ID: 1184715702

View in Genome Browser
Species Human (GRCh38)
Location 22:46280581-46280603
Sequence CCGTGGGCACCCCTGGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 317}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184715702_1184715718 28 Left 1184715702 22:46280581-46280603 CCCCTGCCCAGGGGTGCCCACGG 0: 1
1: 0
2: 1
3: 36
4: 317
Right 1184715718 22:46280632-46280654 TGTTCCCACATGGAGTGGGCTGG 0: 1
1: 0
2: 1
3: 14
4: 243
1184715702_1184715719 29 Left 1184715702 22:46280581-46280603 CCCCTGCCCAGGGGTGCCCACGG 0: 1
1: 0
2: 1
3: 36
4: 317
Right 1184715719 22:46280633-46280655 GTTCCCACATGGAGTGGGCTGGG 0: 1
1: 0
2: 2
3: 12
4: 162
1184715702_1184715713 18 Left 1184715702 22:46280581-46280603 CCCCTGCCCAGGGGTGCCCACGG 0: 1
1: 0
2: 1
3: 36
4: 317
Right 1184715713 22:46280622-46280644 TCTTTCCCTCTGTTCCCACATGG 0: 1
1: 0
2: 7
3: 67
4: 494
1184715702_1184715715 23 Left 1184715702 22:46280581-46280603 CCCCTGCCCAGGGGTGCCCACGG 0: 1
1: 0
2: 1
3: 36
4: 317
Right 1184715715 22:46280627-46280649 CCCTCTGTTCCCACATGGAGTGG 0: 1
1: 0
2: 0
3: 20
4: 255
1184715702_1184715717 24 Left 1184715702 22:46280581-46280603 CCCCTGCCCAGGGGTGCCCACGG 0: 1
1: 0
2: 1
3: 36
4: 317
Right 1184715717 22:46280628-46280650 CCTCTGTTCCCACATGGAGTGGG 0: 1
1: 0
2: 3
3: 22
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184715702 Original CRISPR CCGTGGGCACCCCTGGGCAG GGG (reversed) Intronic
900096520 1:942211-942233 CCGAGGGCACCCCCAGGAAGGGG - Exonic
900297151 1:1957545-1957567 CCCTCGGCTCCCCTGAGCAGGGG - Intronic
900368295 1:2320385-2320407 CCGTTTGCAGCCCTGGGGAGGGG - Intergenic
900404720 1:2487450-2487472 CCGGGGGGATCTCTGGGCAGGGG + Intronic
900622588 1:3594096-3594118 CAGTGGGCTCCCCTGGGCTCCGG - Intronic
900642829 1:3695513-3695535 ACGTGGCCACCCCTGTGCTGAGG + Intronic
900914050 1:5621896-5621918 CCATGGGCATCGTTGGGCAGGGG + Intergenic
900955946 1:5886622-5886644 CTGTGCGCACCTCAGGGCAGAGG - Intronic
901297163 1:8169533-8169555 GCGTGGACCCCCCAGGGCAGTGG - Intergenic
901630518 1:10645940-10645962 CCCTGGAGACCCCTGGGCAGGGG - Intronic
902468313 1:16631356-16631378 CTGGGGGCTCCCCAGGGCAGAGG + Intergenic
902863062 1:19259671-19259693 TCCTGGGTACCCCTTGGCAGAGG + Exonic
903154812 1:21436302-21436324 CTGGGGGCTCCCCAGGGCAGGGG - Intergenic
903217593 1:21851925-21851947 ACCTGGGCAGCCGTGGGCAGAGG + Exonic
904288857 1:29470938-29470960 ACGTGGGCTCCCCTGGGCACGGG + Intergenic
904411157 1:30325651-30325673 CTGTGGACTCCCCTGGGGAGGGG + Intergenic
904829846 1:33299627-33299649 CCCTGGGCATCACTGAGCAGAGG + Exonic
905106461 1:35566057-35566079 GCGTGGGCTCCCCTCGGCTGTGG + Exonic
905399434 1:37691114-37691136 CCGAGGTCAGCCCTGGGCAGTGG - Intronic
905914989 1:41678507-41678529 CGGAGGCCACCCCTGGGAAGAGG - Intronic
906069972 1:43008967-43008989 CCGTGGGCTCCCATCTGCAGCGG + Intergenic
906209991 1:44007413-44007435 GCTGGGGAACCCCTGGGCAGAGG - Intronic
