ID: 1184711218

View in Genome Browser
Species Human (GRCh38)
Location 22:46250493-46250515
Sequence CCGCGCGCTCCCGCAGCGCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184711218_1184711222 -4 Left 1184711218 22:46250493-46250515 CCGTGCGCTGCGGGAGCGCGCGG 0: 1
1: 0
2: 1
3: 8
4: 93
Right 1184711222 22:46250512-46250534 GCGGGCCTGGCCCGCTGTCCTGG 0: 1
1: 0
2: 0
3: 22
4: 199
1184711218_1184711226 7 Left 1184711218 22:46250493-46250515 CCGTGCGCTGCGGGAGCGCGCGG 0: 1
1: 0
2: 1
3: 8
4: 93
Right 1184711226 22:46250523-46250545 CCGCTGTCCTGGCCGCTGCGAGG 0: 1
1: 0
2: 1
3: 8
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184711218 Original CRISPR CCGCGCGCTCCCGCAGCGCA CGG (reversed) Exonic
900367671 1:2317877-2317899 CGGCCCGCGCCCTCAGCGCAGGG + Intergenic
902897088 1:19486027-19486049 CGGCGCGCTCCCCCAGTGCTGGG - Intergenic
903398258 1:23019445-23019467 AAGCGCGCTCCCGCCGCGCCGGG - Intronic
903514775 1:23902967-23902989 CCGCGCCCTCGCGCCGCGCCGGG + Intronic
905183106 1:36178540-36178562 CCTCGCGCTCCCGCTGCTCCCGG - Exonic
905356654 1:37389599-37389621 CCGTGCCCTTCCGAAGCGCAGGG + Intergenic
907051194 1:51330677-51330699 ACCCGCGCTCCCGCACCGCCGGG + Intronic
907513800 1:54980805-54980827 CCGCCCGCACCCGGTGCGCAGGG - Exonic
920191554 1:204197063-204197085 CTGAGCGCTTCCTCAGCGCAGGG + Intergenic
923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG + Intergenic
1062857102 10:784836-784858 CCTCCCGCCCCCGCAGCGCCCGG + Intergenic
1064167784 10:13001572-13001594 CCGGGCCCTCCCGGGGCGCACGG + Exonic
1070566132 10:77605141-77605163 CCGCGCCCAGCCGCAGCCCAGGG + Intronic
1073043227 10:100621468-100621490 CCGAGGGCGCCCCCAGCGCAGGG - Intergenic
1073503894 10:103967238-103967260 CCGTCCGCTCCCGCGGCGCAAGG - Exonic
1075335859 10:121608686-121608708 CCGGGCGCTGCCCCAGCGCCAGG - Intergenic
1077121466 11:910855-910877 CCGCGCGCCGCCGCCGCGCACGG + Intronic
1081573246 11:44304228-44304250 CCATGTGCGCCCGCAGCGCAGGG - Intronic
1083800061 11:65041421-65041443 CCGCGCGGATCCGCAGCGCGCGG + Exonic
1084363706 11:68684711-68684733 CCGGGCGCAGCCGCAGCTCAAGG + Exonic
1085040627 11:73324383-73324405 CTGGGCGCTCCCCCAGGGCAGGG - Intronic
1085302613 11:75467345-75467367 CTGCGAGCTCCCTCAGGGCAGGG + Intronic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1101773794 12:107775635-107775657 CGGCGCCGTCCCCCAGCGCAGGG + Exonic
1104697284 12:130872532-130872554 TCGCGCGGCCCCGCAGCCCATGG - Intronic
1105022837 12:132828731-132828753 GCTCCCGCTCCCGCAGTGCATGG - Intronic
1122697463 14:103562969-103562991 CCCCTGGCTCCCGCGGCGCACGG - Exonic
1122993250 14:105248797-105248819 CCGCGCCCTCGCGCCGCGCCGGG - Exonic
