ID: 1184707392

View in Genome Browser
Species Human (GRCh38)
Location 22:46224058-46224080
Sequence TTGTGGGTGTGGGTGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 995
Summary {0: 1, 1: 0, 2: 7, 3: 94, 4: 893}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184707392_1184707399 -6 Left 1184707392 22:46224058-46224080 CCCTCTTCCACCCACACCCACAA 0: 1
1: 0
2: 7
3: 94
4: 893
Right 1184707399 22:46224075-46224097 CCACAAAGCCAGAGCACCGCAGG 0: 1
1: 1
2: 0
3: 11
4: 173
1184707392_1184707401 9 Left 1184707392 22:46224058-46224080 CCCTCTTCCACCCACACCCACAA 0: 1
1: 0
2: 7
3: 94
4: 893
Right 1184707401 22:46224090-46224112 ACCGCAGGTACCAGTTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184707392 Original CRISPR TTGTGGGTGTGGGTGGAAGA GGG (reversed) Intronic
900005866 1:50498-50520 GTGTGTGTGTGTGTGTAAGAGGG + Intergenic
900195780 1:1374895-1374917 TTGTGGGTTGGGGTGGCGGAGGG - Exonic
900981391 1:6048078-6048100 TTGGGGATGTGAGTGGGAGAGGG - Intronic
901133655 1:6979078-6979100 TTGTTGGTGTGGCTGGAGGAGGG + Intronic
901421314 1:9153095-9153117 ATGTGGGTGTGGGGGCATGAAGG + Intergenic
901453057 1:9347874-9347896 CTGTGGGTGTGTGTTGAAGGGGG - Intronic
901597470 1:10396918-10396940 TTGTGTGTGTGTGTGTGAGATGG - Intergenic
902319884 1:15654272-15654294 GAATGGGTGTGGGTGGCAGATGG + Intronic
902684854 1:18069497-18069519 TTGTGTGTGTGTGTGGAAACAGG - Intergenic
902717364 1:18281914-18281936 TTGGGGGTGTGGTGGAAAGAGGG + Intronic
903741808 1:25562736-25562758 TTGTGGGTGTGGTGGGAGGTGGG + Intronic
904906040 1:33897942-33897964 TTGTGAGTGTGGGTGTAAGGTGG + Intronic
905357013 1:37391738-37391760 TTGGGGGGGTGGTTGGAGGAGGG - Intergenic
905527614 1:38650982-38651004 TTGTGTGTGTGTGTGGAGAACGG + Intergenic
906276645 1:44521566-44521588 CTGTGGGTGTGGGTGGGGGCAGG + Intronic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
906524306 1:46485573-46485595 TTGGGGGTGGGGGTGGGAGTGGG + Intergenic
906747437 1:48231815-48231837 TTGGGGGTGAAGGAGGAAGATGG - Intronic
906919012 1:50043500-50043522 ATGTGGGGGTGGGTGGAGGGTGG - Intergenic
907276700 1:53320798-53320820 TGGAGGGTGTGGGAGGAAGTAGG - Intronic
907527592 1:55062978-55063000 GGGTGGATGTGGGTGGGAGAGGG + Intronic
907672892 1:56492415-56492437 TTGTTGGTGGGGGTAGGAGAGGG - Intergenic
907679554 1:56550716-56550738 GTGTGGGGGTGGGTGGGAGGAGG - Intronic
907720271 1:56965409-56965431 GTGTGTGTGTGTGTGTAAGAAGG + Intronic
908272811 1:62437184-62437206 TAGTTGGTGTTGGTGCAAGACGG + Exonic
908545274 1:65155955-65155977 ATGTGTGTGTGTGTGGAAGGTGG - Intronic
908659969 1:66424997-66425019 TTGTGGGTGTTTCTCGAAGAGGG + Intergenic
908912093 1:69083817-69083839 TTGTGGGGGAGGGTGGGAAAAGG - Intergenic
909091866 1:71235916-71235938 GTGTGTGTGTGTGTGTAAGAGGG - Intergenic
909358528 1:74735392-74735414 TTGTGGGTTCAGGTGGGAGAGGG - Intronic
909413240 1:75377849-75377871 TTGTGGGTGTTTCTCGAAGAGGG - Intronic
909413891 1:75383254-75383276 TTGTGGGTGTTTCTCGAAGAGGG - Intronic
909933058 1:81520367-81520389 ATGTGTGTGTGTGTGGCAGAGGG - Intronic
909934367 1:81533784-81533806 GTGAGGGTGTGGGTGGGAGGAGG - Intronic
910780797 1:90930280-90930302 TTGTGTGTGTGTGTGTGAGACGG - Intronic
911049645 1:93659822-93659844 TTGTGTGTGTGGGTGGGGGTGGG - Intronic
912173278 1:107126701-107126723 TTGTAGATATGGGTGGAGGAAGG - Intergenic
912276911 1:108268551-108268573 TTGTAGGGGTGGGTGGGAGGGGG + Intergenic
912291318 1:108425805-108425827 TTGTAGGGGTGGGTGGGAGGGGG - Intronic
912470127 1:109901123-109901145 TGGTGAGTGTGAGTGGCAGAGGG - Intergenic
912797568 1:112702171-112702193 TTGTGTAAGTGGCTGGAAGAAGG - Intronic
913108862 1:115640618-115640640 CTGGGGGTGGGGGAGGAAGATGG + Intergenic
913294618 1:117306988-117307010 GTGTGGGTGTGCATGCAAGAGGG - Intergenic
913450077 1:118987297-118987319 TTCTGGGTGTCCGTGGATGAAGG - Intronic
914355945 1:146884753-146884775 TGTTGGGTATAGGTGGAAGAAGG - Intergenic
914376167 1:147075867-147075889 TTCCAGGTGTGGGTGGAGGAAGG - Intergenic
914689069 1:150009934-150009956 TTGTGTGTGTGTGTGAGAGAGGG - Intronic
915146028 1:153796211-153796233 TTCTGGATGTTGGTGGAAGCGGG - Intergenic
915490296 1:156246840-156246862 CTGTGCGTGTGGGAGGCAGATGG + Intronic
915801033 1:158793952-158793974 TTAGGAGTGTGGGTGGAAGAAGG - Intergenic
915944578 1:160140513-160140535 TTGTGTGTGTGGGGGGAGGAGGG + Intronic
915968574 1:160334893-160334915 TAGTAGGTGTGTCTGGAAGAAGG - Intronic
916433903 1:164759213-164759235 TTGCAGGTGAGGGTGGAAGGTGG + Intronic
916602243 1:166304385-166304407 TTGTGGGTGGGGCGGGAAGCGGG + Intergenic
916889604 1:169103503-169103525 GTGTGGCTGGGCGTGGAAGAGGG - Intergenic
916911405 1:169351067-169351089 GTGTGGTTGTGGGTGGATGTGGG - Intronic
917239666 1:172933955-172933977 TTGAGGGTAGGGGTAGAAGAGGG + Intergenic
917727443 1:177841021-177841043 ATGTGGGTGTGGGTTGGGGAAGG - Intergenic
917939229 1:179900910-179900932 GTGTGTGTGTTGGTGGTAGAGGG - Intronic
918026603 1:180755600-180755622 TTGTGGAAGTGGGTGTCAGAAGG - Intronic
918204961 1:182300193-182300215 TTGGGGGTGGGGGTAGAAGCTGG - Intergenic
918273852 1:182931673-182931695 TTGTGTGTGCGGGGGGAACAAGG - Intronic
918296624 1:183163049-183163071 TTGTGGGTGTGTGTGAAGGATGG + Intergenic
918319169 1:183348535-183348557 TTGGGGGTGTGGGGGAATGATGG + Intronic
918553093 1:185766695-185766717 TTTTGTGTGTGTGTGGTAGAAGG + Intronic
919647181 1:200106726-200106748 ATGGGGGTGTGGGTAGAAAAAGG - Intronic
920352257 1:205344896-205344918 TTGTGCATGTGTGTGGCAGATGG - Intronic
920453060 1:206074906-206074928 TTGTGGGTGTGCCTGGGTGAAGG - Intronic
920679647 1:208062736-208062758 CTGGGGGTGAGGGTGGGAGAAGG + Intronic
920749586 1:208661122-208661144 TGGTGTGTGTGGGTGAATGAAGG - Intergenic
920947157 1:210540438-210540460 GTGTGTGTGTGTGTGTAAGAGGG - Intronic
920958479 1:210641883-210641905 TTGTGGAAGAGGGTGTAAGAAGG - Intronic
921734549 1:218612228-218612250 TTGTGGCTGTGACTGGAAGGAGG - Intergenic
922216926 1:223527218-223527240 TAGTGGGTGTGGGAGGTATAAGG + Intergenic
923297483 1:232608851-232608873 TTGGGGCTGTGAGTTGAAGATGG - Intergenic
923331540 1:232929658-232929680 TTTGGGGTGTGTGTGGACGAGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923525851 1:234772134-234772156 CTGTGGGGGTCGGAGGAAGAAGG - Intergenic
924178683 1:241419141-241419163 TTGTGGGCGGGGGTGGCGGAGGG + Intergenic
924835319 1:247641038-247641060 TGGTGGGTGGGTGTAGAAGAAGG + Intergenic
1063588972 10:7377970-7377992 TTGTGTGTGTGGGGGGGAGGTGG + Intronic
1063759844 10:9061200-9061222 TTCTGGGTGTGGCTAGAAGATGG - Intergenic
1064076503 10:12273160-12273182 TTGTCTGTGAGGGTTGAAGAAGG + Intergenic
1064162264 10:12956763-12956785 TTGTGGTGGTGGGTGGAGGGAGG - Intronic
1064449183 10:15426189-15426211 TGGTGGGGGCGGGGGGAAGAGGG + Intergenic
1065021891 10:21508556-21508578 GTGTGTGTGTGTGTGTAAGAGGG + Intergenic
1065772335 10:29089010-29089032 TTGTGTGTGTGTGTGTGAGATGG - Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066481788 10:35803163-35803185 TTCTGGGTGGAGGTGGAGGACGG + Intergenic
1067295984 10:44975428-44975450 GTGGGGGTGGGGGTGGAAGGTGG - Intronic
1067320035 10:45209484-45209506 TTGTAGCTGTGGGTGTCAGAGGG - Intergenic
1067613812 10:47744422-47744444 TTGGGGGGGAGGGGGGAAGAGGG + Intergenic
1068710213 10:60125688-60125710 GTGGGAGTGTGGGTGGAATAGGG + Intronic
1069452137 10:68526432-68526454 TTGTGGGTGTTTCTCGAAGAGGG - Intronic
1069583090 10:69578340-69578362 CGGTAGGTGGGGGTGGAAGACGG - Intergenic
1069648701 10:70025869-70025891 TTGTGGGGATGGGTGGGAGGAGG + Intergenic
1069743079 10:70697910-70697932 ATGATGGTGAGGGTGGAAGATGG - Intronic
1070025160 10:72625629-72625651 TTGTGGATGTGGTTAGAAGTGGG - Intronic
1070295835 10:75160725-75160747 GTGAGGTTGTGGGTGGAAGGTGG + Intronic
1070328022 10:75400520-75400542 TTGTGAGTGGGTGTTGAAGAGGG - Intronic
1070965196 10:80526018-80526040 TTTTGGATGTGGGTGGAATTGGG - Exonic
1071019587 10:81036238-81036260 TTTTGGGAGTGGGTAGCAGATGG + Intergenic
1071282420 10:84114597-84114619 TTCCGGGTGTGACTGGAAGAGGG - Intergenic
1071665431 10:87551184-87551206 TTGTGTGTGTTGGGGGCAGAGGG + Intronic
1073094694 10:100972473-100972495 ATCTGTATGTGGGTGGAAGATGG - Intronic
1074856295 10:117476522-117476544 GTGGGTGTGTGGGTGGAAGGGGG + Intergenic
1074909324 10:117893281-117893303 TTGTGTGTTTGTGTGGCAGAAGG + Intergenic
1074952907 10:118357183-118357205 TGGTTGGAGTGGGTTGAAGAGGG + Intergenic
1075040405 10:119103585-119103607 TTTTGGGGGTGGCTGGATGAAGG + Intergenic
1075161646 10:120029601-120029623 TTGTGGGAGGAGGTGGGAGAGGG + Intergenic
1075323508 10:121511422-121511444 GTGTAGGGGTGGGTGGAGGATGG - Intronic
1075509695 10:123061289-123061311 TTCTGGGAGGGGGTGCAAGAAGG + Intergenic
1075520593 10:123141426-123141448 TTCTGGGTGGGGGAAGAAGACGG - Intergenic
1075646385 10:124099567-124099589 CTGTGGGTGTGGGTGAGAGCTGG + Intergenic
1075784822 10:125041968-125041990 TTGGGGGTGGGGGTGGGGGAGGG + Intronic
1075813324 10:125244830-125244852 CTGTGGGTGTGGGTGACAGTTGG + Intergenic
