ID: 1184712804

View in Genome Browser
Species Human (GRCh38)
Location 22:46263064-46263086
Sequence GCCGCCCGGTCCCGCCATGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 76}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184712796_1184712804 30 Left 1184712796 22:46263011-46263033 CCAGGGCAGGCGTTGGGCGCTGA 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1184712804 22:46263064-46263086 GCCGCCCGGTCCCGCCATGGGGG 0: 1
1: 0
2: 1
3: 12
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184712804 Original CRISPR GCCGCCCGGTCCCGCCATGG GGG Exonic
900180163 1:1307742-1307764 GCCGCCCGGGGCCGCCGGGGTGG - Intronic
903115558 1:21176414-21176436 CGCGCCCGGTCCCGCTCTGGGGG - Intronic
903389389 1:22953489-22953511 GCCGCCCGGGCCCGACCTGGTGG - Exonic
904063033 1:27726065-27726087 GCGGCCCGGGCCGGACATGGCGG + Exonic
915410972 1:155700897-155700919 GCCGCCCCGTCCCGTCCGGGAGG + Intronic
918255152 1:182741461-182741483 GCCGCCCGGTCCCGGAAGTGAGG - Intergenic
1069949116 10:72007397-72007419 GCCGCCCAGACCGGCCGTGGCGG + Exonic
1075040743 10:119104688-119104710 GCTGCCCGGTCCCACGATGGGGG - Intronic
1079172088 11:18105996-18106018 GCCGCCGGGTCGCGACAAGGAGG - Exonic
1084265714 11:68004134-68004156 CCCGCCCTGTCCCGCCCTGCGGG + Intronic
1087117983 11:94544493-94544515 GCTGCCTGTTCGCGCCATGGGGG + Exonic
1091221187 11:133930953-133930975 GCCGCCCGGCCCAGCCTTGCCGG + Intronic
1095201386 12:39388175-39388197 GCCTCCGGTCCCCGCCATGGAGG - Intronic
1102351435 12:112195114-112195136 GCGGCCTGGTCCCGGTATGGGGG - Intronic
1105012025 12:132762124-132762146 CGCGCCCGGCCCCGCCCTGGTGG - Intergenic
1110892431 13:80707635-80707657 GCCTCCCGTTCCTGCAATGGGGG - Intergenic
1114265373 14:21070228-21070250 GCCGCGGGGCCCCGCCAGGGAGG - Intronic
1116817679 14:49598945-49598967 GCCACCCGGCGCCGCCATCGGGG - Exonic
1118592473 14:67411880-67411902 GCGGCCCGGTCCCACCATGGGGG + Intronic
1118910878 14:70061042-70061064 GCAGTCCAGTCCCACCATGGTGG + Intronic
1119863540 14:77954614-77954636 GGGGCCCGGTCCAGGCATGGTGG - Intergenic
1122077430 14:99245547-99245569 CCCGCTCTGTCCCGCCAAGGTGG + Intronic
1125536019 15:40441495-40441517 GCACCACGGTCCCGCCATCGGGG + Intronic
1127414940 15:58749221-58749243 GCCTCCCGGGGCCGCCAGGGCGG + Intronic
1128103938 15:65029343-65029365 GCCGCCCGGGCGCGGCCTGGAGG + Intronic
1129190773 15:73936372-73936394 GCAGCCAGCTCCCGCCGTGGAGG + Intronic
1131176441 15:90212232-90212254 GCTGCCCTGTCCCTCCCTGGAGG - Intronic
1132843573 16:1990087-1990109 CCCGCCCGGGCCGGCCATGGAGG + Exonic
1132934684 16:2474542-2474564 GACGCCCTGTCCCCCCATGGGGG - Intergenic
1134831036 16:17323053-17323075 GCAGCCCTGACCTGCCATGGAGG - Intronic
1141637167 16:85320235-85320257 GCCGCCCACTCCCTCCACGGAGG - Intergenic
1142691154 17:1606763-1606785 GACGCCAGGTCACTCCATGGGGG - Intronic
1145236927 17:21214681-21214703 GCCGCCCGGGCCCTCCTTGGAGG + Intergenic
1147900259 17:43779008-43779030 GCCGCCCCGTCCCGCCCCTGGGG + Intergenic
1148021996 17:44559393-44559415 GCCGCGCGGTTCCGGCCTGGGGG - Exonic
1148081108 17:44968112-44968134 GCCGCCCGGCCGCGCCGTCGGGG + Intergenic
1149806155 17:59619916-59619938 TGCGCCCGGTTCCGCCATTGCGG + Exonic
1150124089 17:62625712-62625734 GGCACCAGGTCCCGCCATGCCGG - Intergenic
1151724062 17:75874649-75874671 GCCTCCCGGCCCCGCCGGGGTGG - Exonic
1152393424 17:80016698-80016720 GCCGCCTGGTCCTGGGATGGTGG - Intronic
