ID: 1184709983

View in Genome Browser
Species Human (GRCh38)
Location 22:46244170-46244192
Sequence GGAGATGGGGAGCCTGGAGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 753
Summary {0: 1, 1: 1, 2: 8, 3: 65, 4: 678}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184709979_1184709983 -9 Left 1184709979 22:46244156-46244178 CCTGGAAGCTTCAGGGAGATGGG 0: 2
1: 0
2: 4
3: 36
4: 318
Right 1184709983 22:46244170-46244192 GGAGATGGGGAGCCTGGAGTAGG 0: 1
1: 1
2: 8
3: 65
4: 678
1184709972_1184709983 6 Left 1184709972 22:46244141-46244163 CCCACCAGCTGCTACCCTGGAAG 0: 1
1: 0
2: 2
3: 18
4: 204
Right 1184709983 22:46244170-46244192 GGAGATGGGGAGCCTGGAGTAGG 0: 1
1: 1
2: 8
3: 65
4: 678
1184709977_1184709983 -8 Left 1184709977 22:46244155-46244177 CCCTGGAAGCTTCAGGGAGATGG 0: 1
1: 0
2: 0
3: 25
4: 355
Right 1184709983 22:46244170-46244192 GGAGATGGGGAGCCTGGAGTAGG 0: 1
1: 1
2: 8
3: 65
4: 678
1184709970_1184709983 27 Left 1184709970 22:46244120-46244142 CCAGAGCTCACAGATCAGTGTCC 0: 1
1: 1
2: 0
3: 15
4: 176
Right 1184709983 22:46244170-46244192 GGAGATGGGGAGCCTGGAGTAGG 0: 1
1: 1
2: 8
3: 65
4: 678
1184709973_1184709983 5 Left 1184709973 22:46244142-46244164 CCACCAGCTGCTACCCTGGAAGC 0: 1
1: 0
2: 5
3: 11
4: 271
Right 1184709983 22:46244170-46244192 GGAGATGGGGAGCCTGGAGTAGG 0: 1
1: 1
2: 8
3: 65
4: 678
1184709974_1184709983 2 Left 1184709974 22:46244145-46244167 CCAGCTGCTACCCTGGAAGCTTC 0: 1
1: 0
2: 0
3: 19
4: 220
Right 1184709983 22:46244170-46244192 GGAGATGGGGAGCCTGGAGTAGG 0: 1
1: 1
2: 8
3: 65
4: 678

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184709983 Original CRISPR GGAGATGGGGAGCCTGGAGT AGG Exonic
900114315 1:1021938-1021960 GGAGCTGGGGTGGCTGAAGTTGG + Intronic
900151115 1:1179771-1179793 GGGGGTGGGGAGCTTGGAGCAGG - Intronic
900522168 1:3111065-3111087 TGAGATGGGGAAGCTGGAGGTGG + Intronic
900548741 1:3243122-3243144 CGAGACAGGGAGGCTGGAGTGGG - Intronic
900566008 1:3332127-3332149 GGAGATGCGGAGCCTGAAAATGG - Intronic
901629753 1:10642310-10642332 GGAGCCGGGCAGCCTGGAGAGGG + Intronic
901633803 1:10660364-10660386 GGAGGTGGGCAGCATGGAGGAGG + Exonic
901688836 1:10959664-10959686 AGAGGTGGGTAGCCTTGAGTTGG - Intronic
901789687 1:11647729-11647751 GGAGGTGAGGGGCCTGGGGTAGG - Intergenic
901870711 1:12137751-12137773 GGAGGTGGGGGACCTGGAGCTGG + Intronic
902223357 1:14980874-14980896 GGAGGTGGGGTGGCTGGAGGAGG + Intronic
902612421 1:17605003-17605025 GCATATGGGGATCCTGGGGTGGG - Intronic
902794003 1:18788383-18788405 GGAGGTAGGGAGGCTGGGGTGGG - Intergenic
902794521 1:18792612-18792634 GGGCATGGGGAGGCTGGAGGTGG - Intergenic
902816596 1:18919784-18919806 GGAGATGGGGAGGCTTCAGAGGG + Intronic
903344421 1:22675348-22675370 GGAGATGGGCAGGCAGGAGAAGG - Intergenic
903667056 1:25014434-25014456 GAAAATGGGGAGGCTGCAGTGGG - Intergenic
903953545 1:27010401-27010423 GGAGAGGGGGAGGGTGGTGTCGG - Intronic
904031596 1:27536784-27536806 GGAGCAGGGGAGGCTGGCGTTGG - Intronic
904033406 1:27547060-27547082 GGAGATGGGGTGCTTGGGCTGGG - Intronic
904667987 1:32138584-32138606 GGAGATCGTGAGCTTGGAGTGGG + Intronic
904813971 1:33181773-33181795 GGAGAAGGGGATCCCGGAGCGGG + Intronic
905361398 1:37423339-37423361 GGAGATGGGGAAGCAGGAGGAGG - Intergenic
905365335 1:37448223-37448245 TGAGCTGGAGAGCCTGGAGGAGG - Intergenic
905896295 1:41547924-41547946 GGTGCTAGGGAGGCTGGAGTGGG - Intronic
905897644 1:41558946-41558968 GGAGTGGGGCAGCATGGAGTGGG - Intronic
906797896 1:48712109-48712131 GGAGAAGGGGAGCCTTGAGTTGG - Intronic
907281214 1:53348618-53348640 GGGCATGGGGAGGCTGGAGAGGG + Intergenic
907305998 1:53513525-53513547 GGAGGAGGTGAGGCTGGAGTTGG - Intronic
907471632 1:54677809-54677831 GGATATGGGGACACAGGAGTGGG + Intronic
907733174 1:57087296-57087318 GGAGATGCAGAGCCTGGGCTGGG + Intronic
908618567 1:65950378-65950400 AAAGATGGGGATCCTGGAGTTGG - Intronic
908769362 1:67582436-67582458 GGTTATGAGGTGCCTGGAGTGGG - Intergenic
908824600 1:68121299-68121321 TGAGATGCTGAGCCTGGGGTAGG + Intronic
908878656 1:68706372-68706394 GGGGATGGGGAGGGTGGAGTGGG + Intergenic
909451259 1:75800139-75800161 GGAGATGCGGAAACTGGAGATGG - Intronic
910842937 1:91578160-91578182 GGAAATGGGGAGTCAGGGGTTGG + Intergenic
911205390 1:95087103-95087125 GGAGATGGGGAGCAGGGTGTAGG - Intergenic
911702793 1:100974040-100974062 GGAGATGGGGAGCCCAGAAGGGG + Intronic
912448023 1:109752091-109752113 GGGGCTGGAGGGCCTGGAGTTGG + Exonic
912822764 1:112881042-112881064 GGGGGTGGGCAGCCTGGAGGAGG + Intergenic
914345389 1:146794472-146794494 GGAGAAGGAGCGCCTGGAGAGGG + Intergenic
914827256 1:151145298-151145320 GGAGAAGGGGAGACTGGGCTGGG + Intronic
914858898 1:151370827-151370849 GCAAGTGGGGAGCCAGGAGTAGG + Intronic
914861238 1:151387994-151388016 GGAACTGGGGAGGCTGAAGTGGG + Intergenic
914901358 1:151712772-151712794 AGAGATGGGGAGCAAGGAGAGGG + Intronic
915103416 1:153516447-153516469 GGAGACCTGGAGCCTGGAGAAGG - Intergenic
915107856 1:153545673-153545695 GGAGAAGGGGAGGCTGGTGGGGG - Intronic
915282775 1:154833856-154833878 GAAGATAGAGAACCTGGAGTAGG - Intronic
915306508 1:154982827-154982849 GGATATGAAGACCCTGGAGTAGG - Intergenic
915581323 1:156814892-156814914 TGGGAGTGGGAGCCTGGAGTGGG + Intronic
916574955 1:166059093-166059115 GGAGTTTGGGAACCTGGAGAAGG + Intronic
917197764 1:172484522-172484544 GGAGATGGGCAGTATGAAGTAGG + Intergenic
917554524 1:176070108-176070130 AGAGATGGGGATACTGGAGGAGG - Intronic
918046967 1:180947454-180947476 GGAGATGGGGAGAGGGGAGAGGG + Exonic
918305235 1:183240039-183240061 GGAGATTGGGAGTCTGAACTTGG + Exonic
918384030 1:183986901-183986923 TGTGGTGGGGAGCCTGGAGTGGG - Intronic
918519170 1:185396269-185396291 GGAGCTGTGGAGCTTGGATTAGG + Intergenic
919758642 1:201082483-201082505 GGAGGAGGGGATCCTGGAGAAGG - Intronic
919933394 1:202236080-202236102 GGAGAGGGGGCGCCTGCAGAGGG - Intronic
920213429 1:204345466-204345488 AGAGATGGGGAGTGTGGAGAGGG - Intronic
920299276 1:204978503-204978525 GGAGATGGGAACCCAGGAGAGGG - Intronic
922574174 1:226651312-226651334 GGAAAAGGGGAGCCGGGACTCGG - Intronic
922586092 1:226736290-226736312 GGCTCTGGGGAGCCTGAAGTGGG - Exonic
923659570 1:235946509-235946531 GAACAGGGGGAGCTTGGAGTAGG - Intergenic
923950111 1:238940796-238940818 GGGGCTGGAGGGCCTGGAGTAGG + Intergenic
1062837321 10:644243-644265 GGGGATGGGGAGGCTGCAGGAGG + Intronic
1063228871 10:4044026-4044048 GGAGGTAGGAAGCCTGGAGCTGG - Intergenic
1063590856 10:7394356-7394378 GGAGATGGGGACGCGGGAGAAGG - Intronic
1064005674 10:11697042-11697064 GGAGATGAGGAGTCTGGTCTTGG - Intergenic
1065188187 10:23189230-23189252 GCAGTTGGGGAGCCTGGAGAGGG - Intergenic
1066004453 10:31133920-31133942 GGAGCTGGGGAGCCGGGGGCGGG + Intergenic
1066648799 10:37636690-37636712 GGAGATGGGGACACAGGAGAAGG + Intergenic
1067068755 10:43117931-43117953 GGAAATGGGGAGCCTGGTCGCGG + Intronic
1067261935 10:44700365-44700387 GGAGATGGGGAGACAGGTGCTGG - Intergenic