1076653579 10:132006330-132006352 GTGGGGGTGGGGGTGGGAGAGGG + Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076785586 10:132748299-132748321 TCGCTGGTGTGGGTGGAGGAGGG - Intronic
1077350543 11:2091230-2091252 ATGTGGGTGGAGGTGGAAGAAGG + Intergenic
1077861223 11:6181798-6181820 TTGTGGGGTTGGGGGGAAGGGGG + Intergenic
1078003976 11:7518604-7518626 TCTGGGGTGAGGGTGGAAGAGGG + Intronic
1078327354 11:10391491-10391513 TTGTGGGTGTTTCTCGAAGAGGG + Intronic
1078451323 11:11443032-11443054 TCGTGGGTGTGGATAGAAGTGGG - Intronic
1078719252 11:13869444-13869466 TGCTGGGTGGGTGTGGAAGAGGG - Intergenic
1078836785 11:15037871-15037893 GTGTGAGTGTGGCTAGAAGAGGG + Intronic
1078955581 11:16190778-16190800 TTGTGTGTGTGCGTGGCAGTGGG + Intronic
1078966547 11:16351202-16351224 TTCTGGGTGTGGATGAATGAGGG - Intronic
1079070310 11:17339496-17339518 TTGTGGGGGTGGGGGGAGGGGGG - Intronic
1079107499 11:17580916-17580938 CTGTGGTTGTGGGAGGAAGCAGG - Intronic
1079565763 11:21880040-21880062 TTGTGGGGTTGGGGGGAAGCGGG + Intergenic
1080110044 11:28556494-28556516 TTGGGGGTGGGGGTGGGAGTGGG + Intergenic
1080445207 11:32331855-32331877 CTGGGGGTGTGGGGGGAATATGG + Intergenic
1080545592 11:33314649-33314671 TTGTGTGTGTGTGTGTGAGATGG - Intronic
1080925056 11:36747609-36747631 TTGTGTGTGTGTGTGGAGGAGGG + Intergenic
1080961969 11:37171386-37171408 GTGTGCGTGTGGTTGGAAGAGGG + Intergenic
1081753416 11:45528037-45528059 GTGTGTGTGTGGGTGGAGGGTGG - Intergenic
1082773088 11:57223938-57223960 TTGAGTGAGTGGGTGGATGAGGG - Intergenic
1082822275 11:57552206-57552228 TTGTGTGTGTGTGTGGTGGAGGG - Exonic
1083054929 11:59810547-59810569 TGGAGGGTGGGGGAGGAAGAGGG + Intronic
1083338855 11:61945731-61945753 GGGTGGGGGTGGGTGGAAGGTGG + Intergenic
1083752190 11:64766857-64766879 TTGTGGGGGTGGGTGGGATGGGG - Intronic
1083812166 11:65112167-65112189 TTGGGGGTGTCGGAGGCAGAGGG + Intronic
1083891081 11:65595987-65596009 TGGTGGGGATGGGTGGAGGAAGG + Exonic
1083895271 11:65616577-65616599 GTTTGGGTCTGTGTGGAAGAGGG + Intronic
1084289896 11:68155815-68155837 GTATGGGTGGGTGTGGAAGAAGG + Exonic
1084315098 11:68341343-68341365 TTCTGGGTGTGGGTGGGGGATGG - Intronic
1084831157 11:71770383-71770405 ATTTGGGTGTGTTTGGAAGAAGG - Intergenic
1084959909 11:72710981-72711003 TTGTGTGTGTGTGTAGAAGAGGG - Intronic
1085241357 11:75058910-75058932 TGGTGCTTGTGGGTGGGAGAAGG + Intergenic
1085417330 11:76328087-76328109 TGGCGGGTGTGGGTGGAGGAGGG + Intergenic
1085608134 11:77921622-77921644 TTGGGGGTGTGGGTGGAGTAGGG - Intronic
1085615295 11:77993472-77993494 ATGTGAGGATGGGTGGAAGAGGG + Intronic
1086167715 11:83798665-83798687 TTGGGGGTCTGGGTGCAAGGTGG + Intronic
1086281535 11:85195131-85195153 TAGTGGCTGAGGGTGGGAGATGG + Intronic
1086285616 11:85246549-85246571 TTGTGTGTGTGGCTGGAGGGAGG - Intronic
1086497505 11:87419734-87419756 TTGTGGGTGTGGGAGGAAGGAGG - Intergenic
1087035467 11:93751842-93751864 TTGTGTGTGTGTGTGTGAGATGG + Intronic
1087281149 11:96212137-96212159 GTGTGTGTGTGTGTGGAAGGGGG + Intronic
1089070584 11:115696601-115696623 GTGTGAGTGTGTGTGGGAGAGGG - Intergenic
1089190177 11:116648036-116648058 GTGTTGGTGTGGGTGGAGGGAGG - Intergenic
1089209699 11:116791764-116791786 GTGGGGGTGTGGGTGGAGGCTGG - Intronic
1089920863 11:122208139-122208161 TTCTGGCTTTGGGAGGAAGATGG + Intergenic
1090476353 11:127025043-127025065 GTGTGTGTGTGTGTGTAAGAGGG + Intergenic
1091196952 11:133739268-133739290 TTGTGGGTGTGTGTGCATGTGGG + Intergenic
1091409112 12:227652-227674 TTGTAGGTGTGGATGGATGCAGG - Exonic
1092011384 12:5115571-5115593 ATGTGGGTGTGTATGGAAAAGGG + Intergenic
1092249637 12:6886036-6886058 TTGTGGGTGTTTCTCGAAGAGGG + Intronic
1093090311 12:14913093-14913115 TTGTGAGTATGGGGGAAAGATGG + Intergenic
1093437310 12:19150390-19150412 TTTTGGGTGTGGGCAGAACAGGG - Intronic
1093547830 12:20369134-20369156 TTGTGGGCCTGGGGAGAAGAAGG + Intergenic
1093698125 12:22186047-22186069 TTGTGTGTGTGGGTGGGCGGGGG - Intronic
1093782809 12:23156254-23156276 TTGTGGGGGTGGGGGGAAGGGGG - Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094119893 12:26960652-26960674 TTTGGGGTGTGGATGGAAGGGGG + Intronic
1094121096 12:26975164-26975186 TTATGGGTGGGGATGGAATAAGG - Intronic
1094207178 12:27852972-27852994 TTGTGGGAGTGTGGGGGAGAAGG - Intergenic
1094365985 12:29681660-29681682 TTGTGGGGGTGGGAGGGGGAGGG - Intronic
1094814055 12:34166683-34166705 GTGCGGGTGGGGGTGGGAGAGGG - Intergenic
1095102849 12:38201821-38201843 ATGAGGGTGGGGGTGGGAGAGGG + Intergenic
1095330895 12:40962283-40962305 TTGTAATTGTGGGTGGAAAAGGG + Intronic
1095412925 12:41944256-41944278 TTCAGGGTGTGGGTGGAAGCTGG + Intergenic
1095763260 12:45865249-45865271 TTTTTGGTGTGGGAGAAAGAAGG - Intronic
1096483053 12:51955702-51955724 TTGTAGGAGTTGGTGTAAGAGGG + Intronic
1096889196 12:54749595-54749617 GGGTGGGTGTGGGTGGAATCTGG + Intergenic
1096940101 12:55334194-55334216 TTGTGGGTGTTTCTCGAAGAGGG - Intergenic
1097076747 12:56400543-56400565 TTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1097282749 12:57854858-57854880 TTGCGTTTGTGAGTGGAAGAGGG + Intergenic
1097804630 12:63951930-63951952 TTGTGTGTGTGTGTGGAGGTGGG + Intronic
1098596129 12:72274004-72274026 TTGTGGGTGGGGGTGGAGAACGG - Intronic
1098706209 12:73692986-73693008 TTGGGGGTGGGGGTGGGAGTGGG + Intergenic
1099084005 12:78222267-78222289 TTGTGTGTGTGGTTGGTGGAAGG + Intergenic
1099477468 12:83124592-83124614 TTGTCAGAGAGGGTGGAAGAAGG + Intronic
1099755090 12:86835848-86835870 TTGTGTGTGTGTGTGGAGGGGGG - Intronic
1100021257 12:90072002-90072024 GTGTGTGTGTGTGTGGGAGAGGG + Intergenic
1100712089 12:97268554-97268576 CTGGGGGTGATGGTGGAAGAAGG + Intergenic
1100743081 12:97616632-97616654 CTGTTTGTGTGGGTGGGAGAGGG - Intergenic
1101033039 12:100678530-100678552 GTGTGGGTGTGGGTGGGAGTGGG - Intergenic
1101033041 12:100678536-100678558 TTGTGGGTGTGGGTGTGGGTGGG - Intergenic
1101040517 12:100750935-100750957 TGGTGTGTGTGTGTGGTAGATGG + Intronic
1101075334 12:101123464-101123486 TTGGGGGTGGGGGTGGGGGAAGG - Intronic
1101121007 12:101580082-101580104 TTGTGGGTAGGGGTGGGAGGAGG - Intronic
1101252667 12:102951051-102951073 TTGTGCGTGGGGGGGGAAGCAGG + Intronic
1101530041 12:105565446-105565468 TTGAGGGGATGGGTGGGAGAAGG + Intergenic
1101674594 12:106906523-106906545 TGGTGGGTGGTGGTGGAAGCTGG - Intergenic
1101881217 12:108627343-108627365 TTGTGGACTTGGGTGGGAGAGGG + Intronic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102732096 12:115120631-115120653 TTGAGGGTGGGGGGGGAAGAGGG + Intergenic
1102929012 12:116848556-116848578 TTGTTGGGGTGGATGGGAGAGGG - Intronic
1103297293 12:119898754-119898776 TTGTGGGGGTGGGTGGAGGGGGG - Intergenic
1104259252 12:127167384-127167406 ATGTGGGATAGGGTGGAAGAAGG + Intergenic
1104293120 12:127486980-127487002 TTCTGGGTGTGACTGGAACAGGG - Intergenic
1104452111 12:128878214-128878236 TTGTGTGTGTGTGTTTAAGATGG - Intronic
1104476270 12:129073009-129073031 CTGTGGGTGGGGGAGGGAGAGGG - Exonic
1104568074 12:129903185-129903207 GTGTGGGAGTGTGTGGAGGATGG - Intronic
1104614010 12:130253666-130253688 GTGTGTGCTTGGGTGGAAGAGGG + Intergenic
1104757784 12:131279647-131279669 AGGTGGGGGTGGGTGGAAAATGG - Intergenic
1105258350 13:18760200-18760222 GTGTGGGTGAGGGTGAAACATGG - Intergenic
1105406889 13:20140628-20140650 GTGTGGGCATGGCTGGAAGACGG - Exonic
1105640997 13:22264033-22264055 TTGTGGGTGGGGATGGCGGAAGG + Intergenic
1105715583 13:23060511-23060533 TTGTGTGTGTGTGTGTGAGATGG + Intergenic
1106084237 13:26526064-26526086 GTGTGTGTGTGTGTGTAAGAGGG - Intergenic
1106264036 13:28093797-28093819 TTAGGGGTGTTGGTGGGAGAAGG - Intronic
1106295427 13:28409231-28409253 TTTTGAGTGTGGTGGGAAGAGGG - Intronic
1107541274 13:41391428-41391450 CTGGGGGTGTGGGTGGGAGGAGG + Intergenic
1108626721 13:52236227-52236249 GTGGGGGTGTGGGAGGAAGATGG - Intergenic
1108659347 13:52570258-52570280 GTGGGGGTGTGGGAGGAAGATGG + Intergenic
1108676340 13:52740154-52740176 GGGTGGGGGTGGGGGGAAGATGG + Intergenic
1108707567 13:53003450-53003472 GGGTGGGAGTGGGTGGGAGAGGG - Intergenic
1109187031 13:59282145-59282167 GTGTGCGTGTGTGTTGAAGAGGG - Intergenic
1109553295 13:63935363-63935385 GTTTGGGTGTGGGCGGACGAGGG - Intergenic
1109988836 13:70026728-70026750 GTGTGTGTGTGTGTGTAAGAGGG + Intronic
1110383031 13:74876257-74876279 TTGTGTGTGTGGGTGGTGGGTGG - Intergenic
1110775589 13:79405445-79405467 TTGCGGGTGGGGGTTGGAGACGG + Intronic
1112920694 13:104608583-104608605 TTGTGGGTGATGGGGGAAGCAGG - Intergenic
1113400744 13:109990534-109990556 GTGTCCGTGTGGGTGGACGATGG - Intergenic
1113709496 13:112454244-112454266 TCGTGGGGGTGGGTGGTGGAAGG - Intergenic
1114492389 14:23111518-23111540 TAGTTGGTGAGGGTAGAAGAGGG - Intergenic
1114492787 14:23113777-23113799 TTGGGGTTGTGGGTGGAAAGGGG - Intergenic
1114876226 14:26722255-26722277 TTGTGGGTGAGAGTGAAAGAAGG + Intergenic
1115024441 14:28725169-28725191 GTGTGTGTGTGTGTGGCAGAGGG - Intergenic
