGG + Intronic
1037093249 8:14948861-14948883 GAGAGAAAAAAGCTGTAACAGGG - Intronic
1038061378 8:23917598-23917620 CAGTGACAACAGAGGAAACAAGG - Intergenic
1038815250 8:30896333-30896355 GAGTGAAAATAGATGAAAAATGG - Intergenic
1039407712 8:37327230-37327252 AGTTGTAAACAGATGGAACAAGG - Intergenic
1041606109 8:59784169-59784191 GAGTGAGAAAAGATGGGACGTGG - Intergenic
1042129815 8:65577003-65577025 GAAAGTAAACAGATGGAAAAAGG - Intergenic
1042456540 8:69011461-69011483 GAGAGAAAAAAGACAGAACAAGG - Intergenic
1042678523 8:71351226-71351248 GAGGGAAAACAGTTGAAAGACGG + Intronic
1043261709 8:78208373-78208395 GAGTAAAAACAGAAGCAGCATGG + Intergenic
1043662883 8:82767877-82767899 GAGTGAATATCCATGGAACAAGG + Intergenic
1043730125 8:83667588-83667610 GAGTGAGAAAAAATGGAAGAGGG + Intergenic
1044082183 8:87898860-87898882 GATTCAAAACCTATGGAACATGG - Intergenic
1045891306 8:107161040-107161062 CAATGAAAAAAGATGGAAGAAGG - Intergenic
1047217888 8:122893414-122893436 GAGGGAGAAGAGATGGAAAAAGG - Intronic
1047685217 8:127298411-127298433 GAGTATAACCAAATGGAACATGG - Intergenic
1048599214 8:135901077-135901099 GAGTGAAAAAAGTTGGATCATGG + Intergenic
1048778119 8:137970105-137970127 GAGTAAAAACAGATGGTAGAGGG + Intergenic
1048905354 8:139082426-139082448 GAGTCAGAACAGAAAGAACATGG + Intergenic
1049922477 9:378272-378294 GAGTGAAAACCGACAGAATAGGG + Intronic
1050193914 9:3059971-3059993 GCTTGAAGACAGAGGGAACAAGG + Intergenic
1051035188 9:12736053-12736075 GAGTGCAAGCAGATGGAATTGGG - Intergenic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1052698604 9:31910597-31910619 GAGTCAAAGCAAATAGAACAAGG - Intergenic
1055187945 9:73478647-73478669 GAGTTATGAGAGATGGAACAGGG - Intergenic
1056298773 9:85220812-85220834 GAGTGGAAACAGGTGGATGAAGG + Intergenic
1056946971 9:91005811-91005833 GAGAGAAGATAGATGGCACATGG + Intergenic
1058078403 9:100674225-100674247 GGGTGAAAACAGATGGAAAGGGG + Intergenic
1058469314 9:105260942-105260964 TATTGAATACATATGGAACAGGG + Intronic
1058747271 9:108003784-108003806 GAGTGACAACTTAAGGAACATGG + Intergenic
1060551094 9:124485829-124485851 GAGCGAAGGCAGATGGGACAGGG - Intronic
1186419908 X:9417344-9417366 GGGTGAAGAAAGATGGAACAAGG - Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1187736703 X:22312174-22312196 GAGGGAAGACAAATGGAAGAAGG + Intergenic
1188237231 X:27745388-27745410 GAGTGAAAACACAATTAACAAGG - Intronic
1188306754 X:28568599-28568621 CAGTGAAGACAGATGAATCAGGG - Intergenic
1188758167 X:33990033-33990055 GAGGGAAAGCAAATGGAAAACGG + Intergenic
1188999976 X:36933552-36933574 GAGTGAAAACAGGAGGAAAAAGG - Intergenic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1190320124 X:49175156-49175178 GAGTGGAAACAGCTGGGGCAAGG + Exonic
1190707561 X:53043419-53043441 GAGAGAAGACAGGGGGAACAAGG - Intergenic
1192463431 X:71337535-71337557 CAGTGAAAGCAGTGGGAACAGGG - Intergenic
1193563314 X:83047157-83047179 GAGTGAACACAGATGGTAGCAGG - Intergenic
1194280261 X:91943114-91943136 GAGGATAAACAGTTGGAACATGG + Intronic
1194979728 X:100428061-100428083 GAGTGAGAATAGATGAAAAAGGG + Intergenic
1195295357 X:103471189-103471211 GAGTGAATACACAAGGAAAATGG + Intergenic
1195558096 X:106250335-106250357 GAGTAACAACAGATGCAAGAAGG - Intergenic
1197816275 X:130501834-130501856 GGGAGAAGACAGATGGAAGAAGG - Intergenic
1197905136 X:131416714-131416736 GTGTGAGATTAGATGGAACAGGG + Intergenic
1199376595 X:147118917-147118939 GAATGAGATCAGATGGAACTTGG + Intergenic
1199680836 X:150223577-150223599 GAGAGAAAAGAGAAGGAACATGG + Intergenic
1200597738 Y:5166608-5166630 GAGGATAAACAGTTGGAACATGG + Intronic
1200944157 Y:8815732-8815754 GAAGGAAAACTGATGGAACAGGG - Intergenic
1201076015 Y:10188615-10188637 CAGTGAAAACCGATGAAACAGGG - Intergenic
1202263529 Y:22994374-22994396 GAGTGAAAACACCTAGAAAATGG - Intronic
1202416519 Y:24628115-24628137 GAGTGAAAACACCTAGAAAATGG - Intronic
1202454268 Y:25041971-25041993 GAGTGAAAACACCTAGAAAATGG + Intronic