906546642 1:46624138-46624160 CTCTGGGCACCCCTGTGGAGAGG - Intergenic
906718773 1:47990429-47990451 CCTTGGGCCCCCAAGGGCAGGGG + Intronic
908331457 1:63074751-63074773 CCTTCTGCACACCTGGGCAGAGG + Intergenic
912456510 1:109802003-109802025 CAGAGGGCCTCCCTGGGCAGAGG + Intergenic
914490295 1:148147156-148147178 CCCTGGGAACCCCTGGCCTGAGG + Intronic
914754394 1:150554476-150554498 TCTTGCTCACCCCTGGGCAGTGG + Intronic
915323212 1:155067361-155067383 GAGTGGGCACCGCTGGGTAGTGG - Exonic
915364857 1:155309367-155309389 CCCAGGTCTCCCCTGGGCAGTGG - Intronic
918244078 1:182643735-182643757 CCTTGGGCACCTCTGGGGTGAGG - Intergenic
919805729 1:201380062-201380084 CACTGGGCACCCCAGGGGAGGGG + Intronic
920191390 1:204196341-204196363 CAGTGTCCACCCCTGGGAAGGGG - Intronic
921390245 1:214608057-214608079 CCCTGGGAACCCCTGGCCTGAGG - Intronic
923299677 1:232629950-232629972 CGATGGGCAGCCCCGGGCAGCGG - Intergenic
923618097 1:235554390-235554412 CTCTGGCAACCCCTGGGCAGTGG + Intronic
924246722 1:242092679-242092701 CCCTGGGCACCCCTGGCCCAAGG + Intronic
924443042 1:244102743-244102765 CCCTAGGCACCCCTGGACGGTGG + Intergenic
924633381 1:245763060-245763082 CCCTGGGCTCCTCCGGGCAGAGG + Intronic
1062858604 10:792486-792508 CCTTGAGCACCACTGGGCAGGGG + Intergenic
1062931868 10:1358513-1358535 CCTGGGGCATCCCTGGGCAGCGG - Intronic
1063158013 10:3397750-3397772 CCCTGGGCTCCCCTGAGCAGGGG + Intergenic
1063392017 10:5656061-5656083 CCCTGGCCATCCCTGGGCACCGG - Intronic
1063664558 10:8053626-8053648 CAATGGGCACCCCGGGGCGGAGG - Intronic
1064430622 10:15267202-15267224 CTGTGGGCACGCATGGGCAGGGG + Intronic
1067419681 10:46134764-46134786 CTGGGGGCAGCTCTGGGCAGTGG + Intergenic
1067426337 10:46214647-46214669 CTGGGGGCAGCTCTGGGCAGTGG - Intergenic
1067550379 10:47230247-47230269 CTGTGCGCACCTCAGGGCAGGGG + Intergenic
1069591485 10:69644868-69644890 GCGTGGGCACCCAGGGGCAGGGG + Intergenic
1070783684 10:79151176-79151198 CTGTGGCCACCCCATGGCAGGGG - Intronic
1071491624 10:86140284-86140306 CTGTGGGCATCCCAGGGCATGGG - Intronic
1071496236 10:86169472-86169494 ATGTGGGTACCCCTGTGCAGGGG - Intronic
1072743340 10:97923389-97923411 ACGTGGCCACCCCTGGAGAGAGG + Exonic
1075101851 10:119511744-119511766 CCATGGGCATCCCTGTGCTGTGG - Intronic
1075806454 10:125192508-125192530 CAGTGGCCACCTCTGGGGAGGGG - Intergenic
1076139441 10:128068021-128068043 CCGTGGGCTCCCCTGTGCTGGGG - Intronic
1076146279 10:128125220-128125242 CAGTGGGCATCCCTGGCCACTGG - Intronic
1076648475 10:131970821-131970843 ACGGGGGCACCCCTTGACAGAGG - Intronic
1076919265 10:133442826-133442848 CCGTGGGCACCTCTGTGTAAAGG - Intergenic
1077096177 11:800073-800095 CCCTGGTCACCCCTGGGCCTCGG + Intronic
1077325701 11:1963088-1963110 CCATGGGCGCCCCAGAGCAGGGG - Intronic
1077413857 11:2415480-2415502 CCATGGGCACCCGAGGGAAGGGG + Intronic
1077444071 11:2582248-2582270 CCATGGCCACCCCCGGGCAGGGG - Intronic