1117365680 14:55025299-55025321 TTGTGGGTGTTTCTCGAAGAGGG - Intronic
1117411877 14:55457334-55457356 TTGGGGTTGGGGGTGGAGGAGGG + Intergenic
1117975394 14:61291809-61291831 TTGTGGCTGAGGGTGGGAGTGGG + Intronic
1118315459 14:64723139-64723161 GGGTAGGTGTGGGTGGAGGAAGG + Intronic
1118695814 14:68383997-68384019 TTGGGAGTGTGGGTGCAAGTGGG + Intronic
1119064591 14:71512644-71512666 TTTTGTGTGTGGGGGGAAGCCGG + Intronic
1119115982 14:72021922-72021944 TTGAGGGTGGGGGTGGCAGAAGG - Intronic
1119404453 14:74388897-74388919 CTGTGGGTGTGGCTGCCAGATGG - Intergenic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1120220241 14:81723469-81723491 TTGTGGGTGGAGGTGGGAGAGGG + Intergenic
1120602147 14:86523986-86524008 TTTGGGGTGTGGGGGGAGGAGGG + Intergenic
1120835017 14:89031381-89031403 GGGTGGGTGTGTTTGGAAGAGGG - Intergenic
1121137293 14:91510252-91510274 TTTTGGCTGTGTGAGGAAGACGG - Intronic
1121183232 14:91945322-91945344 TTGTGGGTGTGGATGCCAGATGG + Intronic
1121243518 14:92446948-92446970 CTGTGGGTGTGGGAGGAAAGGGG - Intronic
1121505917 14:94476473-94476495 TTGTGGCTGTTGCTGGGAGATGG - Intronic
1121535469 14:94687616-94687638 TTGTGAGTGTGGGTGGGGGAAGG - Intergenic
1121548080 14:94777386-94777408 TTATGAGTGTGTGTGGAAGAGGG - Intergenic
1121833158 14:97069181-97069203 TCTTGGGTGTGGGTGGAGGTGGG + Intergenic
1121893204 14:97618066-97618088 TTGTTGGTGGGAATGGAAGATGG + Intergenic
1122340298 14:101023754-101023776 TGGTGGTGGTGGCTGGAAGAAGG - Intergenic
1122371908 14:101233643-101233665 GTGTGGGTGAGGGCGGAAGGTGG - Intergenic
1202835036 14_GL000009v2_random:71603-71625 GTGTGGGTGAGGGTGAAACATGG + Intergenic
1123574944 15:21656790-21656812 TTGGCGGTGTCGGTGGCAGAGGG - Intergenic
1123611559 15:22099279-22099301 TTGGCGGTGTCGGTGGCAGAGGG - Intergenic
1123633736 15:22281194-22281216 TTTTGTGTGTGGGGGGGAGAGGG - Intergenic
1123955471 15:25330037-25330059 TTGAGGGTGGGGGTGGAGGTGGG + Intergenic
1124185594 15:27525521-27525543 TTCAGGGTGGGGGTGGAAGTGGG + Intronic
1124824674 15:33082039-33082061 GTGTGTGTGTGTGTGTAAGACGG + Intronic
1124907844 15:33888303-33888325 TTGTGTGTGTGTGTGGCAGGGGG + Intronic
1124907886 15:33888754-33888776 TTGTGTGTGTGTGTGTGAGATGG + Intronic
1127586596 15:60383634-60383656 TTGTGGTTGTGGTTGGCTGATGG + Intronic
1127651081 15:61008388-61008410 TTGTGGGTGCAGCTGGAATATGG - Intronic
1127998404 15:64169132-64169154 GTGTGTGTGTGTGTGGAAGCAGG + Exonic
1128179303 15:65587608-65587630 TTGTGTAGGTGGGTGGGAGATGG + Intronic
1128523352 15:68390207-68390229 TTGTGAGTGAGGTGGGAAGAAGG + Intronic
1129081953 15:73049096-73049118 TTGTGTGTGGGGGTGGGAGAAGG - Intergenic
1129583621 15:76838840-76838862 TTGTGGGTGTGGCTGCCGGAAGG - Intronic
1130437832 15:83919675-83919697 GTGTGGGTGTGGGTGAAGGGTGG + Intronic
1130518211 15:84642471-84642493 TTGTGTGTGTGTGTGTAACAGGG + Exonic
1131087731 15:89591127-89591149 TTGTGTGTGTGTGTGTGAGACGG + Intronic
1131128826 15:89880901-89880923 TTCTGGGTGTGGGAAGAACAAGG + Intronic
1131547041 15:93324183-93324205 TAGTGGGTGTGCGTGGTTGATGG + Intergenic
1131621923 15:94077687-94077709 TTGTGTGTGTGAGTGCATGAGGG - Intergenic
1131771972 15:95747606-95747628 TCTTGGGTGTGGGTGGCAGAGGG + Intergenic
1132447648 15:101940425-101940447 GTGTGTGTGTGTGTGTAAGAGGG - Intergenic
1202983812 15_KI270727v1_random:391034-391056 TTGGCGGTGTCGGTGGCAGAGGG - Intergenic
1132568576 16:634370-634392 TTGTGAGGTTGGGTGGGAGACGG - Intergenic
1132701716 16:1224938-1224960 TTGGGGGTGCGGGTGGGAGTTGG - Intronic
1132819943 16:1859997-1860019 TTGTGGGAGTGGTTGGTTGAGGG - Intronic
1133635010 16:7656949-7656971 CTGGGGGTGTGGGTGGAGGAGGG - Intronic
1133710213 16:8393947-8393969 TTGGGGGTGTGGGGTGAAAAGGG - Intergenic
1133808613 16:9144339-9144361 TTGAGGGTGAGGATGGAAGGCGG + Intergenic
1134505146 16:14799360-14799382 TTATGGGTGAGTGGGGAAGAAGG - Intronic
1134575430 16:15329550-15329572 TTATGGGTGAGTGGGGAAGAAGG + Intergenic
1134727015 16:16426942-16426964 TTATGGGTGAGTGGGGAAGAAGG - Intergenic
1134940422 16:18284913-18284935 TTATGGGTGAGTGGGGAAGAAGG + Intergenic
1135040244 16:19112775-19112797 TTGTGGGGGAGGGGGGAAGGGGG + Intergenic
1135548107 16:23379104-23379126 CTGGGTGTGTGGGTGGATGATGG - Intronic
1135870304 16:26143607-26143629 TTGTGGGGGTGGGGGGAAAGGGG + Intergenic
1135990089 16:27213247-27213269 GTGTGTGTGTGTGTGTAAGATGG + Intronic
1135992995 16:27228877-27228899 CTGTAGGGGAGGGTGGAAGAGGG - Intronic
1136138671 16:28274848-28274870 ATGTGGGAGTGGGTGGGAGAGGG + Intergenic
1136247923 16:28985812-28985834 TTGGGGATGGGGCTGGAAGATGG - Intronic
1136415563 16:30101271-30101293 TTTGGGGGGTGGGTGGAGGATGG - Intergenic
1137580253 16:49629421-49629443 CTGTGGGTGTGGGTGGAAAGAGG - Intronic
1137775750 16:51053153-51053175 TTTTGGGTGGGGGTGGGAGATGG - Intergenic
1137946656 16:52739246-52739268 TGGAGGGTGAGGGTGGGAGAAGG + Intergenic
1138166008 16:54802346-54802368 TGGAGGGTGTGGATGGCAGATGG + Intergenic
1138277680 16:55747949-55747971 TTCTGAGTGTCGGTGGCAGAGGG - Intergenic
1138848789 16:60600695-60600717 TTGAGGGTGGAGGTGGAAGGAGG - Intergenic
1138885462 16:61072579-61072601 TTGGGGGTGCGGGTGTAGGAGGG - Intergenic
1139220386 16:65175864-65175886 TTGGGGGGGTGGGTGGTAGCAGG - Intergenic
1139978071 16:70830708-70830730 TGTTGGGTATAGGTGGAAGAAGG + Intronic
1140002639 16:71040489-71040511 TTGTGTGTGTGGGGGGGAGGGGG - Intronic
1140287641 16:73619761-73619783 TTGTGGAAGTGGGTGGGAGTGGG - Intergenic
1140376645 16:74450237-74450259 CTGTGGATGTGAGTGGATGATGG - Intergenic
1140418836 16:74799575-74799597 TTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1140889109 16:79270090-79270112 TTCTCGGGGTGGGTGGAAGGAGG + Intergenic
1140986209 16:80160196-80160218 GTGAGAGTGAGGGTGGAAGATGG + Intergenic
1141601154 16:85127157-85127179 GTGTGTGGGTGGGTGGAAGGGGG - Intergenic
1141636414 16:85316444-85316466 TGGGAGGTGTGGGTGCAAGATGG - Intergenic
1141749709 16:85950138-85950160 CTGTGGGTGAGGGAGGAAGTAGG + Intergenic
1142104799 16:88296724-88296746 ATGTGTGTGTGGGTGGAGCATGG - Intergenic
1142130395 16:88429368-88429390 GTGAGTGGGTGGGTGGAAGAAGG - Exonic
1142159288 16:88548315-88548337 TGGTGGGTGGGGCAGGAAGAGGG - Intergenic
1142396363 16:89833925-89833947 GTGTGGGTGTGGGTGTGAGCTGG + Intronic
1143195718 17:5074862-5074884 TTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1143470993 17:7175337-7175359 TTGTGTGTGTGTGTGGGTGAAGG - Intronic
1143532075 17:7511343-7511365 GTGTGGGAGTGGGAGGAGGAAGG - Intronic
1143537476 17:7549776-7549798 ATGTGAGTCTGCGTGGAAGAGGG + Intronic
1143575052 17:7787361-7787383 TTGTTGGAGTGGGTGGAAAAGGG - Intronic
1143671369 17:8398136-8398158 ATAGGGGTGTGGGGGGAAGATGG - Intergenic
1144182964 17:12770091-12770113 TGGTGGGTGGAGGTGGAGGAAGG + Intergenic
1144224844 17:13135264-13135286 GTGTGTGTGTTGGTGGCAGAGGG + Intergenic
1144337041 17:14280853-14280875 ATGTGGGTGTGAGTGGAGGAGGG + Intergenic
1144578894 17:16446927-16446949 TTGTGGGTGGGGGTGGGGGGCGG + Intronic
1144833298 17:18143624-18143646 GTGTGGGTCTGGGTGGCAGCAGG + Intronic
1144936299 17:18901715-18901737 TTTTAGTTGTGGGTGGCAGAAGG + Intronic
1144938997 17:18923947-18923969 TTGTGGGTGATGTTGGAGGAAGG + Exonic
1145049580 17:19648836-19648858 TTGTGGCTGTGGGTTGACGGTGG + Exonic
1145867033 17:28248032-28248054 GTGTGGTGGGGGGTGGAAGAGGG + Intergenic
1146008731 17:29178398-29178420 TTGTAGGTGGGGGTGGAGGGTGG - Intronic
1146181374 17:30700223-30700245 TTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1146537562 17:33666348-33666370 TTGAGTGTGTGGGTGGCAGAAGG + Intronic
1146814416 17:35930888-35930910 TTGTGGCTGTGACTGGAGGAGGG - Intergenic
1147178563 17:38671554-38671576 TTGTGGGAGGAGGAGGAAGAAGG - Intergenic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147512876 17:41086900-41086922 TTGTGGGGGTGGGGGGAGGGGGG + Intronic
1147853074 17:43457507-43457529 TTGAGAGTGTGGATGGCAGACGG + Intergenic
1148098296 17:45070255-45070277 TTGTGTGTGTGTGTGTGAGATGG + Intronic
1148226298 17:45900084-45900106 TTGTGGGTGTGGGTTGAGTTGGG + Intronic
1148345972 17:46903961-46903983 ATGTGTGTGTGGGTGGATGGTGG + Intergenic
1148458990 17:47826987-47827009 TGGTGGGGGTGGGGGGAAGATGG + Intronic
1148587376 17:48790669-48790691 TTGTAGGTGTGGTGGGAAGAGGG - Intronic
1148701843 17:49592265-49592287 TTGGGGTTGGGGGTGGAAGAAGG - Intergenic
1148739107 17:49881813-49881835 ATGGGAGTGTGGGTGGAAGGGGG + Intergenic
1148854519 17:50571440-50571462 GTGTGGGTGTGTGTTGGAGAGGG + Intronic
1149208436 17:54276336-54276358 TTGGAGGTGTGGGGGGCAGAGGG + Intergenic
1150048477 17:61936169-61936191 TGGAGGGTGGGGGTGGAAGGAGG + Intergenic
1150064744 17:62099594-62099616 GTGTGGGTGTGGGTGGGTGGGGG + Intergenic
1150306202 17:64087461-64087483 TTGTGTGACTGGGTGGAAGTGGG - Intronic
1150631228 17:66881805-66881827 TTGGGGGTGGGGGTGGAAAATGG + Intronic
1150840868 17:68604174-68604196 TTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1150862517 17:68815932-68815954 TTGTGGGAGTGGGTGGTTGAAGG - Intergenic