1067287974 10:44921308-44921330 GTAGCTGGGGAGCCTGAGGTGGG + Intronic
1067890132 10:50127936-50127958 GGGGGTGGGGAGAATGGAGTGGG - Intronic
1068052149 10:51963692-51963714 GCATGTGGGGAGGCTGGAGTGGG - Intronic
1069107872 10:64405746-64405768 AGAGTAGGGAAGCCTGGAGTGGG + Intergenic
1069775878 10:70926794-70926816 GGAAATGGGGAGGCAGGAGCTGG + Intergenic
1069837118 10:71316575-71316597 AGGGATGGGGAGGCTGGGGTGGG - Intergenic
1070754157 10:78981411-78981433 GGTGATGGGCAGACTGGGGTAGG + Intergenic
1071294022 10:84206300-84206322 AAAGATGGGCAGCCTGGAGAAGG + Intronic
1071511262 10:86264013-86264035 GCAGGTGGGCAGCCTGGATTCGG - Intronic
1071921208 10:90352545-90352567 GGAGATCGGAAGCCTTCAGTGGG - Intergenic
1072297069 10:94019451-94019473 GGTGATGGGGAGGGTGGACTGGG - Intronic
1073113014 10:101073835-101073857 GGAGATGGGGAGAGGGGAGAGGG + Intergenic
1073326671 10:102647382-102647404 GGGGAGGGGGAACCTGGAGAAGG - Intronic
1073441422 10:103555097-103555119 GGAGGTGGGGAGGCTGGAGTGGG + Intronic
1073934530 10:108615320-108615342 TGAGATGGGGAGACTGGAATAGG - Intergenic
1074193494 10:111158711-111158733 TGAGATATGGAGCCTGGAGAGGG + Intergenic
1074273575 10:111979262-111979284 GGGGCTGGAGAGCGTGGAGTCGG - Intergenic
1074406053 10:113181122-113181144 GAGGAGGGGGAGGCTGGAGTGGG - Intergenic
1074607394 10:114987279-114987301 GGAGGAGGGGAGCATAGAGTAGG - Intergenic
1074610503 10:115016815-115016837 GGAGAAGGAGAGTCTGGAGGGGG + Intergenic
1074780116 10:116796501-116796523 GGGGATGGGGAGGCAGGAGCAGG - Intergenic
1074855028 10:117467129-117467151 GCAATAGGGGAGCCTGGAGTGGG + Intergenic
1075449541 10:122540189-122540211 GCAGGTGGGCTGCCTGGAGTTGG + Intergenic
1075573598 10:123562687-123562709 GGGGATGGGGAGCCTGGTGAAGG - Intergenic
1075928251 10:126270964-126270986 GGAGATCAGGAGCCGGCAGTGGG - Intronic
1076097187 10:127740862-127740884 GGAGAGAAGGAGCCAGGAGTTGG + Exonic
1076206713 10:128609847-128609869 GGAGAAGGGATGCCTGGAGCAGG + Intergenic
1076611342 10:131727715-131727737 GGCTCTGGGGAGCCTGGACTGGG - Intergenic
1076835154 10:133017212-133017234 GGCGATGGGGAGCGTGGCGACGG - Intergenic
1076893848 10:133299108-133299130 GGAAATGGGGAGTCAGGATTGGG + Intronic
1077058896 11:609170-609192 GGACAGGGGGAGCCTGCAGGGGG - Exonic
1077173250 11:1177678-1177700 GGAGGTGGGGAGCGTGGAACAGG + Intronic
1077244882 11:1531929-1531951 TGGGATGGGGTGCCTGGAGGGGG - Intergenic
1077431938 11:2520113-2520135 GGCGCTGGGGCCCCTGGAGTCGG + Intronic
1079111989 11:17610258-17610280 GGAGGTGGGGGACCTGGAGATGG - Exonic
1080153080 11:29076492-29076514 GGAGGTGGGTAGCCTGGGGCAGG - Intergenic
1080215119 11:29831587-29831609 GGAGATGAGGAGCTTGTAATAGG + Intergenic
1081304845 11:41499685-41499707 GGAAATGGGGAGCCAGCAGGAGG - Intergenic
1081416771 11:42824684-42824706 GGAGAAGGGTAGCCTGGCTTGGG - Intergenic
1081688096 11:45056605-45056627 GAGGATGGGGAGCCAGGAGGAGG - Intergenic
1081807339 11:45897696-45897718 TGAGAAGAGCAGCCTGGAGTAGG - Intronic
1081856586 11:46307972-46307994 GGGGATGGGCAGCCTGGACAAGG - Exonic
1081998207 11:47377948-47377970 GGAGATGGGGGGACTGGCTTGGG - Intronic
1083142541 11:60733828-60733850 GGAGATGGGGAGGGTGGTGGTGG - Intronic
1083272270 11:61578533-61578555 GGAGATGGGGAGGCAGAAATGGG + Intronic
1083528575 11:63396111-63396133 GGAGGTGGGTAGCCTGGGGAAGG - Intronic
1083677577 11:64335141-64335163 GGAGGAGGGGAGGCTGGAGAGGG - Intergenic
1083691171 11:64409775-64409797 GGAGAGGGGGTGCCGGGAGGAGG - Intergenic
1083750812 11:64759631-64759653 GCTGCTGGGGAGCCTGGGGTGGG - Intronic
1083846219 11:65335171-65335193 AGAGCTGGGGAAACTGGAGTGGG - Intronic
1083890506 11:65593419-65593441 GGGGAAGAGGAGCCTGGACTAGG - Intronic
1084025108 11:66443158-66443180 GGAGAAGGGGACCATGGATTGGG + Intronic
1084543405 11:69801301-69801323 GGAGAAGGGGAGCATTTAGTGGG - Intergenic
1084698170 11:70768727-70768749 GGCCATGGGGAGCCTGGAGATGG + Intronic
1084738837 11:71124660-71124682 GGAGATGGGGAGATTTGACTTGG - Intronic
1084755774 11:71237766-71237788 GGAGGTGGGGAGCCTGGGAAGGG - Intronic
1085034762 11:73293198-73293220 GGAGATGGGGAGGCTGGAAAGGG + Intronic
1085409318 11:76282040-76282062 GGAGGTGGGGAGCCCGGGGGAGG - Intergenic
1086819932 11:91423278-91423300 AGAGATTGGGAGCCAGGATTGGG - Intergenic
1086825474 11:91490100-91490122 GGAGGTGGCTAGCCTGGAGCAGG - Intergenic
1087395760 11:97595624-97595646 GCATTTTGGGAGCCTGGAGTGGG + Intergenic
1088989222 11:114937395-114937417 TGAGGTGAGGGGCCTGGAGTCGG - Intergenic
1089255661 11:117192667-117192689 GGAGATGTGGAGAATGGAGCAGG - Intronic
1089330541 11:117686098-117686120 GGAGCTGGGGCTCCTGTAGTGGG - Intronic
1089380890 11:118030667-118030689 AAAGATGGGAAGCCTGGTGTGGG + Intergenic
1089498821 11:118921382-118921404 GGAGGAGGGGAGCCTGCAGGGGG + Intronic
1089533576 11:119147924-119147946 GGTGATGTGGGGCATGGAGTTGG + Intergenic
1089573179 11:119423212-119423234 GGAGAGGGGGAGCGGGGAGCCGG + Exonic
1089648117 11:119893666-119893688 TGATATGGGGAGCCAGGAGGAGG - Intergenic
1090354412 11:126130191-126130213 GGACAAGGGCAGCATGGAGTGGG + Intergenic
1091433843 12:458794-458816 TGCGATGGGAAGCTTGGAGTTGG + Intergenic
1091584046 12:1805867-1805889 GAAGATGAGGAGCCTGGGCTGGG + Intronic
1091898262 12:4121973-4121995 GTTGATGAGGAGCCTGGGGTTGG + Intergenic
1092193020 12:6533916-6533938 GGAGATGGGGAGGGGGAAGTGGG + Exonic
1092381018 12:7997168-7997190 GGAGATTGGGATGGTGGAGTGGG + Intergenic
1092953220 12:13526747-13526769 GGAGATGGGAATGCAGGAGTGGG + Intergenic
1093252252 12:16821115-16821137 GGAGGTGGGGAGCAAGGAGAGGG - Intergenic
1094427315 12:30328475-30328497 GGCCATGGGCAGCCTGGAGTGGG - Intergenic
1095471763 12:42544484-42544506 GGAGATGGGAAGATGGGAGTAGG - Intronic
1096079768 12:48825650-48825672 GGTGATGGAGATCCTGGGGTGGG - Exonic
1096233539 12:49910709-49910731 GGGCATGGGGAGGCAGGAGTAGG - Intergenic
1096419085 12:51440824-51440846 GGTGAGGGGCAGCCTGGTGTGGG + Intronic
1096847112 12:54413389-54413411 GGAGATGGGTAGGCTGAAGAGGG + Intronic
1097186112 12:57197400-57197422 GGAGATGGGCAGCGGGGAGGAGG - Intronic
1097635793 12:62120698-62120720 GAAAATAGAGAGCCTGGAGTGGG - Intronic
1097841989 12:64330398-64330420 GGAGATGGGGACACTGCAGTTGG - Intronic
1098161605 12:67650756-67650778 GGTGATGGCCAGCCTGGAGGAGG + Intronic
1100347160 12:93743441-93743463 GGTGCTGGGGAGGCTGAAGTGGG - Intronic
1100465518 12:94840972-94840994 GCAGGAGGGGAGCCTGGGGTGGG + Intergenic
1100659272 12:96679107-96679129 GAAGAGGGGGACCCAGGAGTGGG - Intronic
1101520078 12:105474484-105474506 GGAGAAGGGGGGCCCAGAGTAGG + Intergenic
1101541373 12:105668697-105668719 GGGGATGGGGAGGCTGGTGGAGG + Intergenic
1101601622 12:106214828-106214850 GGAGATCCAGAGCCTGGAGAAGG + Intergenic
1101835866 12:108295086-108295108 GAAGATGGGGACACTGGAGCTGG + Intronic
1101874936 12:108591738-108591760 GGAGAAGGGCAGCCAGGAGGGGG - Exonic
1102543484 12:113638441-113638463 GGAGAGGGGGCGCTGGGAGTAGG + Intergenic