1081098409 11:38969802-38969824 CACTGGGCAGCCCTTGGCAGAGG + Intergenic
1081864473 11:46352121-46352143 CAGTGGCCCCCCCGGGGCAGAGG + Intronic
1083224109 11:61273861-61273883 CCCTGGGAAGCTCTGGGCAGTGG - Intronic
1083825967 11:65204323-65204345 CGGAGGGCACCCCAGAGCAGAGG - Intronic
1083936223 11:65871514-65871536 CCTTGGCCAACCCTGGGGAGGGG - Intronic
1084383441 11:68828065-68828087 TCGTGGGCACCCCTGGCCTCTGG + Intronic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1084557513 11:69883747-69883769 CCTTGGGCTCCCCCGGCCAGAGG - Intergenic
1084560616 11:69903553-69903575 CCGTGGGCAGCCCCCGGAAGGGG + Intergenic
1088794523 11:113256556-113256578 CCTTAGGCAGCCTTGGGCAGTGG - Intronic
1088810208 11:113387149-113387171 CCGTGGCCACCCCGAGGCTGGGG + Intergenic
1089297354 11:117478158-117478180 CCTGGGGCACCCCTCAGCAGGGG - Intronic
1090299993 11:125626660-125626682 TCGTGGGCAATCCTGGGGAGAGG + Intronic
1091208006 11:133833842-133833864 CAGTGGACACCCCAGGACAGTGG + Intergenic
1091330560 11:134728264-134728286 CGGTGGGCACCGCTGTGCTGAGG - Intergenic
1202808681 11_KI270721v1_random:18267-18289 CCATGGGCGCCCCAGAGCAGGGG - Intergenic
1091597088 12:1885404-1885426 AAGTGTGCACCCCTGGGCTGCGG - Intronic
1091648300 12:2290336-2290358 CCCTGGGCTCAGCTGGGCAGGGG + Intronic
1092077662 12:5686655-5686677 CCATGGGCCCCTCTGGGAAGCGG + Intronic
1096577566 12:52563085-52563107 CCTTGGGCAACCCAGGGCAAGGG - Intergenic
1096619083 12:52851165-52851187 CCCTGGGGACCACTGTGCAGGGG + Intergenic
1096635125 12:52953290-52953312 GGGTGGGAAGCCCTGGGCAGTGG - Intergenic
1096766631 12:53896246-53896268 ACGTGGGCACTTCTGGGGAGGGG - Intergenic
1097050651 12:56221389-56221411 CCGGGGGCCAGCCTGGGCAGGGG - Intronic
1097679132 12:62632587-62632609 CCCGGGGCTCCCCCGGGCAGGGG - Intergenic
1100589653 12:96014513-96014535 CAGTGGTTACCCCTGGGGAGTGG + Intronic
1101660540 12:106761280-106761302 CTGAGGGCACCTCTGGCCAGCGG - Exonic
1101873616 12:108584178-108584200 CCCTGGACGCCCCTGGGGAGAGG + Intergenic
1102463293 12:113113443-113113465 CAGTGGGCACCCATGGGGACAGG - Intronic
1103362309 12:120361559-120361581 CCATGGGAACCCGAGGGCAGGGG + Intronic
1104609662 12:130217751-130217773 GCGTGGGAGCCGCTGGGCAGGGG + Intergenic
1104805408 12:131586461-131586483 CCCTGGTCACCCCTGAGCACTGG + Intergenic
1105422305 13:20264010-20264032 CCCAGGGGACCACTGGGCAGAGG - Intergenic
1106140376 13:27006489-27006511 CTGTGGGCCCCCCTGGGGACAGG + Intergenic
1107372850 13:39771421-39771443 CCCTGGGGAGCGCTGGGCAGCGG - Intronic
1113468305 13:110527249-110527271 CCTTGGGCAACCCTGGAGAGAGG + Intronic
1113575769 13:111394348-111394370 CTGTGAACATCCCTGGGCAGGGG - Intergenic
1113878244 13:113607914-113607936 CCGAGGTCTCCCCTGGGCAGGGG + Intronic
1115641879 14:35340354-35340376 CAGTGGGCACCCGAGGGGAGAGG - Intergenic
1116326807 14:43540791-43540813 CCCTGTGCTCCCCTGCGCAGTGG + Intergenic