1151194023 17:72419207-72419229 TTGTGGGTCTGAATGGGAGATGG + Intergenic
1151243126 17:72773638-72773660 GTGTGTGTGTGTGTGTAAGATGG - Intronic
1151376994 17:73695911-73695933 TTGTGGGGGTGGGAAGATGAGGG - Intergenic
1151698574 17:75730708-75730730 TTGGGAGTTGGGGTGGAAGATGG - Intronic
1152032838 17:77854558-77854580 TGGAGGGTGGGGGTGGGAGAAGG - Intergenic
1152118785 17:78405469-78405491 TGGTGGGGGTGGTAGGAAGAGGG + Intronic
1152228858 17:79104819-79104841 TTGAGGGTGTGAGGGCAAGAGGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152310011 17:79544368-79544390 TTGCTGGTGTTGGTGGAAGGAGG + Intergenic
1152325650 17:79634340-79634362 TAGAGGGTGTGGGTGGAAGTGGG - Intergenic
1153143409 18:2000996-2001018 TTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1153402982 18:4701566-4701588 TTGTGGGTAAGGGTGGGAGGGGG + Intergenic
1153422036 18:4917461-4917483 TTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1154036941 18:10812375-10812397 TTGAGGGTGAGGGTGGGAGGAGG + Intronic
1154427730 18:14284693-14284715 GTGTGGGTGAGGGTGAAACATGG + Intergenic
1154492929 18:14934901-14934923 GTGTGTGTGTGTGTGGTAGAGGG - Intergenic
1155420877 18:25654718-25654740 TTGTGAGTGTGGGCAGAAGGAGG + Intergenic
1155480920 18:26286655-26286677 TTGTGGGTGTGAGTAGAAAGAGG - Intronic
1155701880 18:28755165-28755187 GTGTGTGTGTGTGTGTAAGATGG + Intergenic
1156003900 18:32417729-32417751 TAGTGGGGGTGGGAGGAAGGTGG + Intronic
1156203196 18:34857218-34857240 TCGTGGGTGTGGTGAGAAGATGG - Intronic
1156557330 18:38082342-38082364 TTGTGGATGTTGGTGGACAAGGG + Intergenic
1157986918 18:52448597-52448619 AGGTGGGTGGTGGTGGAAGAGGG + Intronic
1158323280 18:56287136-56287158 TTGTGGGTGTGTTTCGAAGTCGG - Intergenic
1158403714 18:57142964-57142986 TTGTGGTTGGGGGTGGGAAAAGG + Intergenic
1158476977 18:57788942-57788964 TTGGGGGTGGGAGTGGAAGGAGG - Intronic
1158948508 18:62469083-62469105 TTGTGTGTGTGTGTGTGAGATGG + Intergenic
1159789321 18:72758397-72758419 GTGTGTGTGTGTGTGGAGGAGGG + Intronic
1159797614 18:72863804-72863826 GTGTGTGTGTGGGGGGAAGGTGG + Intronic
1159983397 18:74813462-74813484 TGGTGGGTGTGGGGTGAAGGGGG - Intronic
1160357919 18:78244394-78244416 TTGGGGGTTTGGTTGGAGGAGGG - Intergenic
1160637623 19:92104-92126 GTGTGTGTGTGTGTGTAAGAGGG + Intergenic
1160717596 19:583444-583466 TTGTGGCGGTGGGTGGGAGGGGG - Exonic
1161000378 19:1907772-1907794 TTCTGGGTGGGTGTGGTAGAGGG + Intronic
1161771321 19:6232407-6232429 TTCTGTGTGTGGGTGGAGTAGGG - Intronic
1162446652 19:10727291-10727313 TTCTGGATGAGGGCGGAAGATGG + Intronic
1162452350 19:10762801-10762823 CTGTGGCTGTTGGTGGAAAAGGG + Intronic
1162525158 19:11202553-11202575 TTGTGGTTGGGGGTGGAACGGGG - Intronic
1162582242 19:11538590-11538612 TGGGAGGGGTGGGTGGAAGAAGG + Intergenic
1162777623 19:12989569-12989591 TTGTGTGTGTGGATGAAGGATGG + Intergenic
1163005524 19:14394727-14394749 TGGTAGGTGTGGGTGTCAGAGGG - Intronic
1163022672 19:14491688-14491710 TAGGGGGTGAGGGTGGAAGCTGG - Exonic
1163215227 19:15871524-15871546 GGGTGTGTGTGGGTGGAAGTGGG - Intergenic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1163439075 19:17312463-17312485 TAGAGGGTGTGTGTGGCAGAGGG + Intronic
1163490851 19:17616469-17616491 TTGGGGGTGGGGGTGGAAGGGGG + Intronic
1163744101 19:19034523-19034545 GAGTGGGTGTGGCTGGTAGAGGG + Intronic
1164370303 19:27637772-27637794 TTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1164721269 19:30433319-30433341 TTGGGGAAGTGGGGGGAAGATGG - Intronic
1164733648 19:30524698-30524720 GTTTGGGTGGGGGTGGAGGAGGG - Intronic
1164980964 19:32614094-32614116 AGGTGGGTGTGGCTGTAAGAGGG + Intronic
1165798697 19:38534616-38534638 TTGTGGATGTGGCTGGAACAGGG + Intronic
1166026325 19:40089003-40089025 ATGTGGGTGAGGGAGGAAGGAGG + Intronic
1166200022 19:41231335-41231357 TTGTGGATGTGGGTGGAAGGAGG - Intronic
1166566742 19:43770169-43770191 TTGTGGGAGTGGGAGAAGGATGG - Intronic
1167108549 19:47445691-47445713 TTGTGGGGGTGGGGGACAGAGGG + Intronic
1167217159 19:48172126-48172148 GGGTGGGTGTGGGTGGGAGACGG + Intronic
1167968946 19:53173936-53173958 TTGTGGGTGTGGGTGACAAGGGG - Intronic
1168210441 19:54886241-54886263 TTGTGTGTGTGTGTGTGAGATGG - Intronic
1168438277 19:56340027-56340049 TTTTGGGTTTGGATGGAGGAGGG - Intronic
1202637590 1_KI270706v1_random:55745-55767 GTGTGGGTGAGGGTGAAACATGG - Intergenic
924994129 2:341334-341356 GAGTGGGTGTAGGTGGGAGAGGG - Intergenic
925523997 2:4779601-4779623 TTGTGTGTGTGTATGAAAGATGG - Intergenic
925904796 2:8534123-8534145 GTGAGGAGGTGGGTGGAAGAGGG - Intergenic
926015573 2:9448560-9448582 TTGTGTGTGTGTGTGTGAGACGG + Intronic
926044512 2:9699851-9699873 TTGGAGGGGTGGGTAGAAGAAGG - Intergenic
926119954 2:10236397-10236419 TGGTGGGGGTCAGTGGAAGACGG - Intergenic
926891483 2:17643002-17643024 TTGAGGGTGGGGGTGGGCGAGGG + Intronic
927235080 2:20865927-20865949 TTGTGGGTGTGGGTTGGAATTGG + Intergenic
927517264 2:23679780-23679802 CAGAGGGTGTGGGAGGAAGAGGG + Intronic
927762740 2:25774105-25774127 TTGAGGGTGGAGGTGGAAGGAGG + Intronic
927770610 2:25857806-25857828 TTGTAGGTAGGGGTGAAAGATGG - Intronic
928342480 2:30456553-30456575 TTGTGGGTGGGGGTGGGCCACGG + Intronic
928758691 2:34556549-34556571 TTGTGGGGTTGGGGGGAAGGGGG - Intergenic
928933790 2:36652934-36652956 TTGTTGGTGTGGATGTGAGACGG + Intergenic
928949614 2:36803110-36803132 TTGTGGGTGTGAATGGCACAGGG - Intronic
929378419 2:41319207-41319229 TTGTGGTTGTGGATGGAAAGAGG - Intergenic
929643499 2:43604903-43604925 TGGTGTGTGTGGAAGGAAGAGGG - Intergenic
929716323 2:44314585-44314607 GTGTGTGTGTGTGTGGCAGAGGG - Intronic
929840640 2:45459108-45459130 TTGGAGGTGGGAGTGGAAGAGGG - Intronic
929892468 2:45929712-45929734 TCCTGGGGGTGGGGGGAAGATGG - Intronic
930188259 2:48431710-48431732 TTGTGTGTGTGTGTGGAAGGGGG - Intergenic
930471097 2:51814840-51814862 TTGTGTGGGTGGGTGGGAGAGGG + Intergenic
930711091 2:54551712-54551734 TTATGGGTGTGGGGGGAATGGGG + Intronic
930876068 2:56218418-56218440 ATGTTTGTGTGGCTGGAAGATGG - Intronic
930943682 2:57045335-57045357 TTGTGTCTCTGTGTGGAAGAAGG + Intergenic
931376694 2:61714234-61714256 GTTGGGGAGTGGGTGGAAGAAGG + Intergenic
931549218 2:63424250-63424272 TTGGGGGCGGGGGTGGGAGAGGG + Intronic
931625341 2:64252039-64252061 ATGGGGGTGTGGGTGGGGGAGGG + Intergenic
931726535 2:65117053-65117075 TGGTGGGTGGGGGTGGGGGAAGG - Intronic
931828166 2:66022893-66022915 TTGGGGATGTGGGTGGTAGAGGG + Intergenic
932566508 2:72914559-72914581 TTGTGGGGGATGGTGGTAGAGGG + Intergenic
932931183 2:76041442-76041464 TGGTGGGAGTGGGTGGGAGGGGG + Intergenic
933648282 2:84829751-84829773 GTGTGGATGTGTGTGGAACATGG - Intronic
934860365 2:97759486-97759508 GTGTGGATGAGGGAGGAAGAGGG + Intronic
935116533 2:100142203-100142225 GTGTGTGTGTGTGTGGTAGAGGG - Intronic
935313642 2:101809730-101809752 TTGTTTGTTTGGGAGGAAGATGG + Intronic
936233023 2:110720583-110720605 GGGTGGGGGTGGGTGGCAGATGG - Intergenic
936462889 2:112725054-112725076 TGGGGGGTGTGGGAGGAAGGAGG - Intronic
936771772 2:115922292-115922314 GACTGGGTGTGTGTGGAAGAGGG + Intergenic
937334635 2:121054431-121054453 TTGTGGGGAAGGGTGGCAGATGG + Intergenic
937434196 2:121866815-121866837 TTGTGAATGTGGGTGGATGATGG + Intergenic
938938188 2:136146060-136146082 TTGTGGCAGATGGTGGAAGAAGG + Intergenic
939096733 2:137840869-137840891 TTGTGGGGGAGGGTGGGAGGGGG + Intergenic
939106256 2:137952093-137952115 AAGTGTGTGTGGGTGGGAGAGGG - Intergenic
939705092 2:145442599-145442621 TTGTGGGGGTGGGGGGAGGGGGG + Intergenic
940115563 2:150204561-150204583 CTGTGTGTGTGGGTGGCAGTAGG - Intergenic
940144718 2:150533881-150533903 TTGGTGGGGTGGGTGGGAGATGG + Intronic
940195281 2:151087778-151087800 TGGTGGGTGTGGGAGGAAATAGG - Intergenic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
940865766 2:158816554-158816576 GTGTGTGTGTGTGTGGTAGAGGG - Intronic
940866493 2:158822738-158822760 GTGTGGGTGGGGGTGGGAGAGGG + Intronic
941385852 2:164851225-164851247 TTGGGGTTGGGGGTGGAAAATGG - Intergenic
942280108 2:174353470-174353492 TTGTGTGTGTGTGTGTGAGATGG + Intronic
942452016 2:176114346-176114368 TTGGGGGTGGGGGTTGAGGATGG - Intronic
943593194 2:189823417-189823439 TTGAGGGGGTGGGAGGAAGGGGG - Intronic
943709151 2:191070853-191070875 GTGTGGGGGTGGGACGAAGAAGG + Intronic
943745435 2:191457014-191457036 TGGTGGGTGGGGGTGGGGGAGGG - Intergenic
944100432 2:196020572-196020594 TTGTGTGTGTGTGTGGAATGGGG + Intronic
944272393 2:197797762-197797784 GGGTTGATGTGGGTGGAAGAGGG + Intergenic
944976770 2:205062439-205062461 TTCTGGGTTTGGGTGGGAGCGGG - Intronic
945675903 2:212855382-212855404 TTGTGTGTGTGTGTGGAAAGAGG - Intergenic
946244896 2:218381931-218381953 GTGTGTGTGTGTGTGGCAGAGGG + Intergenic
946543721 2:220714118-220714140 TTGTGGGGGTGGTTGGAGCAAGG + Intergenic
946563894 2:220941995-220942017 TGGTGGGTGAGGGTAGAGGATGG + Intergenic
946816999 2:223589327-223589349 TGGTGAGTGTGGGTGCAAAATGG - Intergenic