1102692833 12:114774857-114774879 GTAGCTGGGGAGCGTGGAGGGGG - Intergenic
1102984088 12:117264676-117264698 GGAGATGGGGAGGATGAAGAGGG - Intronic
1103011285 12:117460421-117460443 GGGGATAGGAAGCCTGGAGCAGG + Exonic
1103155633 12:118682262-118682284 GGAGATGTGAAACCTGGAGGAGG - Intergenic
1103278234 12:119732080-119732102 AGAGATGGGGAGGCCGAAGTGGG - Intronic
1103527254 12:121577214-121577236 GGGGATGGGGTGCCTAGGGTGGG - Intronic
1103763323 12:123266309-123266331 GCAGAGGGGCAGCCGGGAGTTGG - Intronic
1104026736 12:125032974-125032996 GGAGATGGTGAGGCTGTAGCTGG - Intergenic
1104104388 12:125645246-125645268 GGAGATGGGGATCATGGGGAGGG - Intronic
1104287387 12:127436802-127436824 GGAAAAGGTGAGGCTGGAGTGGG - Intergenic
1104880982 12:132069909-132069931 GGAGAAGAGGAGCCTGGAACTGG - Intronic
1104974396 12:132545995-132546017 GCACATGGGGAGCCTGGGGAGGG - Intronic
1105792983 13:23821007-23821029 GGAAATGTGGAGCTTGCAGTTGG - Intronic
1105986189 13:25570221-25570243 GGGGAATGGGAGCCTGGAGATGG + Intronic
1106117483 13:26829918-26829940 GGGGATGGGGGGCCTGCTGTAGG + Intergenic
1106755139 13:32814976-32814998 GGAGATGGTGTGCCAGGAATGGG - Intergenic
1107692668 13:42967688-42967710 GGAGATGGGTAGCAGAGAGTGGG + Intronic
1107909483 13:45092009-45092031 GGAAATGTGGAGGCTGCAGTGGG + Intergenic
1108207479 13:48105505-48105527 GAGGATGAGGAGACTGGAGTAGG + Intergenic
1109467551 13:62756720-62756742 GGAAATGGGGAGGCTGAAGCAGG - Intergenic
1109582801 13:64364113-64364135 GGAGATTGGGATGGTGGAGTGGG + Intergenic
1111310851 13:86483107-86483129 GGAGAGGGGGTTTCTGGAGTTGG - Intergenic
1111693407 13:91592942-91592964 GGAGATGGGGACCCTGGGCCAGG + Intronic
1111991517 13:95121794-95121816 GGAGATGAGGTGTCTGGGGTTGG - Intronic
1113670499 13:112172381-112172403 GGAGGTGGTCACCCTGGAGTGGG - Intergenic
1114340575 14:21738621-21738643 GGAGATGGGGAGCCGGGTTACGG + Intergenic
1115648024 14:35383855-35383877 GGAGATGGGAAGCTTGTTGTGGG + Intergenic
1116832865 14:49739559-49739581 GGTGATGGGGAACATAGAGTAGG + Intronic
1118715038 14:68553525-68553547 GGACTTGGGGAGGGTGGAGTTGG + Intronic
1118854268 14:69609402-69609424 TGGTATGGGGAGGCTGGAGTGGG + Intergenic
1119436013 14:74598350-74598372 GGGGATGGTGACGCTGGAGTGGG - Intronic
1119678273 14:76572720-76572742 GGGGATGGGGAGGCTGAGGTGGG - Intergenic
1119678775 14:76576249-76576271 AGAGATGGGCAGGCTGGCGTGGG - Intergenic
1119888211 14:78162247-78162269 GCAGATGGTGATCCTGGAGAAGG + Intergenic
1120526154 14:85579188-85579210 TGAGAGTGGGAGGCTGGAGTGGG + Intronic
1121103410 14:91264864-91264886 GGAGATGGGGAGCAGGTAGCTGG + Intergenic
1122658573 14:103279225-103279247 GCTGCTGGGGAGCGTGGAGTGGG + Intergenic
1122873161 14:104650689-104650711 GGAGATGGGGAGACTGAGGCAGG - Intergenic
1122961707 14:105096852-105096874 TGAGTTGGGGAGCCAGGAATGGG - Intergenic
1123022991 14:105410987-105411009 GGAGAAGGGCAGTCTGGAGCTGG + Intronic
1123156577 14:106233212-106233234 GGAGAGGGGGAAGCTGGATTGGG - Intergenic
1123762189 15:23441637-23441659 GGAGATGTGGAGGCAGGAGGAGG - Exonic
1124067912 15:26363360-26363382 GGAGATGGAGAGATTGGAGGTGG + Intergenic
1124102778 15:26711577-26711599 GGAGATGGGGAGCCTGGGGCGGG - Intronic
1124202069 15:27687062-27687084 GGAGTTTGGGAGGCTGGAGGGGG + Intergenic
1124418057 15:29490855-29490877 GGAGAGCAGGCGCCTGGAGTGGG - Intronic
1124847600 15:33307311-33307333 GCAGGTGGAGAGCCTGTAGTGGG - Intergenic
1124854486 15:33374188-33374210 GAAGATGGAGAGTCTGAAGTTGG - Intronic
1126775168 15:52094217-52094239 GGAGGAGAGGAGCCAGGAGTGGG - Intergenic
1126892589 15:53222446-53222468 GGGAATGGGGAGGCTGGAGATGG + Intergenic
1127396634 15:58548581-58548603 GGAGCTGGGGAGCCTTCAGAAGG + Intronic
1128131242 15:65228484-65228506 AGTGATGGGGAGCATGGTGTAGG + Intergenic
1128133249 15:65244852-65244874 GGATTTGGTCAGCCTGGAGTAGG + Intronic
1128413191 15:67419401-67419423 GGAGATGGTGACCTTAGAGTTGG - Intronic
1128528884 15:68431128-68431150 GGAGCCGGGGAGCCCGGTGTGGG + Intronic
1129038690 15:72666074-72666096 GGGGCTGGGGCCCCTGGAGTGGG - Exonic
1129211201 15:74071156-74071178 GGGGCTGGGGCCCCTGGAGTGGG + Exonic
1129394322 15:75235888-75235910 GGAGATGAGGACCCAGGAGATGG - Intergenic
1129399202 15:75269931-75269953 GGGGCTGGGGCCCCTGGAGTGGG - Exonic
1129402809 15:75294207-75294229 GGGGCTGGGGCCCCTGGAGTGGG - Exonic
1129503517 15:76061457-76061479 GGAGGTGGGGAGCCCTGAGGGGG + Intronic
1129692521 15:77721833-77721855 TGAAATGGGCAGCCTGGAGCAGG + Intronic
1129715819 15:77849765-77849787 GCAGTTTGGGAGGCTGGAGTGGG + Intergenic
1129728334 15:77915430-77915452 GGGGCTGGGGGCCCTGGAGTGGG + Intergenic
1129871812 15:78945737-78945759 GGACATGGGGAGTCTGAGGTGGG - Intronic
1130707415 15:86246346-86246368 GTTGCTGGGGAGCCTGGAGGTGG + Intronic
1130746695 15:86661722-86661744 GGAGATAGGGAGCTGGGAGATGG + Intronic
1131062108 15:89410609-89410631 GGAGCTGGGAAGCCGGGAGAAGG + Intergenic
1132338946 15:101066001-101066023 GGAGCTGGGGAGGCTTGAGGGGG - Exonic
1132618210 16:852651-852673 GGACAAGAGGAGCCTGGAGCGGG + Intergenic
1132847464 16:2007078-2007100 GGGGAGGGGGACCCTGGGGTTGG + Intronic
1132995828 16:2821969-2821991 GGAGCTGGGAAGCCTGGATTGGG + Intronic
1133318840 16:4900767-4900789 GAGGATGGGAAGCTTGGAGTCGG - Intronic
1133484078 16:6201512-6201534 TGAGAAGGGTAGCCCGGAGTGGG + Intronic
1134567783 16:15266125-15266147 TGGGATGGGGAGGGTGGAGTGGG - Intergenic
1134569243 16:15277514-15277536 GGAGATGGGGAGCGAGAAGATGG - Intergenic
1134733134 16:16478531-16478553 GGAGATGGGGAGCGAGAAGATGG + Intergenic
1134734652 16:16490228-16490250 TGGGATGGGGAGGGTGGAGTGGG + Intergenic
1134932820 16:18221678-18221700 TGGGATGGGGAGGGTGGAGTGGG - Intergenic
1134934305 16:18233442-18233464 GGAGATGGGGAGCGAGAAGATGG - Intergenic
1135867702 16:26119530-26119552 GAGGTTAGGGAGCCTGGAGTGGG + Intronic
1135886931 16:26318637-26318659 GGAGATGGGGTGCCCAGAGATGG - Intergenic
1135901539 16:26464638-26464660 GGAGGTGGGTAGCCTGGGGCAGG + Intergenic
1136370005 16:29830464-29830486 GAACCTGGGGAGCCTGGGGTGGG - Exonic
1136774162 16:32862722-32862744 GGAGCAGGAGAGCCTGAAGTGGG + Intergenic
1136777768 16:32880854-32880876 GGAGGTGGGGAGGCTGCAGCAGG - Intergenic
1136892855 16:33980660-33980682 GGAGGTGGGGAGGCTGCAGCAGG + Intergenic
1136896449 16:33998792-33998814 GGAGCAGGAGAGCCTGAAGTGGG - Intergenic
1139261604 16:65599583-65599605 TGAGATGGGGAGCCGGGGGAAGG + Intergenic
1139297978 16:65919412-65919434 GGAGACGGGGAGGCGAGAGTAGG - Intergenic
1139375424 16:66493706-66493728 GGAGATTGGGGACCTGGTGTCGG - Intronic
1139472767 16:67187110-67187132 AATGATGGGGAGCCTGGAGTTGG - Exonic
1139479994 16:67225502-67225524 GGCAATGGGGAGACTGGACTGGG - Intronic
1139847535 16:69931620-69931642 GGAGATGGGGTGCTGGGAGGAGG - Intronic
1139930597 16:70523311-70523333 GGAGAGTGGGAGCCTTCAGTCGG - Intronic
1139962232 16:70724604-70724626 GGAGATGAGAAGCCGGGAGCCGG + Intronic