1128315145 15:66655219-66655241 CCGAGCCCGCCCGCAGCGCCTGG + Intronic
1128992493 15:72272515-72272537 CCGCGCGCGGCCGCAGCCGACGG + Exonic
1132055253 15:98647507-98647529 CCGCGGCCTCGCGCAGCTCAGGG - Intergenic
1132480951 16:165889-165911 CCCCGCGTTCCCGCCGCGCTCGG + Intronic
1132589601 16:720910-720932 ACGTGCGCTCCCCCAGGGCAGGG + Intronic
1133089773 16:3395049-3395071 CCGCGGGCTCCAGCAGGCCAGGG + Intronic
1136428369 16:30183797-30183819 CCGCGCGCCCCCGCAGCCCGCGG - Intronic
1144339708 17:14301500-14301522 CCGCGCCCGCGGGCAGCGCATGG + Exonic
1147158620 17:38558360-38558382 GCGCGCGCTGCTGAAGCGCACGG - Exonic
1147168714 17:38606107-38606129 CCGCGTGATCCCGCAGCGCGCGG + Intergenic
1148759715 17:49993435-49993457 CGGCGCGCTCGGGCAGCGCCAGG + Exonic
1149994339 17:61399158-61399180 CCCCGCGTTTCCCCAGCGCAAGG + Intergenic
1152245560 17:79183077-79183099 CCGCGCTCGGCCGCCGCGCAGGG + Intronic
1152420417 17:80189824-80189846 CGGCCCGCTCCCGCAGCGAGTGG - Exonic
1152525632 17:80886860-80886882 CCACGTGCTCCCGGAGGGCAGGG - Intronic
1160578521 18:79870482-79870504 CTGCGCGCTCCCTCTGCGCTGGG + Intronic
1160935461 19:1592586-1592608 CCCGGCGCTCCCGCAGGGCTGGG - Exonic
1162019497 19:7862238-7862260 CCACGCGCTGCCGCAGCTCGCGG - Exonic
1162019498 19:7862238-7862260 CCGCGAGCTGCGGCAGCGCGTGG + Exonic
1163370394 19:16897940-16897962 CCACGCACTCCCGGAGAGCACGG + Exonic
1168154120 19:54463738-54463760 CTGCGCCCTCCCCCAGCGCCAGG + Intergenic
926268290 2:11345003-11345025 CCGGGCTCCCCCCCAGCGCACGG - Intronic
929107192 2:38376960-38376982 CCGCGCGCTGCGGGAGCGCGGGG + Intronic
929107191 2:38376960-38376982 CCCCGCGCTCCCGCAGCGCGCGG - Intronic
929151145 2:38750506-38750528 CCGCGCGCTCCCGGTGCGCCCGG - Intronic
931614570 2:64143773-64143795 CCGCGCGCTCCGGCTGCGAGAGG - Intronic
932901929 2:75710928-75710950 GGGCGCGCTCCCGCCGCGCCTGG + Exonic
935301729 2:101698340-101698362 CCGCGCGGTCCCCCAGCGCCCGG - Intronic
944114245 2:196170958-196170980 CCGCGCGGGCCCGCCGCGAAGGG + Intronic
944154167 2:196593334-196593356 CCGAGCGGCCCCGCAGCGCCCGG + Intronic
947122932 2:226836153-226836175 CCGCCAGCTCCCGCAGCCCGGGG - Intronic
948398200 2:237663035-237663057 CTGCCGGCTCCCGCAGGGCAGGG - Intronic
1168753068 20:297542-297564 CCACTCGCTCCCGCAGCCAAAGG - Exonic
1173849799 20:46210554-46210576 CTGCTCCCTCCCGCAGCGCCTGG - Exonic
1177281493 21:18987681-18987703 CTGCGCGCTCCCTCAGTGGAGGG + Intergenic
1180871863 22:19150809-19150831 CCGCACGATCCCGCCGCGCTCGG + Intergenic
1184153186 22:42649941-42649963 CTGTGCGCTCCCGGAGGGCAAGG + Intergenic
1184582730 22:45428480-45428502 CCTCGCTCTCCTGCAGCCCAGGG - Intronic
