ID: 1184714732

View in Genome Browser
Species Human (GRCh38)
Location 22:46274497-46274519
Sequence TGCTGGTTCCCTCATTCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184714725_1184714732 -7 Left 1184714725 22:46274481-46274503 CCCCCCGCTGTTCCTATGCTGGT 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1184714732 22:46274497-46274519 TGCTGGTTCCCTCATTCTCCGGG No data
1184714723_1184714732 22 Left 1184714723 22:46274452-46274474 CCTTGCTCTTGCACTGACTTTCA 0: 1
1: 0
2: 0
3: 22
4: 259
Right 1184714732 22:46274497-46274519 TGCTGGTTCCCTCATTCTCCGGG No data
1184714726_1184714732 -8 Left 1184714726 22:46274482-46274504 CCCCCGCTGTTCCTATGCTGGTT 0: 1
1: 0
2: 1
3: 6
4: 107
Right 1184714732 22:46274497-46274519 TGCTGGTTCCCTCATTCTCCGGG No data
1184714727_1184714732 -9 Left 1184714727 22:46274483-46274505 CCCCGCTGTTCCTATGCTGGTTC 0: 1
1: 0
2: 2
3: 5
4: 105
Right 1184714732 22:46274497-46274519 TGCTGGTTCCCTCATTCTCCGGG No data
1184714728_1184714732 -10 Left 1184714728 22:46274484-46274506 CCCGCTGTTCCTATGCTGGTTCC 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1184714732 22:46274497-46274519 TGCTGGTTCCCTCATTCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184714732 Original CRISPR TGCTGGTTCCCTCATTCTCC GGG Intronic
No off target data available for this crispr