946998193 2:225420519-225420541 TTGAGGATGTGAGTGGAAGCTGG + Intronic
947027557 2:225754089-225754111 TTGTGTGTGTGTGTGCACGATGG + Intergenic
947108712 2:226695723-226695745 GTGTGTGTGTGTGTGGTAGAGGG - Intergenic
947441252 2:230123705-230123727 GTGTGTGTGTGTGTGTAAGATGG + Intergenic
947449899 2:230198200-230198222 CTGTGGAAGTGTGTGGAAGAGGG - Intronic
947532724 2:230923077-230923099 TTGAGGGTGTGGGCGGATGAGGG - Intronic
947619137 2:231577539-231577561 TTGTGGGTGTTTCTCGAAGAGGG - Intergenic
947654330 2:231813409-231813431 TTGTGTGTGTGTGTGTGAGACGG + Intergenic
947899642 2:233710886-233710908 TTGTAGGTTTGGGTGGAAAGAGG + Intronic
948422326 2:237867484-237867506 GTGGGGGTGGGGGTGGGAGAGGG + Intronic
948487691 2:238291245-238291267 TGGTGGGAGTGGGTGGAGCAGGG - Intergenic
948534117 2:238633316-238633338 TTGTGGGTGTGCATGCATGAAGG + Intergenic
948564644 2:238876127-238876149 GGGTGGGTGTGGGTGGAGGGCGG + Intronic
948686926 2:239675695-239675717 TTTGGGGAGTGGGTGGAAGATGG - Intergenic
948825424 2:240571484-240571506 ATGTGGCTGTGGTTGGAAGAGGG + Intronic
1168777923 20:463239-463261 TTGTGGTTGGGGGTGGGAGGTGG - Intergenic
1169840339 20:9928839-9928861 TTGGGAGTGTGGATGGAGGATGG + Intergenic
1169868824 20:10230069-10230091 TTGGGGGTATGGGTGGGAAAAGG - Intronic
1169994665 20:11543682-11543704 TTGTGGGCGAGCGTTGAAGATGG + Intergenic
1170907244 20:20527591-20527613 TTGGGGGTGTGGGGGGAGGGCGG - Intronic
1170993404 20:21327027-21327049 TGGTGGGTGGTGGTGGGAGATGG + Intronic
1171227144 20:23451334-23451356 TGGTGGGTGAGGGTGGATGAGGG - Intronic
1171419711 20:25009792-25009814 TTGGGGGTGTGTGTGCAACATGG + Intronic
1172112141 20:32553254-32553276 TTGGGGGTGAGGGTGGAAGCTGG - Intronic
1172276845 20:33684793-33684815 ATGGGGGTGTGGGTGGCAGCTGG - Intronic
1172479448 20:35262306-35262328 TTGTGGGTGTTTCTCGAAGAGGG + Intronic
1172578207 20:36026036-36026058 TTGTGTGTGTGTGTGAGAGATGG + Intronic
1172716076 20:36964682-36964704 TTCGGGGTGTGGGTAGAAGCTGG + Intergenic
1172718456 20:36981497-36981519 TTCGGGGTGTGGGTAGAAGCTGG - Intergenic
1173229802 20:41185333-41185355 GTGGGGGAGTGGGTGGCAGAAGG - Intronic
1173457539 20:43215574-43215596 TGTTGGGGGCGGGTGGAAGAAGG - Intergenic
1174165811 20:48582823-48582845 ATGTGGGTGTGGGTTGAAGGCGG - Intergenic
1174390078 20:50213633-50213655 TTGTGTGTGTGCATGCAAGAGGG + Intergenic
1174452937 20:50630922-50630944 CTGTAGGTGTTGGTGGAAGGTGG - Intronic
1174490352 20:50888872-50888894 TTGTGGGTGTCGGGGGAAGGGGG - Intergenic
1175328753 20:58148236-58148258 ATGTGGCTTTGGGTGGAAGTGGG - Intergenic
1175571943 20:60030054-60030076 TTGTGGGGGAAGGTGGCAGAAGG - Intronic
1175633178 20:60559293-60559315 GGGTGGGTGTGGGTGAAGGAGGG - Intergenic
1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG + Intergenic
1175781930 20:61688345-61688367 TGGTGGGTGTCGGTGGGAGGAGG - Intronic
1175852533 20:62101521-62101543 GTGTGGGTGTAGGGGGATGAGGG + Intergenic
1175875970 20:62230033-62230055 TTGTGAGTGTGTGTGGAATGGGG - Intergenic
1176424381 21:6538997-6539019 TTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1176676675 21:9784971-9784993 ATGTGTGTGTGTGTGGATGAGGG + Intergenic
1176844341 21:13865217-13865239 GTGTGGGTGAGGGTGAAACATGG - Intergenic
1176966692 21:15219032-15219054 TTGGGGGGGTGGGTGGCTGAAGG + Intergenic
1177249061 21:18568859-18568881 TTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1178363389 21:31968515-31968537 GTGTGGGTGTGGGTGTTAGGGGG - Intronic
1178553039 21:33557967-33557989 TTTTTGGTGTGGGTGGATGGGGG + Intronic
1178750424 21:35297308-35297330 GTGTGTGTGTGTGTGGCAGAGGG - Intronic
1178789270 21:35683784-35683806 GAGTGGGTGAAGGTGGAAGAGGG - Intronic
1178915586 21:36704040-36704062 AGATGGGTGTGGGTGAAAGAGGG + Intronic
1178944099 21:36931935-36931957 TTGGGGATGTGGGGGGAAAACGG - Intronic
1179165715 21:38933732-38933754 GTGTGTGTGTGGGTGGAGGGGGG - Intergenic
1179330838 21:40399359-40399381 TTGAGAGTATGGGTGGAAAAGGG + Intronic
1179680592 21:43018463-43018485 GTGTGTGTGTGGGTGGCAGGGGG - Intronic
1179699874 21:43147312-43147334 TTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1179788457 21:43742351-43742373 TTGTGGGTGTGTGTGGAGACAGG + Intronic
1179881274 21:44294253-44294275 GTGTGGGTGTGGGTGGAGAGTGG - Intronic
1180150476 21:45944642-45944664 ATGTGGTTGTGGGTGGAACTGGG - Intergenic
1180755627 22:18159058-18159080 TTGTGTGTGTGTGTGTGAGATGG + Intronic
1180755932 22:18161208-18161230 GTGTGAGTGTTGGTGGAAGGAGG - Intronic
1180837785 22:18939437-18939459 TTGTGGGTGTTTCTCGAAGAGGG - Intergenic
1180838694 22:18947644-18947666 TTGTGGGTGTTTCTCGAAGAGGG - Intergenic
1180914952 22:19479518-19479540 TTTTTGGTGTGGTTTGAAGAAGG - Intronic
1181075836 22:20376195-20376217 GTGTGAGTGTTGGTGGAAGGAGG + Intronic
1181303950 22:21903576-21903598 GTGTGTGTGTGTGTGAAAGAAGG - Intergenic
1181437097 22:22917397-22917419 ATGTGGGTGTGTGTGTAAGCCGG + Intergenic
1182026269 22:27121662-27121684 TTATTGGGGTGGGAGGAAGACGG - Intergenic
1182201351 22:28573832-28573854 TAGTGGGGGTGGGGGGAAGTGGG - Intronic
1182772185 22:32803617-32803639 ATGTGGGTGGAGGTGGAGGAGGG - Intronic
1183005387 22:34897101-34897123 TGTTGGGTCTGGGTGGCAGAAGG - Intergenic
1184468636 22:44683416-44683438 TTCTGGGTGTGGGTGGCAGATGG - Intronic
1184707392 22:46224058-46224080 TTGTGGGTGTGGGTGGAAGAGGG - Intronic
1184967788 22:47994089-47994111 TTGTGGGTCTGGGTTGGAGGAGG - Intergenic
1185056581 22:48581967-48581989 CTGTGGGTCTGCGTGGAACATGG + Intronic
1185196081 22:49470308-49470330 GTGAGAATGTGGGTGGAAGATGG + Intronic
1203287876 22_KI270734v1_random:164736-164758 TTGTGGGTGTTTCTCGAAGAGGG - Intergenic
949096094 3:87577-87599 TTGTGTGTGTGGGGGGACGCGGG + Intergenic
949174561 3:1044206-1044228 GTGTGGGTGGAGGTGGAAGGTGG - Intergenic
949538204 3:5012007-5012029 TGGTGGGCCTGGGTGGGAGAAGG + Intergenic
949802501 3:7918969-7918991 ATGTAGGTGTGGGATGAAGAAGG + Intergenic
950006853 3:9697006-9697028 TTTTGGGGGTGGGAGGAAGAAGG - Intronic
950112276 3:10426869-10426891 GGGTGGGGGTGGGGGGAAGATGG + Intronic
950656410 3:14439753-14439775 TTGTGTGTGTGTGAGGAAGCTGG + Intronic
951614115 3:24522469-24522491 CTGTGGGTGGGGGTGGAACCTGG - Intergenic
951625222 3:24653546-24653568 TTGTGTGTGTGAGTGGAGGAGGG + Intergenic
951823744 3:26843787-26843809 GTGTGTGTGTGTGTGGCAGAGGG - Intergenic
952383947 3:32825604-32825626 TTATGGGTGGGAGTGGGAGAAGG - Intronic
952958887 3:38577442-38577464 TTGTGGGTGTGGGTGTAAAGGGG + Intronic
953369556 3:42376010-42376032 TTGTGGATTTGGGTGGCAGGCGG - Intergenic
954241181 3:49294839-49294861 TTGAGGCCGTGGTTGGAAGAAGG - Intronic
954489228 3:50885876-50885898 TTTTTGGTGTGGGGGGCAGAGGG + Intronic
954501345 3:51019617-51019639 TTGGAGGTGAGGGTGGAAGGAGG - Intronic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
955111142 3:55951120-55951142 GGGTGGATGTGGGTGGGAGATGG + Intronic
955588685 3:60510709-60510731 TTGTGTGTGTGGGGGGAGGTGGG - Intronic
956012384 3:64845381-64845403 TTGGGGGTGTGGGTGGGAATGGG - Intergenic
956166536 3:66401980-66402002 TTGTGTGTGTGGGTGGGAAGCGG - Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957341066 3:78897302-78897324 TGTGGGGTGTGGGTGGAGGATGG - Intronic
957398251 3:79673320-79673342 GTGTGGGTGTGGGTGTGTGAGGG + Intronic
957606985 3:82413092-82413114 TTGTGAGTGTGGGTGAGAGAGGG - Intergenic
957980246 3:87500180-87500202 GTGTGGGTGGAGGTGGAAGCTGG - Intergenic
958663993 3:97110202-97110224 TTGTAGATGGGGGTGGATGATGG + Intronic
958734031 3:97989095-97989117 TGGTGGGTGACGGTGGTAGATGG + Intronic
960284453 3:115811237-115811259 ATGTGGGTGTGGGTCTGAGAGGG + Intronic
960622518 3:119650686-119650708 GAGTGAGTGTGGATGGAAGAGGG - Intronic
960987926 3:123292532-123292554 CTGTGGGTGGTGGTGGAAGGCGG - Intronic
961060727 3:123826049-123826071 TTGGGGGTGGGGGTGGTACAGGG - Intronic
961851652 3:129825529-129825551 TGGTGGGGGTGGGTGGTAGGGGG + Intronic
962414987 3:135173709-135173731 TTGTGGGTTTGGGAGGCACACGG - Intronic
963320682 3:143806097-143806119 CTGTGTGTGTGGGTGGGGGACGG - Intronic
964091166 3:152877781-152877803 TTGTGTGTGTGTGTGTAATATGG + Intergenic
964140223 3:153390039-153390061 TAGTGGGTGTAGGGGGAAAAGGG - Intergenic
964297970 3:155254595-155254617 CTGAGAGTGTGGGTGGAAGAAGG - Intergenic
964389802 3:156185260-156185282 AGGTGGCTGTGAGTGGAAGAAGG - Intronic
965028224 3:163329257-163329279 TTGTGGCTGTGGGAGAAACAAGG + Intergenic
965268480 3:166580950-166580972 TTGTGGGCGTGGATGGAAATAGG + Intergenic
966200846 3:177358769-177358791 GTGTGGGTGAAGGTGGAAGTGGG + Intergenic
966302032 3:178489901-178489923 TTTTGGGTATGGGTGGAGGTGGG - Intronic
966579108 3:181539554-181539576 TTGAGGGTGAGGGTGGCAGGAGG + Intergenic
966748857 3:183303215-183303237 TGGTGGGAGTGAGTGGAGGAGGG - Intronic
967194677 3:187016201-187016223 GTGTGTGTTGGGGTGGAAGATGG - Intronic
968422302 4:496144-496166 TTTTGTGTGTGGGGGGTAGACGG + Intronic
968523624 4:1045669-1045691 ATGGGGGTGTGGGTGGAGGGGGG + Intergenic