1117470203 14:56036947-56036969 CAGTGGGCACCTCTTGGCAAAGG - Intergenic
1121855791 14:97268981-97269003 GTGTGGGCAGCCCTGGCCAGAGG - Intergenic
1122580322 14:102767732-102767754 CTGTGGGCAGCCCTGGGGAGAGG + Intergenic
1122986887 14:105216576-105216598 ACCTGGGCACCCCAGGGGAGGGG + Intronic
1123009114 14:105338702-105338724 GCCTGGGCACCCAAGGGCAGGGG - Intronic
1123010504 14:105347379-105347401 CCGTCTCCACCCCTGGGCATTGG - Intronic
1124661249 15:31552710-31552732 CGTTGGGCAACCCTGGGCATAGG - Intronic
1125677761 15:41511755-41511777 GCGTGAGCGCCCCTGGGGAGAGG + Intronic
1125767737 15:42146405-42146427 CTGTGGGCTCCCCTTGGCTGCGG - Intronic
1126381392 15:48051027-48051049 TGGTGGGCATCCCTGGGCTGTGG - Intergenic
1126663634 15:51055892-51055914 CCCTGTGCACACCTGGGCTGGGG - Intergenic
1127103087 15:55587693-55587715 CCGCCGGCACCCCGGGGCCGAGG - Intronic
1127960258 15:63885272-63885294 TCTGGGGCAGCCCTGGGCAGTGG - Intergenic
1127982630 15:64046083-64046105 CGGAGGGCGCCCCAGGGCAGCGG + Intronic
1128314971 15:66654700-66654722 CCGTGGGCTCTCCTGGACTGTGG - Intronic
1128321413 15:66697342-66697364 AGTTGGGCACCCTTGGGCAGTGG - Intergenic
1128756333 15:70186270-70186292 CTGTGAGCTCCCCTGGGGAGTGG + Intergenic
1129687087 15:77692707-77692729 CAGGGAGCAGCCCTGGGCAGAGG + Intronic
1129708344 15:77807286-77807308 CAGTGAGCTCTCCTGGGCAGGGG + Intronic
1129927782 15:79381582-79381604 GCCTGGGCACCACTGGGCAGGGG - Intronic
1130094353 15:80844865-80844887 CCATGGGCACCCTGGGGCTGGGG - Intronic
1130952852 15:88605835-88605857 CCATGGGCACCCTAGGGCCGGGG - Intergenic
1132525188 16:410798-410820 ACGTGGGCAAACCTGGGCGGGGG - Intronic
1132570309 16:641412-641434 CCGGGGGCATCCCTGTGCTGGGG - Intronic
1132807885 16:1783565-1783587 CCGTGGGCCCTCCTGAGTAGTGG + Intronic
1132896230 16:2230594-2230616 CCTTGGGCAGCCCTGGGGACTGG + Intronic
1133270826 16:4610117-4610139 CTCTGGGAACCCCTGGGCGGCGG - Intronic
1135734594 16:24920607-24920629 CCCTGGGCTGCCCTGGGAAGAGG + Intronic
1136021465 16:27443095-27443117 CCGGGGAGACCCCTGGGCTGTGG + Exonic
1136233898 16:28903177-28903199 CCGTGGGCTCCCCAGTGCTGGGG - Intronic
1136477392 16:30522004-30522026 CTGTGGACATCCCAGGGCAGGGG - Exonic
1136483064 16:30554998-30555020 CCTTGGAGAGCCCTGGGCAGTGG + Exonic
1136536675 16:30903681-30903703 CAGAGGGCACCACTGGCCAGGGG - Intergenic
1137672048 16:50284699-50284721 CAGTGGGCAAGCCTGGGCTGAGG + Intronic
1137988670 16:53131115-53131137 CCGGGGGCACCGCGGGGCAGCGG + Intronic
1138068520 16:53967086-53967108 CCTTAGGCACCACTGCGCAGCGG - Intronic
1138460242 16:57143694-57143716 CTGTGGGCACCAGTGGCCAGAGG - Intronic
1140513407 16:75524861-75524883 CCGTGGCCACACGTGGCCAGTGG - Intergenic
1141438249 16:84013153-84013175 CCAGGGGCACCCATGGGCGGAGG - Intronic
1141516601 16:84549098-84549120 CCCGGGGCATCTCTGGGCAGGGG - Intronic
1141577720 16:84975291-84975313 CATTGGGCACCTCTGGGAAGGGG - Intronic