1139988598 16:70920791-70920813 GGAGAAGGAGCGCCTGGAGAGGG - Exonic
1141108137 16:81250306-81250328 AGAGATGGGGAGGCAGGAGCTGG - Intronic
1141468170 16:84220850-84220872 GGAGATGATGAGGCTGGATTGGG - Exonic
1141544538 16:84756085-84756107 GGAGATGGGGGGCGGGGGGTGGG - Intronic
1142232195 16:88905272-88905294 GGAGATGGGTGTCATGGAGTGGG - Intronic
1203076586 16_KI270728v1_random:1124841-1124863 GGAGCAGGAGAGCCTGAAGTGGG + Intergenic
1203080183 16_KI270728v1_random:1142963-1142985 GGAGGTGGGGAGGCTGCAGCAGG - Intergenic
1142548216 17:720525-720547 GGAGGTGGGGAGGATGGATTGGG + Intronic
1142548258 17:720710-720732 GGAGATGGGGAGGATGGATTGGG + Intronic
1142641719 17:1288898-1288920 GGGGATGGGGAGTCTGGTGGGGG - Intronic
1142641798 17:1289064-1289086 GGGGATGGGGAGTCTGGTGGGGG - Intronic
1142641926 17:1289357-1289379 GGGGATGGGGAACCTGGTGGGGG - Intronic
1143637999 17:8177364-8177386 TGAGATGGGGAGTGGGGAGTAGG - Intergenic
1143819613 17:9549716-9549738 GGAGATGGGGAGGAGGGAGATGG + Intronic
1143919130 17:10317127-10317149 GGAGATAGGGAGGCTGGAGTGGG + Intronic
1144029889 17:11310116-11310138 GAAGATGGGGAGAGTGGATTGGG + Intronic
1144180990 17:12752643-12752665 GGAGATCGGGGGGCTGGAGCTGG - Exonic
1144436922 17:15250568-15250590 TGAGATGGGGAGACTGGAGGAGG - Intronic
1144590663 17:16521004-16521026 GAGGATGGGGAGCCTGGTGCTGG + Intergenic
1144830964 17:18131037-18131059 GGAGTTGGGCAGCATGGGGTGGG + Intronic
1144851473 17:18246183-18246205 GGAGTTGAGGAGGCTGGAGTCGG + Exonic
1144957204 17:19024809-19024831 GGAGCAGGGGAGCAGGGAGTAGG - Intronic
1146122054 17:30204427-30204449 GGGGATGAGGAGCCTGGGTTAGG - Intronic
1146343527 17:32041782-32041804 GGAGTTGGGGAGCAGGGAGGAGG - Intronic
1146696094 17:34909964-34909986 GGAGTTGGGGACCGTGGTGTTGG - Intergenic
1147535868 17:41323119-41323141 GGAGATGGAGAGCCAGCAGAGGG + Intergenic
1147620779 17:41865286-41865308 GGAGATGGAGAGCATGGAGACGG - Exonic
1147762763 17:42811151-42811173 AGAGAAGAGAAGCCTGGAGTAGG + Intronic
1147866228 17:43554429-43554451 GGAGCTGGGGAGTCTGAAGCGGG - Intronic
1147996558 17:44363133-44363155 GGAGGCTGGGAGCCTGGAGCTGG - Intronic
1148048268 17:44757312-44757334 GGACATGGGCAGGCTGGAGCAGG + Intergenic
1148102136 17:45098697-45098719 CCAGATGGGGAGCATGGAGAGGG + Intronic
1148119748 17:45201482-45201504 TCAGATGGGGTGCCTGGAATTGG + Intergenic
1148124768 17:45231022-45231044 GGAGAGGGCGACCCTGGGGTTGG + Intronic
1148156248 17:45426664-45426686 GGAGATGGGGAGGCTAAAGATGG - Intronic
1148690589 17:49524745-49524767 AGAGGTGGGGAGCCTGGAGTGGG + Intergenic
1148750733 17:49944472-49944494 GGAGCTGAGGAGCCTGGAGGTGG - Intergenic
1148759657 17:49993162-49993184 GGAGCTGGGAATTCTGGAGTAGG + Intronic
1149048468 17:52275855-52275877 TGAGATGTGGACCCTGGAATTGG + Intergenic
1149422169 17:56521495-56521517 GGGGGTGGGGAGCCTGGGGCTGG + Intergenic
1149551433 17:57543074-57543096 TGAGATGGGAAGCATTGAGTAGG - Intronic
1149576293 17:57715838-57715860 GGTGATGGGCAGCCTCGGGTGGG + Intergenic
1150058981 17:62047554-62047576 GGGGATAGGGAGCATGGAGAGGG + Intronic
1150387918 17:64775282-64775304 GGAGATGGGGAGGCTGAAGATGG - Intergenic
1150782409 17:68134226-68134248 GGAGTTGGGGAGCGGGGAGGAGG + Intergenic
1151353131 17:73543234-73543256 GGAGGAGGAGAGGCTGGAGTGGG + Intronic
1151354794 17:73551869-73551891 ACAGAAGGGAAGCCTGGAGTTGG - Intronic
1151454667 17:74218677-74218699 GGAGACCGGGAGGCTGGAGGAGG + Intronic
1151463349 17:74268832-74268854 GGAGATGGGAAGGCTGGAGAGGG - Intergenic
1151477474 17:74352280-74352302 GGAGGAGGGCAGCCTGGAGCAGG + Exonic
1152437775 17:80286680-80286702 GGAGGTGGGGGGCGTGGAGTGGG + Intronic
1152637146 17:81434877-81434899 GGGGATGAGGTACCTGGAGTGGG + Intronic
1152655991 17:81519446-81519468 GGAGATGGCGCCCGTGGAGTGGG + Intronic
1152659464 17:81535642-81535664 GGAGATGGGGATGGTGGAGATGG - Intronic
1152659515 17:81535792-81535814 GGAGATGGGGATGGTGGAGATGG - Intronic
1152735838 17:81996358-81996380 GGAGAGGGTGAGCCGGGGGTAGG + Intronic
1152803073 17:82340611-82340633 GGAGATGGGGAGGCAGGTGCGGG - Intergenic
1152945207 17:83194328-83194350 GGAGGTGGGGAGGCAGGATTGGG - Intergenic
1153997409 18:10454447-10454469 GGAGGAGGGGCGCCCGGAGTGGG + Intergenic
1154190941 18:12230784-12230806 GTAGATGGGCACCCTGGAGAGGG + Intergenic
1154323814 18:13375551-13375573 TGAGATGGGGAGGCTTGGGTTGG + Intronic
1155433628 18:25787909-25787931 GGAGATGGGGACCAGTGAGTAGG - Intergenic
1155640593 18:28009074-28009096 GGAGACTGGCATCCTGGAGTAGG + Intronic
1156223117 18:35074464-35074486 GGAAATGGGGAGGGAGGAGTAGG + Intronic
1156367446 18:36442138-36442160 GGAGAAGGGGAGCAGGGAGGGGG - Intronic
1156478686 18:37422524-37422546 GGAGCCTGGGAGCCTGGAGGAGG + Intronic
1157105661 18:44772104-44772126 GGAGGTGGGGAGGCTGGGGCGGG - Intronic
1157379766 18:47202931-47202953 GGAAATGGGCAGTCTGGAGTTGG + Intergenic
1158284246 18:55861710-55861732 AGAGAAGGGGAGGCTGGAGCAGG + Intergenic
1158649750 18:59274171-59274193 GGAGACTGGGAGCCCCGAGTCGG + Intergenic
1158829715 18:61263900-61263922 GGAGGTGGGTAGCCTGGGGCAGG + Intergenic
1158888232 18:61849001-61849023 AGGGAAGGGGAGCCTGGAGAGGG + Intronic
1160019707 18:75171091-75171113 GGAGAGCGGGAGCCAGGAATTGG - Intergenic
1160347891 18:78149869-78149891 GGAGATGGGGAGTGTCCAGTGGG + Intergenic
1160376770 18:78419858-78419880 GGTGATGGGGAGGCTGGAGACGG - Intergenic
1160527536 18:79546350-79546372 GGAGAGGGTGAGCCTGGAGAGGG - Intergenic
1160527542 18:79546380-79546402 GGAGAGGGTGAGCGTGGAGAGGG - Intergenic
1160527552 18:79546425-79546447 GGAGAGGGTGAGCCTGGAGAGGG - Intergenic
1160527570 18:79546515-79546537 GGAGAGGGTGAGCCTGGAGAGGG - Intergenic
1160527573 18:79546530-79546552 GGAGAGGGTGAGCGTGGAGAGGG - Intergenic
1160527582 18:79546575-79546597 GGAGAGGGTGAGCGTGGAGAGGG - Intergenic
1160527585 18:79546590-79546612 GGAGAGGGTGAGCGTGGAGAGGG - Intergenic
1160527594 18:79546635-79546657 GGAGAGGGTGAGCGTGGAGAGGG - Intergenic
1160534758 18:79585944-79585966 GGATATGGGGTGCATGGTGTGGG - Intergenic
1160534766 18:79585972-79585994 GGATATGGGGTGCATGGAGTGGG - Intergenic
1160534774 18:79586000-79586022 GGATATGGGGTGCGTGGAGTGGG - Intergenic
1160591587 18:79947808-79947830 GGAGAGGGGAAGCCAGGAGTGGG + Intronic
1161016824 19:1987417-1987439 GGAGATGGGGGGCCGGGCATGGG - Intronic
1161211390 19:3067874-3067896 AGAGATGGGCAGCCTGGGCTGGG + Intergenic
1161227053 19:3151573-3151595 GGAGGTGGGGTCCCTGGAGTTGG - Intronic
1161248934 19:3270394-3270416 GGAGAGAGGGAGCCGGGAGGAGG + Intronic
1161577270 19:5061238-5061260 GAAGATGGGGAGCCTGGGATGGG - Intronic
1162013322 19:7830698-7830720 GGGGATGGGGAGCCCTGAGGGGG - Intronic
1162229528 19:9254735-9254757 GGAGAGGCGGAGCTTGCAGTGGG - Intergenic
1162572074 19:11479834-11479856 CGAGGTGGGGAGCCTGGACCTGG + Intronic
1163235070 19:16025205-16025227 GGAGCTGGACAGCCTGGGGTGGG - Intergenic
1163297893 19:16424212-16424234 GGAGATGAGGAAGTTGGAGTAGG + Intronic