969436982 4:7194008-7194030 TTGTGGGGGTGGGGGGAAGTGGG - Intronic
970371563 4:15412311-15412333 GTGGGGGTGGGGGTGGGAGATGG - Intronic
970558451 4:17259269-17259291 TTGTGGGGGTGGGGGGAGGGGGG - Intergenic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
970721209 4:18991331-18991353 TTGTGTTTGTGTGTGGACGAGGG + Intergenic
970751369 4:19367152-19367174 CTGGGGGTGGGTGTGGAAGAGGG + Intergenic
970791126 4:19859357-19859379 CTGAGGGTGTGGGTGGGAGGAGG - Intergenic
971558282 4:28040838-28040860 TTGGGGATGTGGGAGGAGGATGG + Intergenic
972951223 4:44325175-44325197 TTGGTGGTTTGGGTGGAAGCTGG + Intronic
973393223 4:49573319-49573341 GTGTGGGTGAGGGTGAAACATGG + Intergenic
973570477 4:52233937-52233959 TTGTGTGTGTGGGGGGGGGAGGG + Intergenic
973747943 4:53982899-53982921 TTGTGGGTGTGCTTGCATGAAGG + Intronic
973879367 4:55253829-55253851 TGGTGGGAGTGGGTTGGAGAGGG - Intergenic
974214167 4:58823512-58823534 GTGTGTGTGTGTGTGGATGAAGG - Intergenic
974518013 4:62941641-62941663 TTGTGGGTGTTTCTCGAAGAGGG - Intergenic
974865017 4:67569732-67569754 TTGTGTGTGTGTGTGTGAGATGG + Intronic
974890549 4:67877019-67877041 TTTTGGGTGTGGGTAGGTGACGG + Intronic
974937762 4:68428779-68428801 GTGTGTGTGTGGGAGGAAGTGGG + Intergenic
975073229 4:70170119-70170141 GTGTGGGTGTGTGGGGAGGAGGG + Intronic
975535952 4:75450583-75450605 TTCTCGGGGTGGGGGGAAGAAGG - Intergenic
976148083 4:82063259-82063281 TTGTGGTTGTGGGAGGCAGGTGG - Intergenic
976269071 4:83212435-83212457 GTGTGGGTGGGGGTGGTGGAGGG + Intergenic
977307989 4:95349369-95349391 GTGTGGGTGTGTGTGTATGAGGG - Intronic
977435767 4:96992396-96992418 TTGTGTGTGTGGGTGGGTGGGGG - Intergenic
977481339 4:97580562-97580584 TTGTGTGTGTGTGTGTGAGAGGG - Intronic
978099886 4:104825661-104825683 TTGAGGGTGAGGGTGGGAGGAGG - Intergenic
978379652 4:108113448-108113470 TTGTGGGGGTGGGAGGGAAACGG + Intronic
978435434 4:108679058-108679080 GTGTGTGTGTGTGTGGTAGAGGG - Intergenic
978759883 4:112345358-112345380 ATGTGGATGTGGGTGGAATGGGG + Intronic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
978783989 4:112588998-112589020 TTATGGGTGTGGTTGGTAGAAGG - Intronic
978829387 4:113066179-113066201 TTGTGGGGCTGGGGGGAGGAGGG - Intronic
979312539 4:119220865-119220887 ATGTGGGTGTGGTTGGTGGATGG + Intronic
979972682 4:127157145-127157167 TGGTGGTTGTGGGGGGACGATGG - Intergenic
980128426 4:128795649-128795671 TTTTGTGTGTGTGTGTAAGATGG + Intergenic
980344229 4:131591593-131591615 TTGTGTTTGTGCGTGGAAGTGGG + Intergenic
980350582 4:131678741-131678763 ATATATGTGTGGGTGGAAGAGGG - Intergenic
980473009 4:133273942-133273964 TTGTGGGTGGGGTGGGGAGAGGG - Intergenic
981555670 4:145990948-145990970 TTGAGGGTGGAGGTGGCAGATGG + Intergenic
981887532 4:149694537-149694559 GTGTGTGTGTGTGTGGAAGGAGG - Intergenic
982512798 4:156304944-156304966 TTGTGGGTGTTTCTCGAAGAGGG + Intergenic
984117718 4:175703174-175703196 TTTTGGGGGTGGGTGGAAGATGG + Intronic
984432231 4:179664277-179664299 GTGTGGGTGAGGGTGAATGAGGG - Intergenic
984494301 4:180475268-180475290 GTGTGGGTGAGGGTGGGTGAAGG + Intergenic
984501853 4:180566910-180566932 GTGTGGGTGAGGGTGAATGAAGG + Intergenic
984784348 4:183554067-183554089 ATGTGGGTGTGGGTGTGAGTGGG + Intergenic
984784350 4:183554073-183554095 GTGTGGGTGTGAGTGGGTGAGGG + Intergenic
985416659 4:189742177-189742199 TTGTGGGAGTGGGTGGCAAATGG + Intergenic
1202764908 4_GL000008v2_random:141600-141622 GTGTGGGTGAGGGTGAAACATGG - Intergenic
986327542 5:6687555-6687577 TTTTGGGTGTGGGGAGAAGGAGG - Intergenic
986377030 5:7142762-7142784 GTGGGGGTGGGAGTGGAAGAAGG - Intergenic
986414588 5:7515910-7515932 TAGAGGGTGTGGGTGGAGGCAGG + Intronic
986591410 5:9374789-9374811 TTGTGGGTGGGGGTGGGTGCGGG - Intronic
986603299 5:9495927-9495949 TAGTGTGTGTGGATGGGAGAGGG - Intronic
986623603 5:9702831-9702853 TTGGGGGTGGGGGTGTCAGATGG + Intronic
987300917 5:16597620-16597642 TTGTGGGTGGGGGAGGACCAAGG - Intronic
987524387 5:19029444-19029466 TTGTAGGTGGGAGTGGAAGGAGG + Intergenic
987717237 5:21587385-21587407 TTGTGGGTGGGGGTGGTTGTAGG + Intergenic
988081986 5:26426462-26426484 TTGTGGGGGTGGGGGGGAGGGGG + Intergenic
988554534 5:32224742-32224764 TTGTATGTGTGTGTGGAAGGTGG + Intergenic
988832135 5:34998212-34998234 TTTTTGGTGAGGTTGGAAGATGG - Exonic
988897991 5:35698884-35698906 CTGTGACTGTGGGTGGACGAAGG + Intronic
989737869 5:44730669-44730691 TTGTGGGTGTTTCTCGAAGAGGG + Intergenic
990259322 5:54004793-54004815 GTGTGTGTGTGTGTGTAAGAGGG + Intronic
991270950 5:64780064-64780086 TGGGGGCTGTGGGTGGAGGAGGG - Intronic
991354581 5:65754672-65754694 TATGGGGTGTGGGAGGAAGAGGG - Intronic
991491279 5:67185282-67185304 GTGTGTGTGTGTGTGTAAGAGGG - Intronic
991959005 5:72022879-72022901 GTGTGTGTGTTGGAGGAAGAGGG - Intergenic
992281812 5:75185550-75185572 TTGTGTGTGTGTGTGTGAGATGG - Intronic
992870396 5:80999679-80999701 TTCTGGGCGTGGGTGGAAGTGGG + Intronic
992949096 5:81839091-81839113 TTGGAGGTGGGGGTTGAAGATGG - Intergenic
992970290 5:82049395-82049417 TTGTGGGGGTGGGGGGAGGGGGG + Intronic
994376711 5:99023114-99023136 TTGTGTGTGTGTGTGGAGGAAGG + Intergenic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
994955788 5:106530184-106530206 TTGTGCAAGTGGTTGGAAGATGG - Intergenic
994980678 5:106872788-106872810 TTCTGGGTGGGGGTGGAATCAGG - Intergenic
995248704 5:109964669-109964691 TTGTGGGTTTGAGTAGAAGGAGG + Intergenic
995356341 5:111242073-111242095 GTTTGGGGGTGAGTGGAAGATGG - Intronic
995501411 5:112811018-112811040 TTGTGTGTGTGTGTGTGAGATGG - Intronic
995961266 5:117842668-117842690 TTGTGGGAGAGGGTGGGAGGAGG + Intergenic
996393817 5:122992323-122992345 TTATGTGGGTGGGTGGTAGATGG - Intronic
996694348 5:126377235-126377257 GTGGGGGTGTGGGTGGCAAAGGG - Intronic
997046257 5:130321657-130321679 TTGAGGGTGGAGGTGGAGGAGGG + Intergenic
997365401 5:133322252-133322274 GTGTGGGTGTGGGTGGGTGTGGG - Intronic
997418585 5:133748564-133748586 TTGTGTGTGTGTGTGTGAGATGG - Intergenic
997582474 5:135026521-135026543 GTGGGGGTGGGGGTGGAATAGGG - Intergenic
997698642 5:135880932-135880954 GTGTGGGTGGGGGTGGGGGATGG - Intronic
997941241 5:138159479-138159501 TAATGGGGGTGGGTGGCAGAGGG - Intronic
998726234 5:145017864-145017886 TTTTGGGTCTGGGTGGAGGTGGG - Intergenic
998816280 5:146017442-146017464 CTGTGAGTGTGGGAGGCAGAGGG - Intronic
998884585 5:146680787-146680809 GTGTTTGTTTGGGTGGAAGAAGG - Intronic
998936706 5:147236657-147236679 TTGTGTGTGTCTGTGGAAGGGGG - Intronic
999075463 5:148791398-148791420 CTGTGGATGTGGGTGGGGGATGG - Intergenic
999156951 5:149464885-149464907 GTGAGGGTCTGGCTGGAAGATGG - Intergenic
999233657 5:150077880-150077902 TTGTGGGGGTGGGTGGGGGGAGG - Intronic
999275927 5:150330211-150330233 TTGAAGGTGTGGGTGGAAGAAGG + Intronic
999366736 5:151028295-151028317 ATGTGGGTGTGGGTGCATGTGGG + Exonic
999391490 5:151195766-151195788 TTGTGGGTGTGGGTGTGTGTGGG - Intronic
999538567 5:152546922-152546944 GTGTGTGTGTGTGTGGCAGAGGG + Intergenic
1000832168 5:166116428-166116450 TTGTGGGTGGGAATGGAAAATGG - Intergenic
1000836758 5:166164650-166164672 TTGTGGGGGTGTTTGGAAGGGGG - Intergenic
1001232055 5:169997057-169997079 TTGTGGGTGTTTCTCGAAGAGGG + Intronic
1001713013 5:173793109-173793131 TTGTGGGTGGGGGTGGGTGGGGG + Intergenic
1001750428 5:174126064-174126086 GTGTGTGTGTGGATGGGAGATGG - Intronic
1001821853 5:174716558-174716580 TAGTGGGGGTGGGTGGGAGTGGG + Intergenic
1002182607 5:177438714-177438736 TAGTGGGTGTGAGTGGAAGTGGG + Intronic
1002442389 5:179271147-179271169 TTGGGGGTGGGGGTGGAGGGAGG + Intronic
1002482749 5:179514145-179514167 TTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1002599930 5:180348295-180348317 CTGTGTGTGTTGGGGGAAGAGGG + Intronic
1002624798 5:180518495-180518517 TTGTGTGTGTGGGGGGGAGGAGG + Intronic
1003368087 6:5496145-5496167 TTTTGGTTGGGGGTGGAAGGAGG + Intronic
1003482280 6:6545346-6545368 TTGTGTGTGTGTGTGGAGGGAGG - Intergenic
1004069919 6:12288568-12288590 GTGTGGGTGTGGGTGTGGGAGGG + Intergenic
1005084723 6:21993254-21993276 TTGTGGGTCTGGGTGAAGCAGGG - Intergenic
1005364136 6:25060501-25060523 TTGTGTGTGTGTGTGGAAAGGGG + Intergenic
1005430407 6:25750776-25750798 TTGTGTGTGTGGGGGGAGGGGGG + Intergenic
1005697528 6:28365186-28365208 TGGAGGGAGTGGGTAGAAGACGG - Intronic
1005797424 6:29380319-29380341 TGGTGTCTGTGGGTGGCAGAAGG - Intronic
1005881648 6:30067037-30067059 CTGCGGGTGTGGGTGGAGGAGGG - Intronic
1005898229 6:30196126-30196148 TTGTGGTTGGGGGTGGCTGAGGG - Intronic
1006201410 6:32295329-32295351 TTGTGTGTGTGTGTGTGAGATGG - Intronic
1006399728 6:33810142-33810164 TTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1006405075 6:33840338-33840360 CTCTGTGTGTGCGTGGAAGAGGG - Intergenic
1006505273 6:34485326-34485348 TAGGGGGTGAGGGTGGAAGCAGG + Intronic
1007244169 6:40448140-40448162 TGATGGGTGTGAGTGGAGGAAGG - Intronic
1007475052 6:42114050-42114072 TGGTGTGTGTGGGAGGAAGACGG + Intronic
1007600353 6:43077125-43077147 CTGCGGGTGAGGGCGGAAGAAGG + Intronic