1141878911 16:86845298-86845320 CAGTGGGGGCCCCTGGTCAGAGG - Intergenic
1142135115 16:88448413-88448435 GCCTGGGCCACCCTGGGCAGGGG - Intergenic
1142213158 16:88817913-88817935 CCGTGGCCAGCACAGGGCAGAGG - Intronic
1142492809 17:289613-289635 CGGTGGTCACCCCAGAGCAGCGG - Intronic
1144338923 17:14297285-14297307 GCGCGGGAACCCCTGGCCAGAGG - Intergenic
1144520305 17:15948410-15948432 CCGTCGGCACCACTGGGGACTGG - Intronic
1145190887 17:20841759-20841781 CCCTGGGAACCCCTGGCCTGAGG + Intronic
1147387863 17:40092301-40092323 CCCTGGGAACTCCTGGGCGGGGG + Intronic
1147862856 17:43533780-43533802 CAGGGGGCACCCATGAGCAGAGG - Intronic
1147986599 17:44310637-44310659 CCATGGGCTCCCCTGGGCCCTGG + Intronic
1148074665 17:44928433-44928455 CCATCGGGACCCCTGGGCTGGGG + Exonic
1148419053 17:47531032-47531054 GCGCGCGCACGCCTGGGCAGAGG - Intronic
1148578662 17:48728380-48728402 CCTGGGGCACCCCAGGGCATGGG + Exonic
1149658002 17:58320342-58320364 GGGTGGGCACGGCTGGGCAGGGG - Intronic
1151398739 17:73842130-73842152 GTCTGGGCACCCCTGGGCTGGGG - Intergenic
1151578164 17:74963176-74963198 AGGCGGGCACCCATGGGCAGAGG + Intronic
1152070787 17:78132683-78132705 CCCTGGGGAGGCCTGGGCAGGGG - Intronic
1152131957 17:78482961-78482983 CCGTGTGCAACCCTTGGAAGGGG + Intronic
1152218403 17:79047640-79047662 CCATGGGGGCCCCTGGGGAGCGG + Exonic
1152357071 17:79812670-79812692 CCGGGGGCGCACCAGGGCAGGGG - Intergenic
1152420007 17:80187647-80187669 CGGTGCTCACCCCTGGGCTGTGG - Intronic
1152426585 17:80221420-80221442 CCGTTCGCCCCCCTGGGGAGGGG + Intronic
1152474948 17:80512033-80512055 GCGTGGGCACTGCAGGGCAGCGG + Intergenic
1152574808 17:81135322-81135344 CCTTGGTGTCCCCTGGGCAGGGG + Intronic
1152779392 17:82219595-82219617 CGGTGGCCGCCCCTGAGCAGGGG + Intergenic
1154388484 18:13916750-13916772 CGGTGGCCAGCCCTGGGGAGTGG + Intergenic
1155527811 18:26735148-26735170 CCATGGCCACCTCTGGACAGGGG + Intergenic
1156339671 18:36200060-36200082 CTGTGAGCACGCCTGGGAAGTGG + Exonic
1156497482 18:37535700-37535722 CCCTGAGCACCCCTGGGGAAAGG + Intronic
1158416216 18:57251777-57251799 CGGTGGGCAGGGCTGGGCAGAGG - Intergenic
1160021727 18:75186650-75186672 ACATGGGCCCCTCTGGGCAGCGG - Intergenic
1160501043 18:79401137-79401159 GGGTGGGCACCCCTGGGCCTGGG + Intronic
1160783900 19:891026-891048 CCAGGGGCACCGATGGGCAGTGG + Exonic
1160801883 19:974125-974147 CCTTGGAGACCCCTGGGGAGGGG + Exonic
1160809486 19:1007288-1007310 CCGTGGGACCCCCAGGGGAGAGG + Intronic
1160995317 19:1879664-1879686 CCCTGGGAACCCCTGGCCTGAGG - Intronic
1161420145 19:4171997-4172019 CCCAAGGCACCCCTGGGCAGAGG - Exonic
1162445216 19:10718549-10718571 CTGTGGGACGCCCTGGGCAGAGG + Intronic
1162534746 19:11256229-11256251 CCGTGGGCACACAGGGGCTGGGG + Intronic
1163369245 19:16892854-16892876 CTTTGGGCAGCCCTGGGCTGGGG + Intergenic
1163387970 19:17011748-17011770 CCGTGGGCACCTGCAGGCAGAGG + Exonic
1163634739 19:18432751-18432773 GCTGGGTCACCCCTGGGCAGGGG + Intronic