1163603469 19:18261981-18262003 TGAGATGGGTAGCCTGGGCTTGG + Intronic
1163603558 19:18262371-18262393 TGAGATGGGTAGTCTGGACTTGG + Intronic
1163632285 19:18423707-18423729 GGACATGGGGCGCCTGGACCTGG - Intronic
1163636320 19:18438604-18438626 GGACATGGGGAGCCAGGGGATGG - Intergenic
1163666755 19:18607043-18607065 GGGGGTGGGAAGCCTGGAGCTGG - Intronic
1164134059 19:22395096-22395118 GGAGAAGTGGAGGCTGCAGTGGG + Intronic
1164828889 19:31305158-31305180 GGAGAGGGGGTGGCTGGAGATGG - Intronic
1165041922 19:33074548-33074570 GGAGGTGGGGAGGTTGCAGTAGG + Intergenic
1165309762 19:35022978-35023000 GGAGCTGGGGGGCATGGGGTGGG - Intronic
1165455770 19:35909627-35909649 GGAGATTTGGAGCCTGGAGGAGG + Intergenic
1165888851 19:39098850-39098872 GGAGATGGGGGGACTGGTGGGGG - Intronic
1166360587 19:42251428-42251450 GGGGGTGGGCAGCCTGGGGTGGG + Intronic
1166404382 19:42509152-42509174 AGGGATGGGGAGGCTGAAGTTGG + Exonic
1167262513 19:48467195-48467217 GGAGATGGAGAAGCTGGAGGGGG - Intronic
1168259928 19:55187616-55187638 GGAGAGGGGGTACCTGGTGTTGG + Intronic
1168574564 19:57499320-57499342 GGAGATGGAGATGATGGAGTAGG - Intronic
1168574586 19:57499527-57499549 GGAGATGGAGATGATGGAGTAGG - Intronic
1168661894 19:58173818-58173840 GGACATGGGGACCCTGGTGGAGG - Intergenic
1168694228 19:58395894-58395916 GGAGATGGGGAGGCCCGAGGCGG - Intergenic
925064979 2:922511-922533 GGAGCTGGTGGGCCTGGACTGGG + Intergenic
925104375 2:1277892-1277914 TGACATGGAGACCCTGGAGTGGG - Intronic
925266365 2:2569296-2569318 GGAAATGGGGAACCTTGTGTTGG + Intergenic
925361721 2:3284716-3284738 GGAGTTGGGCAGACTCGAGTTGG - Intronic
925426959 2:3757794-3757816 GGAGATGGGGAGGTTGGTGCTGG - Intronic
925862038 2:8188129-8188151 GGAGATGGGAAGCCTGGACCAGG + Intergenic
926818542 2:16826820-16826842 GGAGATGGGAACCCAGGAGGTGG - Intergenic
926950820 2:18241181-18241203 GCACTTGGGGAGCCTGAAGTGGG - Intronic
926994238 2:18716728-18716750 GTGGAGGGGGAGGCTGGAGTGGG - Intergenic
927099197 2:19775036-19775058 GAGGAATGGGAGCCTGGAGTGGG - Intergenic
927606708 2:24491977-24491999 CGAGAGGGGGAGCCGGAAGTCGG + Exonic
927707297 2:25304427-25304449 GGGGATGGGGAGGATGGAGTGGG - Intronic
927882524 2:26698715-26698737 GGAGATGGGGGGTGGGGAGTGGG - Intronic
928025519 2:27735835-27735857 GGAGATTGGGCGCCGGGAGGCGG + Intergenic
928094915 2:28398559-28398581 GCAGCTGGGGAGCCTGGACGAGG + Intronic
928211608 2:29327959-29327981 GGAGCTGGGGTGCATGGAGGAGG + Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930034020 2:47074527-47074549 GGAGATGGGGTGGGTGGAGATGG - Exonic
930781189 2:55225737-55225759 GGAGATGGGGAGCCTGGAGGAGG - Intronic
932340884 2:70961951-70961973 AGAGATGAGGAGCCCTGAGTTGG - Intronic
932573113 2:72948662-72948684 GGAGACGGGGTGCCAGGAGGAGG - Intronic
932921220 2:75917073-75917095 GGAGTTGGGCAGCCTGGGGTTGG + Intergenic
934158856 2:89229412-89229434 GGAGAAGGAGAGGCTGGTGTGGG - Intergenic
934208418 2:89953016-89953038 GGAGAAGGAGAGGCTGGTGTGGG + Intergenic
934330606 2:92063274-92063296 GCAGTTTGGGAGCCTGAAGTGGG - Intergenic
935062042 2:99616803-99616825 GGGCAAGGGGAGCTTGGAGTGGG - Intronic
935138820 2:100333146-100333168 GTAGATGGGGAGCCAGAAGGGGG - Intergenic
935639516 2:105277745-105277767 GAATATGGGGAGCTTGGACTGGG - Intronic
937269217 2:120637305-120637327 CGAGATGGGGAGGATGCAGTTGG - Intergenic
938933940 2:136112230-136112252 GGGGCTGGGAAGCCTGCAGTAGG + Intergenic
939166432 2:138645928-138645950 GGAGATGGGGAGCTCATAGTGGG + Intergenic
939399160 2:141668896-141668918 TGAGATGGGGAGCATGCAGACGG - Intronic
939886886 2:147690887-147690909 GGAGTTGGGGGACATGGAGTAGG - Intergenic
941233244 2:162938287-162938309 GTGGATGGGGAGCCAGAAGTGGG - Intergenic
943848910 2:192690519-192690541 GGAGATGGGGAGTCTGAAAGGGG - Intergenic
944097838 2:195989776-195989798 GGAGCAGGAGAGACTGGAGTGGG - Intronic
944555949 2:200888129-200888151 GGAGATTGGGAGGCTTGAATCGG - Intronic
945052983 2:205843162-205843184 AGAGATGGGGAGCCTGGGATTGG - Intergenic
945654529 2:212606996-212607018 TGAGATGGGGAGACTGCAGATGG - Intergenic
945774797 2:214092809-214092831 GGAGATGGCAAGGCTGGAGGAGG + Intronic
945987510 2:216367116-216367138 GGTGATGGGGAGCAGGGAGGTGG + Intronic
946061989 2:216950389-216950411 GGAGGGGGGCAGCCTGGAGAGGG + Intergenic
946403765 2:219482427-219482449 GGAGCTGGGGAGCCAGGACCCGG + Intronic
947047376 2:226003465-226003487 GGAGAAGAGGTGTCTGGAGTAGG - Intergenic
948052965 2:234992250-234992272 GGAGCTGGGCAGCCTGGGGAGGG + Intronic
948364129 2:237443564-237443586 GGAGATGGGGAGTTGGGAGTTGG + Intergenic
948372749 2:237500683-237500705 GGGGATGGGGTGCTTGGAGGTGG - Intronic
948796432 2:240404727-240404749 GGAGTTTGGGAGGCTGAAGTGGG + Intergenic
1169208633 20:3753769-3753791 GGAGAGGGAGGGCCTGGGGTGGG - Exonic
1169729432 20:8770664-8770686 GAAGATGGGAAGCCGGGAGGGGG + Intronic
1169992859 20:11522876-11522898 GGAGGTGGGGAGCTGGGAGGTGG + Intergenic
1170025895 20:11890054-11890076 GGAGAAGGGGAGCCCGGTGGTGG - Intergenic
1170607402 20:17884117-17884139 GGAGAAGGGCAGCGTGGAGGAGG - Intergenic
1170948112 20:20910019-20910041 GGAGAAGGGAAGCCGGGAGAGGG + Intergenic
1170961893 20:21032845-21032867 AGAGGTGGGGAGGCTGGAGTAGG + Intergenic
1171361566 20:24590088-24590110 GGACATGGGGAGCGTGGAACTGG + Intronic
1171486384 20:25489422-25489444 GGAGATGCAGCGCCTGGTGTTGG - Intronic
1171545616 20:25998265-25998287 GGAGATGGAGTGCCGGGAGGTGG + Intergenic
1172209540 20:33187152-33187174 GCAGCTGGGGAGCCTGGGGTAGG + Intergenic
1172220130 20:33268178-33268200 TGAGAGGTGGAGCCTGGAATGGG - Intergenic
1172702878 20:36863546-36863568 GGAGCCGGGGCGCCTGGAGGCGG - Exonic
1172773196 20:37393231-37393253 GCAGATGGGTAGGCTGGAGGAGG + Intronic
1173104733 20:40123229-40123251 TTTGATGGGGAGCCTGGAGAAGG - Intergenic
1173158724 20:40636804-40636826 GGAGTTGAGGAGGCTGGAGGAGG - Intergenic
1173162696 20:40664251-40664273 GGGGATGGGGAGGATGGAGACGG - Intergenic
1173518904 20:43684709-43684731 GGTGGTGGGGTGCCTGTAGTTGG + Intronic
1174059395 20:47821802-47821824 GTAGGAGGGGAGCCAGGAGTGGG + Intergenic
1174065308 20:47860465-47860487 GTAGATGGGGACCATGCAGTAGG - Intergenic
1174213418 20:48898067-48898089 TGAGATGGGGAGCCTGTGGGAGG - Intergenic
1174588263 20:51625284-51625306 GGTGATCGAGAGCCTGGAGATGG - Exonic
1174720493 20:52806725-52806747 GGAGATGGGGAAGCTGGCTTTGG + Intergenic
1175246430 20:57584993-57585015 GGGGATGGGGAGGCTGGAATGGG + Intergenic
1175908019 20:62391422-62391444 GGAGATGCGGAGCCTGTCGGAGG - Exonic
1175950927 20:62582589-62582611 GCAGCTGGGGAGCCTGGAGAAGG + Intergenic
1175979144 20:62728244-62728266 GGAGATGGGTACCTTGGGGTCGG + Intronic
1176173886 20:63708583-63708605 GGACGAGGAGAGCCTGGAGTCGG + Exonic
1176370529 21:6059390-6059412 TGAGATGGGGAGCCTGGCCCAGG + Intergenic
1176413885 21:6463781-6463803 GGCGAAGGGGAGCCTGGAGAAGG - Intergenic
1177204417 21:17994883-17994905 GGGGATGGGGTTACTGGAGTAGG + Intronic