1161283066 19:3456199-3456221 CCCGCCCGGTCCTGCCACTGAGG - Intronic
1162420989 19:10565982-10566004 CCCGCGCGGTTCCGGCATGGCGG + Exonic
1165392328 19:35545710-35545732 GCCGCCCGGTCCCGCCCGCGCGG - Exonic
1167240130 19:48338691-48338713 GCAGCCCGATCCTGCCCTGGAGG - Intronic
932493829 2:72137010-72137032 GCATCCCTGTCCCGCCATGGAGG - Intronic
932722480 2:74147989-74148011 GCCTCCCGGCCCCGCCCCGGAGG + Exonic
934761938 2:96861260-96861282 GCTGCCCAGCCCCGCCATGCCGG - Exonic
935046738 2:99489835-99489857 GCCGCCGGGCCCGGGCATGGTGG - Exonic
940420966 2:153478766-153478788 GCCGTCCGCTCCAGCCCTGGTGG + Exonic
941020844 2:160407261-160407283 GCCGCCCGGGCCGGGCAGGGTGG - Intronic
942630518 2:177946483-177946505 GCCGCCCCGTCCCGGGAAGGAGG + Intronic
944831125 2:203534993-203535015 GGCGCCCGGCCCCGCCATCCGGG - Intronic
946248138 2:218398677-218398699 CCCGCCCCGCCCCGCCACGGAGG + Intronic
948513528 2:238488674-238488696 GCAGGCAGGTCCCGCCAAGGGGG - Intergenic
949040952 2:241849808-241849830 GCCGCCTTGTCCCTCCCTGGAGG + Intergenic
1181165805 22:20982367-20982389 GCTGCCCGGTCCAGCCATCCCGG - Exonic
1184712804 22:46263064-46263086 GCCGCCCGGTCCCGCCATGGGGG + Exonic
951962967 3:28349142-28349164 CCCGCCCCGTCCCGCCGCGGAGG - Exonic
954609555 3:51937141-51937163 CCCTCCCGGATCCGCCATGGGGG + Intronic
954912703 3:54122406-54122428 GCCGCCCGGCCCCGCCTCGGCGG - Intergenic
957888032 3:86316080-86316102 GCCCTCCAGTCCCACCATGGTGG - Intergenic
961377253 3:126475397-126475419 GCCGCCCGGCCCCGCAACCGCGG - Exonic
962218841 3:133546265-133546287 GCGGCCCGGGCCGGACATGGCGG - Intergenic
969342028 4:6548304-6548326 GCCTCCCGGTCCCCCACTGGTGG + Intronic
969669262 4:8580747-8580769 GCAGCCCGGGGCCGCCCTGGAGG - Exonic
982490621 4:156025156-156025178 ACAGCCCGGGCCCGGCATGGTGG + Intergenic
997359878 5:133288331-133288353 GGCTCCCTGTCCCACCATGGGGG - Intronic
1006513768 6:34534929-34534951 GCTGCACGGGCCCGCCCTGGTGG + Exonic
1007760123 6:44128342-44128364 GCCGCCCGGGCCTGCGTTGGAGG + Intronic
1016973486 6:149786229-149786251 GCCGCCCTGTCCCGTCTGGGAGG - Intronic
1018686529 6:166308097-166308119 GCCGCCCGCCCCCGCCCCGGGGG - Exonic
1019440590 7:1044448-1044470 GCCCCCCGGCCCCGCCCTCGCGG - Intronic
1019457473 7:1138053-1138075 GCCGCCCGGTCGCGCCGCGCCGG + Exonic
1029698022 7:102227461-102227483 GCAGCCCTGTCCCCCCATCGAGG + Exonic
1033253198 7:139777831-139777853 GCCGCCCGGGCCCGGCGCGGGGG + Intronic
1033657072 7:143381556-143381578 GCAGCCCGGCCCGGCCATGGCGG + Exonic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1039936569 8:42051583-42051605 GCCGGCCGGGCCCGCCCTGGGGG - Intronic
1039936592 8:42051625-42051647 GCCGCCCGGCCCCGCGCTCGCGG - Intronic
1040038806 8:42896636-42896658 GCCGTCCGGTCGCGCCCTCGCGG - Exonic
1043502923 8:80874213-80874235 GCCGGCCGGTCCAGCGAAGGCGG - Intronic
1052807319 9:33024945-33024967 GCCGCCTGGGCCCGCGAGGGCGG - Intronic
1062500523 9:136850145-136850167 GCAGCCCCGTCCCGCCCTGCCGG + Intronic
1186466302 X:9786530-9786552 GCTGAGCGGTCGCGCCATGGAGG + Exonic
1187447743 X:19373376-19373398 GCCGCCCCATCCCGGCAAGGAGG - Intronic
1191184133 X:57592198-57592220 GCCGCCCGGGCCCGCCATCTTGG - Exonic
1191213255 X:57910249-57910271 GCCGCCCGGGCCCGCCATCTTGG + Exonic
1200256187 X:154584594-154584616 GGCGCCAGGTCCAGCCAAGGTGG - Intergenic
1200261582 X:154619809-154619831 GGCGCCAGGTCCAGCCAAGGTGG + Intergenic
1200267564 X:154654106-154654128 GGCGCCAGGTCCAGCCAAGGTGG + Intergenic