1007698021 6:43746235-43746257 GTGTGTGTGTGTGTGGAGGAGGG + Intergenic
1007700009 6:43760950-43760972 TCGTGGGTGGTGGTGGTAGACGG + Intergenic
1007748489 6:44057467-44057489 ATTTGGGTGTGGGTGGACGTGGG - Intergenic
1008322143 6:50129125-50129147 TTGTGTGTTTGTGTGGAAGCAGG + Intergenic
1008449294 6:51631655-51631677 TTGGGGGAATGGGTGGAATAAGG + Intronic
1008485726 6:52033341-52033363 TTGTGGGTGTGGGGGCAGGATGG - Intronic
1008542235 6:52555240-52555262 TGGAGGGTGGGGGTGGAAGTGGG - Intronic
1008583038 6:52923436-52923458 TTGTGGGTGTTTCTCGAAGAGGG - Intergenic
1008856926 6:56099663-56099685 ATGTGGGTGTGCGTGTATGAGGG - Intronic
1009602627 6:65821854-65821876 TAGTGGGAGTGGGGGGAAGTGGG + Intergenic
1009740930 6:67745636-67745658 TTGTGGGGTTGGGTGGGGGAGGG - Intergenic
1009950903 6:70394559-70394581 ATGAGGGTGTGCGTGGAAGCAGG + Intergenic
1010196013 6:73241077-73241099 TTGTGGGTGGGGGTGGGGGTGGG - Intronic
1011154721 6:84317527-84317549 GTGTGTGTGTGGGTGGAGCAGGG + Intergenic
1011713476 6:90079279-90079301 TTGTGTGTTTGGTTGGAGGAGGG - Intronic
1012379124 6:98599233-98599255 TTGGGGGTGCAGGTGGAAGGGGG - Intergenic
1013066156 6:106686124-106686146 GTGTGTGTGTGTGTGTAAGAGGG - Intergenic
1013363967 6:109421136-109421158 TGGTGGGTGTGGGAGGGAGGGGG - Intronic
1014317413 6:119884745-119884767 GGGGGGGTGTGTGTGGAAGAGGG - Intergenic
1014633961 6:123821719-123821741 GTGTGGCTGTGGGAGGATGAGGG + Intronic
1015102390 6:129496627-129496649 TTGTGTGTGTAGGGGGAAAAGGG + Intronic
1015380471 6:132561511-132561533 GTGTGTATGTGGGTGGAGGAGGG + Intergenic
1015399126 6:132768629-132768651 TTGAGGGTGTGGGTGGATGGTGG - Intergenic
1015574731 6:134659292-134659314 TTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1015591880 6:134830069-134830091 CTGTGGCTGTGGCTGGAACATGG - Intergenic
1016174462 6:141062211-141062233 AGGTGGGGGTGGGGGGAAGATGG + Intergenic
1016386995 6:143538087-143538109 GTGTGTGTGTGTGTGTAAGACGG - Intronic
1016665612 6:146636614-146636636 GTGTGGGTGTGGGTGGGTGTGGG + Intronic
1017523141 6:155219728-155219750 TGCTGGGTGTGGCAGGAAGACGG + Intronic
1017859056 6:158378487-158378509 GTGGGGGTGGGGGTGGGAGATGG + Intronic
1018102070 6:160449242-160449264 TGGGGAGTGTGGGTGGAAGGGGG + Intronic
1018767433 6:166945135-166945157 GTGTGGACGTGGGTGGATGAGGG - Intronic
1019004366 6:168784100-168784122 TTGTGTGTGTGTGTGTGAGACGG + Intergenic
1019130913 6:169873843-169873865 GTGTGGGGGTGGGAGGTAGATGG - Intergenic
1019158938 6:170056885-170056907 CTGTAGGTGTGGGGGAAAGATGG - Intergenic
1019378361 7:708238-708260 TTCTGGGTCTGTGTGGGAGAAGG - Intronic
1019406383 7:886250-886272 CTGGGGCTGTGGGTGGCAGAGGG + Intronic
1019433676 7:1011152-1011174 TGGTGGGTGTGGGTGGGTGTGGG - Intronic
1020164576 7:5797841-5797863 TGGTGGGTGTGGCTGGGTGAGGG + Intergenic
1020214557 7:6179780-6179802 TGGTGGGTGTGTGTGGTAGGTGG - Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020353346 7:7248871-7248893 AGATGGGTGGGGGTGGAAGAGGG + Intergenic
1020359307 7:7310364-7310386 TTTTAGGTGAGGGTGGGAGATGG - Intergenic
1020434866 7:8151718-8151740 ATGTGGAGGTGGGTGGAAGAAGG + Intronic
1020930455 7:14386783-14386805 TTCTGAGGGTGGGTGGCAGAAGG + Intronic
1020976622 7:15014438-15014460 TGGTGGGTGTGGGTGAAATGAGG + Intergenic
1021142726 7:17047676-17047698 TTGTGGGTCAGGGAGGCAGAAGG - Intergenic
1021345158 7:19518217-19518239 TTGTGGGGTTGGGGGGAAGGGGG + Intergenic
1021403479 7:20237190-20237212 TGGTGGGGGTGGGTGGGAGGTGG + Intergenic
1021632279 7:22659211-22659233 TTGGGGGGGTGGGGGGAAGTGGG - Intergenic
1023177335 7:37447614-37447636 TTGTGGGTGTGTGTGTGAGTCGG - Intronic
1023319242 7:38975863-38975885 CTGGGGGTGTGGGTGGAGGTGGG - Intergenic
1023862998 7:44226797-44226819 GGGGGGGTGTGGGGGGAAGATGG + Intronic
1023931844 7:44711053-44711075 GGGTGGGTGAGGGTGAAAGAGGG + Intergenic
1024030654 7:45456968-45456990 TTGAGGGTGGGGTTGGAAGTGGG - Intergenic
1024712262 7:52029430-52029452 GTGTGGGTGTGGATGGATGGTGG - Intergenic
1024720604 7:52133769-52133791 GAGTGGGTGTGGATTGAAGAAGG + Intergenic
1024969548 7:55055693-55055715 GTGTGTGTGTGCGTGCAAGAGGG - Intronic
1025844769 7:65186219-65186241 TTGGGGGTGTGGGTGGAGTAGGG + Intergenic
1025895097 7:65692552-65692574 TTGGGGGTGTGGGTGGAGTAGGG + Intergenic
1026399947 7:69999741-69999763 TTGTGTGTGTGTGTGGCAGGGGG - Intronic
1026855946 7:73754991-73755013 TTGAGGGTGAGGGTGGGAGGAGG + Intergenic
1027113220 7:75457379-75457401 TTGTGGGGGTTGGGGGATGAAGG - Intronic
1027285470 7:76641974-76641996 TTGTGGGGGTTGGGGGATGAAGG - Intergenic
1027455861 7:78390949-78390971 CTTTGGGTGAGGGTGGGAGATGG + Intronic
1028087272 7:86651829-86651851 TTTTGGGTGTTGGGGGAAGTGGG - Intronic
1028318752 7:89435687-89435709 TTGTCTGGCTGGGTGGAAGAGGG - Intergenic
1028399625 7:90410703-90410725 TTGTGGGGGTGGAAGGAGGAGGG + Intronic
1028743477 7:94302126-94302148 TTTTGGGCTTGGGTGGATGAGGG - Intergenic
1029222606 7:99002384-99002406 ATGCTGGTGTGGGAGGAAGAGGG + Intronic
1029493295 7:100883957-100883979 TTGTGGTTGTGAGAGGAAGGGGG + Intronic
1030283267 7:107798917-107798939 TTGGGGGAGTGGGTGAGAGATGG + Intronic
1030751006 7:113232686-113232708 TTGTGGTTGTGGGTGGGTCAGGG + Intergenic
1031284331 7:119844724-119844746 GTGTGTGTGTGGGTGGAAGGCGG + Intergenic
1031409965 7:121429884-121429906 TTGTGTGTGTGGGGGGGGGAGGG - Intergenic
1031795476 7:126168923-126168945 TTGTGGGTGTTTCTCGAAGAGGG - Intergenic
1032485696 7:132285920-132285942 TTGTGGGTGGGGGTGGTGGGTGG - Intronic
1032805253 7:135347869-135347891 TTTGGGGTGGGGGTGGCAGAGGG - Intergenic
1032848657 7:135773477-135773499 TTTTGTGTGTGCGTGGATGAGGG - Intergenic
1033143623 7:138851568-138851590 GTGGGGGTGTGTGTGGAAGGGGG + Intronic
1033158346 7:138975279-138975301 TTGAGTGTGTGGATGCAAGAGGG + Intronic
1033263553 7:139865308-139865330 TTGTGGGTGTGGGTGAGAAATGG + Intronic
1033648288 7:143321558-143321580 CTGTGGGTGGGGCTGGATGATGG - Intronic
1033928913 7:146499587-146499609 TTCGGGGTGTGGGGGGAGGAAGG - Intronic
1034313495 7:150110443-150110465 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034313514 7:150110512-150110534 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034313532 7:150110581-150110603 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034343121 7:150370375-150370397 TAATTTGTGTGGGTGGAAGAGGG + Intronic
1034427810 7:151023845-151023867 GTGTGGGTGTGGGTGGGAGAGGG - Intronic
1034480177 7:151313957-151313979 GTGTGAGTGTGGGTGTGAGATGG + Intergenic
1034636846 7:152574491-152574513 TTTTGTGTGTGTGTGGGAGAGGG + Intergenic
1034749243 7:153553545-153553567 TTGTGTGTGTGTGTGGAGGTAGG - Intergenic
1034793365 7:153990221-153990243 CTGAGGGTGGGGCTGGAAGAGGG - Intronic
1035367798 7:158360386-158360408 TCCTGGGTGTGGGTGGATGTGGG - Intronic
1035367834 7:158360526-158360548 TCCTGGGTGTGGGTGGATGTGGG - Intronic
1035367852 7:158360596-158360618 TCCTGGGTGTGGGTGGATGTGGG - Intronic
1035367870 7:158360666-158360688 TCCTGGGTGTGGGTGGATGTGGG - Intronic
1035367974 7:158361051-158361073 TCCTGGGTGTGGGTGGATGTGGG - Intronic
1036257709 8:7218818-7218840 GTGGGGGTGGGGGTGGAGGATGG - Intergenic
1036279164 8:7384683-7384705 TTTTGGGTGTGGGAGAAAGATGG + Intronic
1036309758 8:7677414-7677436 GTGGGGGTGGGGGTGGAGGATGG - Intergenic
1036342352 8:7927190-7927212 TTTTGGGTGTGGGAGAAAGATGG - Intronic
1036359778 8:8068705-8068727 GTGGGGGTGGGGGTGGAGGATGG + Intergenic
1036561549 8:9903778-9903800 ATGGGGGTGTGGGTGGAAGTGGG + Intergenic
1036776681 8:11617666-11617688 TTGGGGGTGTGGGAGGAAGAGGG - Intergenic
1036891182 8:12598265-12598287 GTGGGGGTGGGGGTGGAGGATGG - Intergenic
1037121582 8:15294126-15294148 TTGGGGGTGGGGGTGGGGGAGGG + Intergenic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037767531 8:21781321-21781343 TCGTGGGTGGTGGTGGAAGTGGG - Intronic
1038495333 8:27998022-27998044 TTGTGGGTCAGGGTGGTTGACGG - Intergenic
1038497641 8:28015092-28015114 TTTTAAGTGTGGGTGGAGGAGGG - Intergenic
1038617940 8:29112656-29112678 TTGAGGGTGAGGGTGGGAGAAGG + Intronic
1039129162 8:34242100-34242122 TTATGTGTGTGTGTGAAAGAGGG + Intergenic
1039153767 8:34532375-34532397 ATGAGGGTGTGGCTGGAAGCAGG + Intergenic
1039550565 8:38440167-38440189 TTGTGGGTGGGGGAGGAACTCGG + Intronic
1039924346 8:41915736-41915758 TTGCAGGTTTGGGGGGAAGATGG - Intergenic
1040102338 8:43516717-43516739 TGGTGGGTGAGGGTGGAGGATGG + Intergenic
1040413252 8:47176215-47176237 TTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1040426273 8:47290041-47290063 TTGTGTGTGTGTGTGTGAGATGG + Intronic
1040453149 8:47568581-47568603 ATGAGGTTGAGGGTGGAAGATGG - Intronic
1040680658 8:49804360-49804382 GTGTGTGTGTGTGTGTAAGAAGG + Intergenic
1041425150 8:57712694-57712716 TTCTGGGTGTGGATGGTTGAGGG - Intergenic
1041732259 8:61074723-61074745 TTGTGGGAGTGGGTGGATGGTGG + Intronic
1041908269 8:63057668-63057690 GTATGGGTGTGGGAGGAGGATGG + Intronic
1042016017 8:64312581-64312603 GTGTGTGTGTGTGTGCAAGATGG - Intergenic