1177341038 21:19800617-19800639 GGGGATGGGGAGCAAGGAGAGGG - Intergenic
1177537484 21:22447494-22447516 GGAGTTGGGGGGCTTGGAGATGG - Intergenic
1178183978 21:30198378-30198400 GGAGGTGGGTAGCCAGAAGTAGG + Intergenic
1178358673 21:31930490-31930512 AGAGAAGGTGAGCCTGGAGCTGG - Intronic
1179500760 21:41807029-41807051 GGTGATGGGGGACCTGGTGTTGG - Intronic
1179517418 21:41918268-41918290 TGAGATTGGGAGCAGGGAGTGGG - Intronic
1179571645 21:42282109-42282131 GGCACTGGGCAGCCTGGAGTGGG + Intronic
1179689383 21:43072103-43072125 GGCGAAGGGGAGCCTGGAGAAGG - Exonic
1179752990 21:43479151-43479173 TGAGATGGGGAGCCTGGCCCAGG - Intergenic
1179901610 21:44396986-44397008 GGACTTGGGGCACCTGGAGTTGG + Intronic
1180189333 21:46155068-46155090 GGAGATGGAGAGGCGGCAGTGGG + Intronic
1180955165 22:19738225-19738247 GTAGAAGGGGAGACTGGAGGAGG - Intergenic
1181546069 22:23603369-23603391 GGAGGTGAGGAACCTGGAGGAGG - Intergenic
1181985382 22:26796841-26796863 GGAGATGGGGAGGCTGAGGCTGG + Intergenic
1182010973 22:27000369-27000391 GGAGTTGGGGAGACAGCAGTGGG - Intergenic
1182119022 22:27774961-27774983 GGTGATGGGGAGCCGGTAGGTGG + Intronic
1182325123 22:29506747-29506769 GGAGATGGCGAGAGTGGTGTTGG - Exonic
1183243504 22:36675679-36675701 GGAGATGGGGAGCTGTGAGCTGG - Intronic
1183257330 22:36770926-36770948 GAAGAAGGGAAGGCTGGAGTCGG + Intronic
1183509788 22:38228012-38228034 GAGGACGAGGAGCCTGGAGTGGG + Intronic
1183639899 22:39086569-39086591 TGAGAATGGAAGCCTGGAGTAGG + Intronic
1183756394 22:39770271-39770293 GGAGATGGGAAGGTTAGAGTAGG + Intronic
1183806872 22:40219304-40219326 GGAAAAGGAGAGCTTGGAGTAGG + Intronic
1184070748 22:42144769-42144791 GGGCTTGGGGAGCTTGGAGTGGG - Intergenic
1184243731 22:43225194-43225216 GGAGATGGAGGGGCAGGAGTGGG - Intronic
1184273896 22:43399621-43399643 GGAGACCTGGAGCCTGGAGGTGG + Intergenic
1184452963 22:44593721-44593743 GGAGATGGGGCGCATGGTGAGGG + Intergenic
1184489078 22:44799039-44799061 GGGGATGGGAAGCCTGGAGCAGG - Intronic
1184519823 22:44986806-44986828 GGAGTTGGGGGTCCTGGAGCTGG + Intronic
1184559865 22:45256027-45256049 GGAGAGGGAGAGCCTGCAGGAGG - Intergenic
1184709983 22:46244170-46244192 GGAGATGGGGAGCCTGGAGTAGG + Exonic
1184719168 22:46299587-46299609 GGAGATGGAGAGTCTGTAGATGG - Intronic
1185036007 22:48477258-48477280 GGTGATGGGGTGTGTGGAGTGGG - Intergenic
1185075119 22:48678897-48678919 GGAGCCGGGGAGCCGGGAGAGGG - Intronic
1185075162 22:48679028-48679050 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185075229 22:48679220-48679242 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185075426 22:48679734-48679756 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185118039 22:48949167-48949189 GGAGGGGGGGATGCTGGAGTGGG - Intergenic
1185394119 22:50578176-50578198 GGCGAAGGGCAGCCTGGAGTTGG + Intronic
949880828 3:8659409-8659431 GGAGGAGGTGAGGCTGGAGTGGG - Intronic
950238242 3:11342358-11342380 GGGGATGGGGAGCTGGGAGATGG - Intronic
950363086 3:12463624-12463646 GGAGGTGGGCAGCCTAGAGCTGG - Intergenic
950481624 3:13247824-13247846 GAAGATGGGGAACGTGCAGTGGG - Intergenic
950675147 3:14550179-14550201 GGAGGCGGGGAGGCTGGAGAGGG - Intergenic
951384281 3:22025727-22025749 GGAGATTGGGATGGTGGAGTGGG + Intronic
952900911 3:38111332-38111354 AGAGATGGGGAGTCTGGGCTGGG + Intronic
953193994 3:40714911-40714933 GGAGATAGGGTGCCTGGGGCTGG - Intergenic
953882844 3:46700575-46700597 GGAGTGGGGAGGCCTGGAGTTGG - Intergenic
954028292 3:47800368-47800390 GGAGTTTGGGAGGCTGAAGTGGG + Intergenic
954077320 3:48190406-48190428 GGAGAAGGGGAGCTTGGGGCTGG + Intergenic
954143220 3:48621098-48621120 GGAGCTGGGGAGCAGGGAGTAGG + Intronic
954156186 3:48686054-48686076 GGGGATGAGGGGCCTGGAGCCGG - Intronic
954289314 3:49641018-49641040 AGAGAGGGGGAGGCTGGGGTGGG + Intronic
954355122 3:50078418-50078440 AGAGATGGGGAGTGAGGAGTGGG + Intronic
955885731 3:63596354-63596376 GGAGAGGGGGAGACAGGAGGAGG - Intronic
956432096 3:69197598-69197620 GGAGAGGGGGAGCGGGGAGAAGG + Intronic
957777050 3:84766999-84767021 GGAGGTGGGGGGCTTGGAGAGGG + Intergenic
958001955 3:87761833-87761855 GGAGATGGGGAGCCAGAAGGGGG + Intergenic
958647152 3:96887999-96888021 GGAGGTGGGTAGCCTGGGGCAGG - Intronic
960561060 3:119084538-119084560 GGAGATGGGCAGCCTGCAGTGGG - Intronic
960990191 3:123305086-123305108 GGAGTTGGGAAGCCTGGGCTTGG + Intronic
961114247 3:124315202-124315224 TGGGATGGGGAGCAAGGAGTAGG - Intronic
961451621 3:127004769-127004791 GGGGAGGGGGAGCCTGGTGCAGG + Intronic
961560995 3:127730238-127730260 GGTCATGGAGAGCCTGGGGTTGG - Intronic
961658667 3:128457003-128457025 GGAGATGGAGCCCCTGGAGGGGG - Intergenic
962671044 3:137708952-137708974 GGAGAAGGAGAGACTGGAGATGG + Intergenic
962751472 3:138437214-138437236 GGAGAATTGGAGCCAGGAGTCGG + Intronic
964555786 3:157936550-157936572 GAAGGTGGAGAGACTGGAGTGGG - Intergenic
964661750 3:159127278-159127300 GGAGTTGGGGAGGCAGGGGTTGG + Intronic
965386179 3:168049206-168049228 GTAGGTGTGGAGCCTGCAGTGGG - Intronic
965560957 3:170062220-170062242 GGAGAGGGGGACCCTGGGGAGGG - Intronic
965772794 3:172198733-172198755 TGATATGGGGAGTCAGGAGTGGG - Intronic
967542835 3:190689462-190689484 GGATATGTTGAGCTTGGAGTAGG + Intergenic
968171514 3:196513987-196514009 GGAGATGGAGAGGCAGGAATGGG - Intronic
968539083 4:1154041-1154063 AGAGATGGGGAGGCAGGTGTAGG + Intergenic
968610648 4:1555442-1555464 AGACATGGGGAGCCTGGCTTGGG - Intergenic
968626622 4:1628885-1628907 GGAGTAGGGGACCCTGCAGTGGG - Intronic
968643863 4:1728801-1728823 TGGGATGGGGAGCGTGGCGTGGG + Intronic
969209042 4:5672232-5672254 GGGGAGGGCGAGCCTGGAGAAGG + Intronic
969487551 4:7480756-7480778 CGAGCTGGGGAGCCTGGGGCGGG - Intronic
969514715 4:7640645-7640667 GCAGAAAGGGAGCCTGCAGTTGG - Intronic
969835298 4:9835409-9835431 GGAGATGGGGAGGTTCAAGTGGG - Intronic
970101698 4:12530560-12530582 GGAGAATGAGAGCCGGGAGTAGG + Intergenic
970960999 4:21871247-21871269 GGAGGTGGGGAGCGGGGAGGGGG - Intronic
971090104 4:23332767-23332789 GGAGATGGGGAGAATGGAAATGG + Intergenic
975982882 4:80179304-80179326 GGAGATTGGGATGATGGAGTGGG - Intergenic
976569862 4:86594974-86594996 GGGGGTGGGGTGACTGGAGTGGG + Intronic
978396452 4:108285678-108285700 GGAGCTGGGGAGGCAGGGGTTGG - Intergenic
979072392 4:116224562-116224584 GGTACTGGGGAGCCTGAAGTGGG - Intergenic
981513650 4:145584481-145584503 GGAGATGGGGAGGCTGGAGCAGG - Intergenic
981578617 4:146230154-146230176 GGAAATGGAGAGGGTGGAGTGGG + Intergenic
982266486 4:153542798-153542820 GGAGATGGAAATCCTGGAGAGGG + Intronic
982540046 4:156657282-156657304 GGAGATGGGGAGGCTGGGAAGGG + Intergenic
982856832 4:160393445-160393467 GAAGTTGGGGAACTTGGAGTTGG + Intergenic
983469129 4:168135475-168135497 GGAGGTTAGGAGCCTGTAGTTGG + Intronic
983513923 4:168637268-168637290 AGAGAAGGGAAGACTGGAGTGGG - Intronic
984702220 4:182825748-182825770 GGAGGTGGGGAGTGGGGAGTGGG - Intergenic