1184690110 22:46113653-46113675 GCGGGCCCTCCCGCAGTGCAAGG + Intronic
1184711218 22:46250493-46250515 CCGCGCGCTCCCGCAGCGCACGG - Exonic
955195594 3:56802148-56802170 CCGGGCGCCCCCGCAGAGCGTGG + Intronic
961144786 3:124584786-124584808 CCCAGCGCTCCCGCATGGCACGG - Intronic
961780199 3:129316541-129316563 TCTCGCGCTCCCGCAGCCTAGGG - Intergenic
970967872 4:21948843-21948865 CCGCGCGCCCCCGCCGCCAAGGG - Intergenic
973279207 4:48341685-48341707 CCGCTCGCTCTCGCAGCGACAGG - Exonic
976704716 4:88008122-88008144 CCGCGCGCCCACGGAGCTCACGG - Exonic
982712238 4:158769085-158769107 CCCCGCGCTCCCGCAAGGCTGGG + Intergenic
984823656 4:183905962-183905984 CCGCGCGCACGCACAGCGCCCGG + Exonic
1007161097 6:39792426-39792448 GCCCGCGCTCCCGCAGCCCGAGG - Intronic
1014925682 6:127267222-127267244 CGGCGCCCTCGGGCAGCGCAGGG - Intronic
1022485103 7:30771755-30771777 CCGGGCGCTTCCGCAAGGCACGG + Intronic
1025033024 7:55572514-55572536 CCGCGCGCTCCCGACACGCCCGG + Exonic
1034880358 7:154757987-154758009 CCGCCCTCTCCCGCCACGCACGG + Intronic
1034999296 7:155599116-155599138 CACCACGCTCCTGCAGCGCAAGG + Intergenic
1038008709 8:23457309-23457331 CGGCGCGCTCCCCCAGCCCCTGG - Intronic
1039903254 8:41767646-41767668 CCGCGCGCACCCCCTTCGCAGGG - Intronic
1041839262 8:62249319-62249341 CCGCGCCCTCCTGCAGGGCAGGG - Intronic
1044729934 8:95221419-95221441 CCCAGCGTTCCCGCAGCCCATGG + Intergenic
1048965931 8:139614474-139614496 CTGCGCGCTCCCACTGTGCATGG - Intronic
1049237254 8:141518555-141518577 CCGCGCGCGGGCGCAGCTCAGGG - Exonic
1052192843 9:25678341-25678363 CCGCGCGGCCCCTCAGCCCACGG - Exonic
1054891793 9:70259317-70259339 CCGCGCGCTGCCGGAGCCCCGGG - Intronic
1056470727 9:86902799-86902821 CCGCGCGCCCCCGCAGAGGCCGG - Intergenic
1058486652 9:105448308-105448330 CCCCGCGCACCCACAGCCCACGG - Intronic
1058923402 9:109639796-109639818 CCGTGAGCTCCTGCAGGGCAGGG + Intergenic
1060811206 9:126612506-126612528 CCGCGGGGCCCCGCGGCGCAGGG + Intergenic
1060952265 9:127612017-127612039 CCGCGCGCGCCCGGGGCGCAGGG - Intergenic
1061108792 9:128552528-128552550 ACGCGCGCTCCCGCGGCGGGCGG - Intergenic
1062048172 9:134433935-134433957 CCGCCCGCTCCCCCAGAGCCTGG - Intronic
1062272235 9:135714808-135714830 CCGCGCGCCCCCGCAGCCGCCGG + Intronic
1189331011 X:40145277-40145299 CCGCGCGAACCCGCGGCGCCCGG + Intronic
1198214605 X:134545083-134545105 CCGCGCACTGCCCCGGCGCAAGG + Intergenic
1199086289 X:143633992-143634014 CCGCGCGCTCCCGTCCCACAAGG + Intronic
1199232858 X:145459349-145459371 CCACCCTCTCCCTCAGCGCATGG + Intergenic
1200077961 X:153561087-153561109 CAGCGCGCTCACCCAGGGCAAGG - Intronic