1042619541 8:70690249-70690271 TTGAGGGGGAGGGTGGAAGGAGG - Intronic
1043130611 8:76456144-76456166 TTGGGGGTGTGGGGTGAGGAAGG + Intergenic
1043300590 8:78726094-78726116 ATGTGAGGGAGGGTGGAAGAGGG + Intronic
1043991000 8:86754526-86754548 TTGTGGGGGTGGGGGGAAAGGGG - Intergenic
1044310226 8:90684795-90684817 TTGTGGGTGTTTCTCGAAGAGGG - Intronic
1044932202 8:97261054-97261076 TTGTGAATGTGGGTGGCAGAGGG - Intergenic
1045474614 8:102542514-102542536 AGGTGGGTGTGGGAGGAGGAGGG - Intergenic
1045477557 8:102566261-102566283 TTGTGATCCTGGGTGGAAGATGG + Intergenic
1046235416 8:111417996-111418018 TTGTGGACTTGGGTGGAAGGGGG + Intergenic
1046587595 8:116167097-116167119 TCAGGGGTGGGGGTGGAAGAGGG - Intergenic
1046996210 8:120526735-120526757 TGGTGGGTGGGGTTGGAAGAGGG + Intronic
1047141670 8:122147797-122147819 GTGTGTGTGTGTGTGGAGGATGG - Intergenic
1047573316 8:126125975-126125997 TTTTGTGTGAGGGTGGAAGGGGG - Intergenic
1048071879 8:131029852-131029874 GTGTGGGTGGGGGTGGAGTAGGG + Intronic
1048813835 8:138312660-138312682 TTGCTGGTGTGGGTGGAGGTGGG - Intronic
1048881678 8:138877109-138877131 TTGTGGCTGGGGGTGGGGGAGGG - Intronic
1049231723 8:141488266-141488288 TTGAGGGGGAGGGAGGAAGATGG - Intergenic
1049405146 8:142449069-142449091 TGGTGGGTGTAGATGGAAGTGGG - Intergenic
1049663683 8:143832752-143832774 TTGTGGGTGTTTCTCGAAGAGGG - Intergenic
1050507779 9:6365264-6365286 TTGTGTGTTTGGGTGGCAGGAGG + Intergenic
1050584556 9:7097070-7097092 ATGTGGGAGTGGGATGAAGAAGG - Intergenic
1050738165 9:8788277-8788299 TTGTGTGTGTGTGTGTGAGATGG + Intronic
1051330856 9:16023834-16023856 TTGTGGGGGTGGGGGGAGGGTGG - Intronic
1051366236 9:16323366-16323388 TTGTGGCTGTGGCTGGAGGCAGG - Intergenic
1051389537 9:16549110-16549132 TTTTGGATGTAGGGGGAAGAGGG - Intronic
1051472822 9:17468237-17468259 TTGAGGGTGAGGGTGGGAGGAGG + Intronic
1051680518 9:19603168-19603190 TTGTGGGGGTAGGTGGATGGGGG + Intronic
1051906521 9:22101657-22101679 GTGTGTGTGTGTGTTGAAGAGGG - Intergenic
1052330599 9:27263796-27263818 TTGTTGGTGTTGCTGGATGATGG - Intergenic
1052480860 9:29024019-29024041 TATTGGTTGTGGGTGGAAGGAGG - Intergenic
1052676529 9:31633061-31633083 TTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1052879226 9:33590474-33590496 CTGGGGGTGGGGGTGAAAGATGG + Intergenic
1053026304 9:34731417-34731439 GTGGGGGTTTGGGTGGGAGAAGG - Intergenic
1053496752 9:38553745-38553767 CTGGGGGTGGGGGTGAAAGATGG - Intronic
1053662744 9:40295848-40295870 GGGTGGGTGTGGATGGAAAAAGG + Intronic
1053913190 9:42926023-42926045 GGGTGGGTGTGGATGGAAAAAGG + Intergenic
1054374874 9:64442072-64442094 GGGTGGGTGTGGATGGAAAAAGG + Intergenic
1054521869 9:66080436-66080458 GGGTGGGTGTGGATGGAAAAAGG - Intergenic
1054697067 9:68371186-68371208 GTCTGGGTTTGGCTGGAAGAAGG - Intronic
1054880191 9:70136518-70136540 GTGTGGGAGGGGGTGGAAGGTGG - Intronic
1055166150 9:73196630-73196652 GTGTGTGTGTGTGTGGAAAAAGG - Intergenic
1055762344 9:79622341-79622363 ATGTCTGTGTGGCTGGAAGAGGG - Intronic
1055831028 9:80379096-80379118 GTTGGGATGTGGGTGGAAGAGGG - Intergenic
1056102068 9:83309186-83309208 TTGTGGGGGTGGGGGGAGGAGGG + Intronic
1056567635 9:87788839-87788861 TTGTGTGTGTGTGTGTGAGATGG + Intergenic
1056672657 9:88644188-88644210 TTGTGGGTGGGAATGTAAGATGG - Intergenic
1056780933 9:89550413-89550435 TTCTGGGATTGGGAGGAAGACGG - Intergenic
1056885447 9:90438833-90438855 TTGAAGCAGTGGGTGGAAGAGGG + Intergenic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057676667 9:97141301-97141323 CTGGGGGTGGGGGTGAAAGATGG - Intergenic
1057791399 9:98127364-98127386 TTGTGGGGGTGGAAGGGAGAGGG + Intronic
1058179459 9:101779139-101779161 GTGTGGGTGGGGGAGGAAGCTGG - Intergenic
1058293297 9:103272310-103272332 TTGGGGGTGGGGGTGCAAGTGGG - Intergenic
1058442130 9:105019196-105019218 TTGGGGAAGTGGGTGGAGGAAGG - Intergenic
1058802172 9:108555235-108555257 TGGTGGGAGTGGGAGGGAGATGG + Intergenic
1058887118 9:109329988-109330010 GTTTAGGTGTGGGTGGAAGGAGG + Intergenic
1058892230 9:109371003-109371025 TTGGGGTGGTGGCTGGAAGATGG + Intergenic
1059174186 9:112154315-112154337 TTGTGTGTGTGTGTGGAGGTGGG - Intronic
1059453721 9:114386951-114386973 GTGTGGGTGGGGGTAGAAGCAGG - Intronic
1059459071 9:114418285-114418307 GTGTGGGGGTGGGGAGAAGAGGG + Intronic
1060003903 9:119982725-119982747 TTGGATGTGTTGGTGGAAGATGG + Intergenic
1060426825 9:123513209-123513231 GTGTGGGTGTGGGGTGAACAAGG - Intronic
1060554852 9:124503007-124503029 TAGGGGGTGGGGGTGGGAGAGGG - Intronic
1060649757 9:125315253-125315275 TTGTGTGTGTGTGTGGAGGATGG - Intronic
1060925864 9:127454696-127454718 CTGTGGGTGGGGGAGGCAGATGG - Intronic
1061201765 9:129142145-129142167 TTTTGGCTGTGGGAGAAAGAGGG + Intronic
1061451267 9:130668084-130668106 GTGTGGATGTGCCTGGAAGATGG + Intronic
1061810477 9:133159796-133159818 TTGTGTGTGTGCGTGGCGGAGGG - Intronic
1062248872 9:135584255-135584277 TGGTGGGGGTGGGTGGGATAAGG - Intergenic
1062614719 9:137391140-137391162 CTGTGGCTGTGGGTGGACGTGGG - Intronic
1203545658 Un_KI270743v1:126488-126510 GTGTGGGTGAGGGTGAAACATGG - Intergenic
1185464344 X:346049-346071 GTGGGGGTGGGGGTGGGAGAGGG + Intronic
1185622987 X:1464788-1464810 GTGTGTGTGTGGGGGGAAGTGGG + Exonic
1185631094 X:1516286-1516308 TTGTGGGAGAGGGGTGAAGAAGG - Intronic
1185910159 X:3973590-3973612 TTCTGGGTGTGACTGGAACAGGG - Intergenic
1186016800 X:5204805-5204827 GTGTGTGTGTGTGTGGCAGAGGG + Intergenic
1186254889 X:7707772-7707794 TTGTAGGTGTGGGGAAAAGAAGG - Intergenic
1186265924 X:7833777-7833799 CTGTGTGTGTGGGTGGGAGGAGG - Intergenic
1186317016 X:8382031-8382053 TGGTGGGTGGAGGTGGAAGGGGG + Intergenic
1187246326 X:17555775-17555797 TCCTGGGGGTGGGTGGAGGAGGG - Intronic
1187955064 X:24509477-24509499 ATGTGTGTGTTGGGGGAAGAGGG - Intronic
1188340693 X:28997774-28997796 TTGTGGGGGTGGGGGGAACATGG - Intronic
1189060297 X:37746544-37746566 TTGTGGGTGTGGGTGGACATGGG - Intronic
1189178692 X:38982855-38982877 TAGGGGGTGTGGATGGAAGGAGG + Intergenic
1189185217 X:39049001-39049023 GTGTGTGTGTGTGTGGTAGAAGG - Intergenic
1189260509 X:39675318-39675340 TTGCTGGTGTGGGTGGCAGCAGG - Intergenic
1189334411 X:40161980-40162002 TTTGGAGTGTGGGTGGGAGAAGG - Intronic
1190234638 X:48606174-48606196 TTGGGGGTGGGGGTAGAAGCAGG + Exonic
1190277872 X:48910916-48910938 TTGTGAGTGTGGGTAGAGCAAGG - Intronic
1190466468 X:50729007-50729029 TTGGGGGTGGGGGTGGGAGATGG + Intronic
1190914648 X:54802147-54802169 TTGAGGGGGTGGGAGGGAGATGG + Intergenic
1191927061 X:66324746-66324768 GTGTGGGTGTGGGTGGAGATGGG + Intergenic
1192072756 X:67958495-67958517 ATGTGTGTGTGGGTGGGGGAGGG - Intergenic
1192473486 X:71419734-71419756 AGGTGGGTGTGGGTGGTAGGAGG - Intronic
1192762584 X:74109097-74109119 TTGTGGGGAAGGGTGGGAGAGGG + Intergenic
1193197751 X:78654753-78654775 GTATGTGTGTGGGTGGAAGTGGG + Intergenic
1193509972 X:82387737-82387759 TTCTGGGTGTGAGTAGCAGAGGG + Intergenic
1194128446 X:90049113-90049135 ATGTAGGTGTAGATGGAAGAGGG - Intergenic
1194249977 X:91562729-91562751 CTGTGTCTCTGGGTGGAAGAGGG + Intergenic
1194406309 X:93500134-93500156 TTGGGGGTGTGGTGGGAGGAGGG + Intergenic
1194748606 X:97658369-97658391 TTGAGGAGGTGGGTGGGAGAAGG - Intergenic
1194968893 X:100320932-100320954 TTGGGGGGATGGGTGGAAGGGGG - Intronic
1195406614 X:104521536-104521558 GTGTGTGTGTGTGTGTAAGAAGG + Intergenic
1195942316 X:110176347-110176369 TTGTGCCTCTGGGAGGAAGATGG - Exonic
1196050512 X:111298962-111298984 GTGTGTGTGTGTGTGTAAGAAGG + Exonic
1196169261 X:112569433-112569455 TTGTTGGTGTGTGTGAGAGAGGG + Intergenic
1196871364 X:120116116-120116138 ATGGGGGTGTGGGTGGAGGGTGG + Intergenic
1196898596 X:120361750-120361772 GGGTGGGTGTGGGTGGGAGTTGG - Intergenic
1196925993 X:120633867-120633889 TTGTGTGTGTGTGTGTGAGACGG - Intergenic
1197115203 X:122823831-122823853 TGTTGGGGGTGGGTGGAAGGAGG + Intergenic
1197170344 X:123426924-123426946 CTGTGTGTGGGGGTGGAAGGGGG + Intronic
1197180934 X:123535837-123535859 TTGTGGGTGGGGGAGGGAGGAGG + Intergenic
1197196852 X:123711002-123711024 TTGGGTGTGTGAGTGGAAGATGG - Intronic
1197207076 X:123799572-123799594 TTGTGGGAGTTGGTGGCTGAAGG - Intergenic
1197637752 X:128934265-128934287 TTGTGTGTGTGGGTGAAGGGAGG + Intergenic
1197879143 X:131146581-131146603 TTGTGTGTGTGTGTGGAGGCGGG + Intergenic
1197888388 X:131241379-131241401 TTGTTGTTTTTGGTGGAAGATGG + Intergenic
1198651212 X:138865656-138865678 TGGTGGGTGAGGCTGGAACAGGG - Intronic
1199025683 X:142934795-142934817 TGGTGCATGTGGGTGGGAGATGG + Intergenic
1199109873 X:143918677-143918699 TTGGGGATGTGGGTGGAAAATGG + Intergenic
1199963851 X:152801547-152801569 TTGGGGGAGAGGATGGAAGAGGG + Intergenic
1200568940 Y:4803978-4804000 CTGTGTCTCTGGGTGGAAGAGGG + Intergenic
1201297211 Y:12474221-12474243 TTCTGGGTGTGACTGGAACAGGG + Intergenic
1201556526 Y:15268828-15268850 TTCTGGGTGTGACTGGAACAGGG - Intergenic
1201570830 Y:15412107-15412129 TTGTGGGGGTTGGGGGAAGGGGG + Intergenic