984930928 4:184846516-184846538 GGGGATGGGGAGACAGGAGCTGG + Intergenic
984973526 4:185210264-185210286 GGAGCTGGGCGGCCAGGAGTCGG - Intronic
986938578 5:12920770-12920792 GGAGATTGGGATGGTGGAGTGGG - Intergenic
987141688 5:14953140-14953162 GGAGAAAGAGGGCCTGGAGTTGG - Intergenic
988616492 5:32780057-32780079 AGAGAGGGGCAGCCTGGACTGGG - Intronic
990140404 5:52696824-52696846 GGAGATGGAGAGGATGGGGTGGG - Intergenic
991013386 5:61907242-61907264 GGCAATGGAGAGCCTGGAGATGG + Intergenic
991018880 5:61959562-61959584 GGAGATGGGGAACCAGGAGCTGG - Intergenic
991443654 5:66677805-66677827 GGAGGTGGTGGGCCTGGAGATGG + Intronic
992250489 5:74871181-74871203 GGAGGTGAGCAGCCTGGAATTGG - Intergenic
992565656 5:77993122-77993144 GCAGGTGGGGAGTGTGGAGTTGG + Intergenic
992940354 5:81754629-81754651 GAATTTGGGGAGCCTGGATTTGG + Intergenic
995593332 5:113722712-113722734 GGACATGGGGAGGTTGGAGAGGG + Intergenic
995694649 5:114865759-114865781 GGAGGTGGGTAGCCTGGGGCAGG - Intergenic
997570185 5:134921371-134921393 GGAGAAGGGGAGTTTTGAGTTGG + Intronic
999257175 5:150216185-150216207 GGAAGTGGGAAGCCTGGGGTGGG + Intronic
999571351 5:152923503-152923525 GGAGAAGTGGATCCTGAAGTAGG + Intergenic
1001531155 5:172462832-172462854 GGGGACGGGGAGGCTGGGGTGGG + Intergenic
1002047880 5:176552220-176552242 GGAAATGAGGAGCCCAGAGTGGG + Intronic
1002048045 5:176553041-176553063 TGAGATGGGGAGGGGGGAGTTGG + Intronic
1002049412 5:176561615-176561637 ACAGAAGGGGATCCTGGAGTTGG + Intronic
1002100815 5:176856729-176856751 GGAGGTGGGGAGGCTGCTGTGGG - Intronic
1002136594 5:177111676-177111698 GGTGATGGAGAACCTGGAGATGG + Intergenic
1002139506 5:177130483-177130505 CCAGATGGGGAGGCTGGAGATGG + Intergenic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1003512015 6:6789728-6789750 GGAGGTGGGCAGCCAGGAGGTGG - Intergenic
1003692275 6:8366487-8366509 GGAGCTAGGGAGGCTGGGGTAGG + Intergenic
1004058255 6:12163409-12163431 GGAGAAGGCAAGCCTGGAGTCGG - Exonic
1004709318 6:18155234-18155256 GGAGACGGGGCGCCGGGAGAGGG - Intergenic
1005146036 6:22691154-22691176 GTAGATGGTTAGCCTTGAGTGGG + Intergenic
1005524105 6:26628624-26628646 TGTGATGGGTAGCATGGAGTGGG - Intergenic
1006439890 6:34047440-34047462 TGGGATGGTGAGCCTGGACTCGG - Intronic
1006447671 6:34088953-34088975 GCAGGTGGGGAGCCTGTAGGTGG - Intronic
1006631712 6:35435130-35435152 GGAGATGGGGACCTTAGAGAAGG - Intergenic
1006799294 6:36749578-36749600 GGATATTGGGAGCCTGAGGTGGG + Intronic
1007353137 6:41289879-41289901 GGAGATTGGGAGGCTGGAGGAGG - Intergenic
1007800640 6:44389384-44389406 GGAGATGTAGAGGATGGAGTGGG + Intronic
1007905597 6:45457399-45457421 GGAGATAGGGTGACTGGAGAAGG + Intronic
1009436225 6:63621294-63621316 GAAGATGGTGTGCCTGGAGAGGG - Intergenic
1010499731 6:76582668-76582690 GTGGATGAGAAGCCTGGAGTAGG + Intergenic
1012501090 6:99888873-99888895 GGTGAAGGATAGCCTGGAGTTGG - Intergenic
1012981076 6:105831079-105831101 GGGGAAGGGGAGGCTGGAGGAGG + Intergenic
1013473521 6:110486990-110487012 GGTGATGGGGTGTCTGGAATTGG - Intergenic
1014794925 6:125713858-125713880 GGAGATGGAGAGACTGGACAAGG - Intergenic
1014826999 6:126058096-126058118 GGAGGTGGGGGGCTAGGAGTGGG - Intergenic
1016307885 6:142702612-142702634 GGTGATGGGTTTCCTGGAGTGGG - Intergenic
1016836414 6:148481608-148481630 GGAAATGGGGAGGCTTGAGCAGG + Intronic
1017523300 6:155220906-155220928 GGAGGTGGGGAGCTAGGAGACGG - Intronic
1017962324 6:159233199-159233221 GGAGATGGGCTGCCTGGAGGAGG - Exonic
1018471335 6:164101098-164101120 GGAGAAGGGGGGCCTGCAGGTGG - Intergenic
1018471449 6:164101409-164101431 GGAGGAGGGGAGCCTGCAGGTGG - Intergenic
1018471473 6:164101472-164101494 GGAGGAGGGGAGCCTGCAGGTGG - Intergenic
1018471480 6:164101493-164101515 GGAGGAGGGGAGCCTGCAGGTGG - Intergenic
1018471487 6:164101514-164101536 GGAGGAGGGGAGCCTGCAGGTGG - Intergenic
1018471494 6:164101535-164101557 GGAGGAGGGGAGCCTGCAGGTGG - Intergenic
1018471506 6:164101577-164101599 GGAGGAGGGGAGCCTGCAGGTGG - Intergenic
1018471540 6:164101724-164101746 GGAGGAGGGGAGCCTGCAGGTGG - Intergenic
1018471551 6:164101766-164101788 GGAGGAGGGGAGCCTGCAGGTGG - Intergenic
1018471558 6:164101787-164101809 GGAGGAGGGGAGCCTGCAGGTGG - Intergenic
1018611950 6:165655385-165655407 TGGGATGGGAAGCCTGGAGGAGG - Intronic
1018955988 6:168410909-168410931 GGAGGTGGGGGGCCGGGAGGTGG - Intergenic
1018967540 6:168500353-168500375 AGAGAAGGGGAGACTGAAGTAGG + Intronic
1019186919 6:170225990-170226012 GGGGATGGTGAGACTGGAGGTGG - Intergenic
1019295307 7:270741-270763 GGGGTTGGGGAGGCTGGAGGTGG - Intergenic
1019500814 7:1363994-1364016 GGAGATGGGGAGTGAGGAGTGGG - Intergenic
1019508780 7:1406722-1406744 GGACATGGAGAGCCTGGACCAGG - Intergenic
1019542083 7:1556059-1556081 GGAGAGGAGGAGGCTGGACTGGG - Intronic
1019556542 7:1634298-1634320 GGAGAGGGAGATCCGGGAGTTGG - Intergenic
1020011768 7:4809204-4809226 GGAGATGGGCAGGCCCGAGTCGG - Intronic
1021199296 7:17710431-17710453 GGAGATGGCAGGCCTGGAGGTGG + Intergenic
1021395672 7:20145039-20145061 GGAGTTGTGGAACATGGAGTTGG - Intronic
1023255395 7:38307781-38307803 GGAAATAGGGAACCTGGAGCAGG + Intergenic
1023638913 7:42238356-42238378 GGAGATGGGGAGCCAAGGATGGG - Intergenic
1023879069 7:44308416-44308438 GGGGATGGGGACCCAGGAGCAGG - Intronic
1023935473 7:44737023-44737045 GAAGATCAGGGGCCTGGAGTAGG + Intergenic
1024340192 7:48249984-48250006 TGAGAAGGGAAGCCTGGACTTGG - Intronic
1024619710 7:51146973-51146995 GGTGATGGGGAGCCAGCAGGGGG + Intronic
1024667774 7:51563543-51563565 GGAGCTGGGGAGACTGGGGAAGG - Intergenic
1024983528 7:55177249-55177271 GGAGAGGGGGAAGCTGGAGGAGG + Intronic
1026533167 7:71217974-71217996 GGAGCTGGAAAGCCTGGAGATGG - Intronic
1026873870 7:73869032-73869054 GGAGATGGGGAGCCAGGGAGTGG - Intergenic
1028237561 7:88380814-88380836 GGAGATTGGGATGGTGGAGTGGG + Intergenic
1028360228 7:89957777-89957799 GGAGATGGGGGGCCTGATCTTGG - Intergenic
1029224418 7:99014606-99014628 GGAGAATGGGAGTCTGGAGCTGG + Intergenic
1029283216 7:99449929-99449951 GGAGAAGGTGAGCCTGGAAGCGG + Intronic
1029409508 7:100399675-100399697 GGAGAAGGGGAGTGTGGTGTGGG + Intronic
1029656184 7:101926336-101926358 GGAGAAGAGGTGCCTTGAGTGGG + Intronic
1029708165 7:102286346-102286368 GGACAATGGGAGCCTGGAGGAGG - Intronic
1030985079 7:116231832-116231854 GGAAATGGGGAGCTGGGGGTGGG - Intronic
1032908717 7:136404333-136404355 GGATATGGGGCTCCTGGAGGGGG + Intergenic
1033186578 7:139231856-139231878 GGAGACGGTGCGCCTGGAGCTGG + Exonic
1034291368 7:149934728-149934750 GGAGGTGGGAGGCCTGGTGTTGG - Intergenic
1034417360 7:150972106-150972128 GGAGGTGGGGAGGCTAGACTGGG - Intronic
1034814730 7:154162166-154162188 GGAGGTGGGAGGCCTGGTGTTGG + Intronic
1035195271 7:157214089-157214111 GGAGATGGGGAGAAAGGAGGAGG - Intronic
1035293894 7:157857113-157857135 GGAGCTGGGGATGCTGGAGGGGG + Intronic
1035313492 7:157984232-157984254 GGGGAGGTGGAGCCTGGCGTGGG - Intronic
1035353742 7:158265013-158265035 GGGGCTGTGGGGCCTGGAGTAGG - Intronic
1036753781 8:11459301-11459323 GGAGTTGGGGAGACTTGAGCTGG - Intronic
1037630514 8:20651541-20651563 GGAGATGGAGAGCCTGTGGCTGG - Intergenic
1037748424 8:21664219-21664241 GGATATGGGGAGCCTGGGGCTGG - Intergenic
1037808291 8:22070340-22070362 AGAGATGGGGAGAGTGGAATGGG + Intronic
1038486972 8:27942723-27942745 GGAGTTGGGCTGCCTTGAGTGGG + Intronic
1040021715 8:42746799-42746821 TGTGGTGGTGAGCCTGGAGTTGG - Intergenic
1040889828 8:52305762-52305784 GTAGATGGGCATCCTGGAGGTGG - Intronic
1041637053 8:60156267-60156289 GGAGGTGGGTAGCCTGGGGCAGG + Intergenic
1042169943 8:65981418-65981440 GGAGATGGTGAGACTTGAGCAGG - Intergenic
1042467177 8:69141064-69141086 GGAGGTGGGTAGCCTGGGGCAGG - Intergenic
1042902826 8:73746315-73746337 GGAGAGGGAGCGCCTAGAGTAGG - Intronic
1043472797 8:80578630-80578652 GGAGAAGGGGAGCAGGGAGAAGG - Intergenic
1043982409 8:86657627-86657649 GGAGCTGGGGCACCTGGAGCGGG + Intronic
1044892114 8:96848022-96848044 TGACATGGGGAGGTTGGAGTGGG - Intronic
1045253850 8:100502989-100503011 GGGGATGGGGAGGATGGGGTGGG + Intergenic
1045431736 8:102121378-102121400 GGAGTTGGAGAGCTTGGAGTGGG + Intronic
1046031022 8:108784441-108784463 GGAGATGGAGCGCCTGGAGAAGG - Exonic
1047640619 8:126817455-126817477 GGAGATGGAGAGCTTTGAGTTGG + Intergenic
1047672089 8:127159080-127159102 AGAGGTGGGGAGCGTGGAGTAGG - Intergenic
1048009216 8:130443171-130443193 GGAGAGGGGGCCCCTGCAGTGGG - Intronic
1048674389 8:136761772-136761794 GGAGATGGGGAGCAAGGGGAGGG - Intergenic
1048980835 8:139702785-139702807 GGAGCTGGTGATCCTGCAGTCGG - Exonic
1048987511 8:139742634-139742656 GGAGTTAGGGAGCCAGGAGATGG + Intronic
1049009805 8:139879672-139879694 GGAGAGGAGGTGCCTGGTGTAGG - Intronic
1049162305 8:141105222-141105244 GGAGATGAGGGGCCCTGAGTGGG - Intergenic
1049186769 8:141259354-141259376 GGAGCTGGGGGGCCTGAGGTGGG - Intronic
1049365802 8:142236320-142236342 GGAGGTGGGGAGCCTGGCAGGGG + Intronic
1049387790 8:142353107-142353129 GTAGAGGGGGACCCTGGAGAAGG - Intronic
1049789833 8:144467475-144467497 TGGGATGTGGATCCTGGAGTAGG - Exonic
1049804509 8:144532824-144532846 AGCCATGGGTAGCCTGGAGTGGG - Intronic
1050005252 9:1122774-1122796 GGATAAGGGGAGTGTGGAGTAGG - Intergenic
1050559120 9:6816392-6816414 GGAAAAGGGGAGCCTATAGTAGG - Intronic
1050715750 9:8523219-8523241 GGAGATGGGGACAGTGGAGCAGG + Intronic
1050730544 9:8704245-8704267 GGAGATGCAGAGGATGGAGTGGG - Intronic
1051334684 9:16055168-16055190 GGAGATGGGGGAACTGTAGTAGG + Intronic
1052325694 9:27214963-27214985 GGAGTTGGGAAAGCTGGAGTAGG - Intronic
1052457692 9:28721659-28721681 GGGGATGGGGAGAATGGAGAGGG + Intergenic
1052736888 9:32352001-32352023 GGAGACTGGGAGACTGGAGGAGG - Intergenic
1052915686 9:33923072-33923094 GGAGGTGGGGAGCCTGGAGCTGG - Intronic
1053470864 9:38345481-38345503 GGAGAAGGGGAGACAGGAGATGG - Intergenic
1055004966 9:71496109-71496131 GGAGATGAGGTGGCTGGAGCAGG - Intergenic
1055024302 9:71703106-71703128 GGAGGTGGGGAGACTGAAGTGGG + Intronic
1055439536 9:76324588-76324610 GGAAATGGGGACCTTGGAGCAGG - Intronic
1055862906 9:80774984-80775006 GGAGAGGGTTAGCCAGGAGTGGG - Intergenic
1056802192 9:89700098-89700120 GGAGTAGGTGAGGCTGGAGTGGG - Intergenic
1056883798 9:90420658-90420680 GGAGATGGTGAGGCTGAACTTGG + Intergenic
1056936546 9:90919298-90919320 GGTGATGGCAAGCCTGGAGCGGG - Intergenic
1057019256 9:91683221-91683243 GGATGTGGGGACCCTGGAGGAGG + Intronic
1057068767 9:92077955-92077977 GGAGATGGTGAGGAGGGAGTGGG - Intronic
1057200872 9:93139384-93139406 GGGGATGGCCAGCATGGAGTGGG - Intergenic
1057476350 9:95406067-95406089 GGAGTCGGGGAGCCTGGACTAGG + Intergenic
1058931254 9:109721430-109721452 GGAGTTGGAAGGCCTGGAGTTGG - Intronic
1059092036 9:111369951-111369973 GGAGAAGGGGAGAGTGGATTTGG - Intronic
1060047067 9:120349560-120349582 GGAGAGGGGCAGCCTGAGGTGGG - Intergenic
1060067756 9:120518477-120518499 GGAGAGGGAGAGACTGGAGAAGG - Exonic
1060219248 9:121755642-121755664 GGAGATGTGGAGCTTGGGGTGGG + Intronic
1060405787 9:123372503-123372525 GGAGAAGGTGAGCCTGTACTGGG + Intronic
1060594894 9:124841802-124841824 TGAGATGTGGAACTTGGAGTGGG - Intergenic
1060727858 9:126017608-126017630 TGGGATGGGGAGCGTGGAGTGGG + Intergenic
1060807250 9:126585629-126585651 GGAGATGGGGACCCATGAGGAGG + Intergenic
1061239573 9:129361825-129361847 GGAGAAGGGGAGCCAGTGGTGGG - Intergenic
1061246154 9:129402136-129402158 GGAGTTGGGGAGCAGGGAGGAGG - Intergenic
1061506863 9:131036484-131036506 GCAGAAGGGGAGCCTGGGGAGGG + Intronic
1061921829 9:133786854-133786876 GGAGAGGGGAAGCGTGGAGCGGG + Intronic
1061960172 9:133983802-133983824 GGAGCCGGGGAGCGTGGGGTGGG - Intronic
1062035586 9:134381170-134381192 GGAGAGGGGGACCCTGGGGAGGG + Intronic
1062312188 9:135944847-135944869 GGAAATGGCGAGCCTGGGGGCGG - Intronic
1062473637 9:136717384-136717406 GGAGAGGCAGAGCCAGGAGTGGG + Intronic
1062570491 9:137182858-137182880 GGAGATGGGGAGGCTGAGGAAGG + Intronic
1062725315 9:138070026-138070048 GGAGGTGGGGTTTCTGGAGTGGG + Intronic
1185464429 X:346321-346343 GGAGACCGGGAGCCGGGAGAGGG + Intronic
1187371936 X:18716590-18716612 GGGGATGGAGAGCCGGGAGGGGG - Intronic
1187746124 X:22411315-22411337 GGAGATGGGGATCGTGGGGGGGG - Intergenic
1189239524 X:39515017-39515039 GGGGATGGGGAGCTGCGAGTGGG - Intergenic
1189405569 X:40720139-40720161 GGAGAGGGGGTGACTGGTGTTGG - Intronic
1189993192 X:46613752-46613774 GGAGATAGTGTCCCTGGAGTGGG + Intronic
1190116576 X:47629502-47629524 GGTTAGGGGGAGCCTGGGGTGGG - Exonic
1190290241 X:48987733-48987755 GGAGATGGGGGAACTGGAGAGGG + Intronic
1191915383 X:66195301-66195323 GGAGATGGAGAGGATGAAGTAGG + Intronic
1192181763 X:68920615-68920637 GGAGATCCAGGGCCTGGAGTGGG - Intergenic
1192784330 X:74322382-74322404 GGAGATTGGGAGCAGGGACTTGG + Intergenic
1193252514 X:79308741-79308763 TGAGCTGTGCAGCCTGGAGTTGG - Intergenic
1194381755 X:93200952-93200974 GGGGAAGGGCAGGCTGGAGTTGG - Intergenic
1194934889 X:99937131-99937153 GGAGAAGGGGATCAGGGAGTGGG + Intergenic
1195384089 X:104297226-104297248 GGAGATGGGGCAGCTGGAGATGG + Intergenic
1195672984 X:107484606-107484628 GGGGGAGGGGAGCCTGGTGTGGG + Intergenic
1197426001 X:126297647-126297669 GGAGATTGGGATAGTGGAGTGGG - Intergenic
1198226218 X:134648218-134648240 GAAGATGGAGAGCCTGGGATGGG + Intronic
1198710420 X:139495607-139495629 AGAGATGGGGAGCCGGTAGAAGG - Intergenic
1200018005 X:153180339-153180361 GGAGATGAGGAGACAGGTGTGGG - Intronic
1200088976 X:153625620-153625642 GGAGAACGGGAGACTGGAGCTGG - Intergenic
1200105801 X:153711358-153711380 GGAGCAGGAGAGCCTGAAGTGGG - Intronic
1200154662 X:153969153-153969175 GGAGTTGGGAAGGCTGGAGCTGG - Intronic
1200213265 X:154356301-154356323 GGAGACAGGGAGCCCGGGGTGGG - Intronic
1200927589 Y:8668546-8668568 GGAGATGGGAAGCCTGAAAAGGG - Intergenic
1201426751 Y:13859730-13859752 TGGGATGGGGAGGCTGCAGTGGG - Intergenic