1163664530 19:18597041-18597063 CCGTGGTCACTGCGGGGCAGAGG + Exonic
1164631084 19:29761844-29761866 CCCTGGGCTCTCTTGGGCAGTGG + Intergenic
1164852109 19:31492573-31492595 ACTTGGGCACCCTTGGGCAATGG + Intergenic
1165340981 19:35212027-35212049 CCGTGGGCACACCCAGGCAGAGG + Intergenic
1166054030 19:40277986-40278008 CCCTGGGCCCCCCTTGGGAGGGG + Intronic
1166737991 19:45097431-45097453 CTGGGGGCACCCCAGTGCAGGGG + Intronic
925043497 2:752483-752505 CCCTGGGTAACCCTGGGTAGAGG + Intergenic
925291476 2:2751265-2751287 CCGGGGCCACCCCTGGGCTCTGG - Intergenic
925892568 2:8447661-8447683 CTGTGGGGACCCCTGGGCTCTGG - Intergenic
927937739 2:27085068-27085090 CCTCGGGCAGCCCTGGGCTGGGG + Intronic
929119173 2:38469777-38469799 CAGTGGGAACCCCTGGAAAGAGG - Intergenic
931201009 2:60097301-60097323 CCATGGGCATCCCTGGGCACTGG - Intergenic
934857737 2:97739503-97739525 TGGAGGGCTCCCCTGGGCAGCGG - Exonic
935165164 2:100563402-100563424 CCTAAGGCACACCTGGGCAGAGG + Intronic
936010303 2:108921223-108921245 CTGTGGGCACTCCTAGGCTGGGG + Intronic
936950621 2:117974228-117974250 CCCTGGGCACCCCTGGAAAATGG + Intronic
937091739 2:119211077-119211099 CCGTAAGCACTCCTGGACAGAGG - Intergenic
937302401 2:120851400-120851422 CCGTGGGCCCCCAGGGCCAGGGG + Intronic
938379087 2:130826616-130826638 CAGTGGCCACCTCTGGGGAGAGG - Intergenic
940140502 2:150486573-150486595 CCGTGGGAATCCCTTGGGAGGGG + Intronic
945431710 2:209772186-209772208 CCGCGGGCCGCCCTGGGCTGGGG + Intronic
946852435 2:223920259-223920281 CCCTGGGCACACTTGAGCAGCGG - Intronic
947105260 2:226662222-226662244 TCGTGGGCAGCCATGTGCAGTGG - Intergenic
947875505 2:233464959-233464981 ACCTGGGCACCCCTGCCCAGTGG + Intronic
948126321 2:235567168-235567190 CAGCGGGCAGCCCTTGGCAGAGG + Intronic
948386905 2:237586111-237586133 CTGGGGGCAGCCCTGGGCTGGGG + Exonic
948855032 2:240726135-240726157 CCGTGGCCAGACCTGGGCTGTGG - Intronic
1171109919 20:22471518-22471540 CCATGTGCAACCGTGGGCAGAGG - Intergenic
1172146614 20:32762309-32762331 GCGGGGGCACCCCCGGGCGGGGG + Intergenic
1172216888 20:33242045-33242067 CAGAGGGCACACCTGGCCAGGGG - Exonic
1172519817 20:35559320-35559342 CGGTGGGTGCCCGTGGGCAGAGG - Intergenic
1172943568 20:38671296-38671318 CCCTGGAGACCCCTGGGCCGTGG - Intergenic
1173729417 20:45318070-45318092 CCGTGGTCACCTCTGGGCCTGGG - Intergenic
1174158229 20:48531164-48531186 CCTTGGGCACAACTTGGCAGGGG - Intergenic
1174401410 20:50277993-50278015 CCCTGGGCTGCCATGGGCAGAGG + Intergenic
1175319490 20:58075169-58075191 CCCTGGGCACCCCCGGGCTGGGG - Intergenic
1175520656 20:59600614-59600636 CCCTGGCTGCCCCTGGGCAGAGG + Intronic
1175537079 20:59722308-59722330 GGGTGGGCACCTCTGTGCAGTGG + Intronic
1175715816 20:61253399-61253421 CCGGGGGCGCCCCTGGGCGGAGG + Intronic
1175955754 20:62608291-62608313 CCGTGGGCTCCTCTAGGCTGTGG - Intergenic
1178497452 21:33099335-33099357 CTTGGGGCACCCTTGGGCAGAGG + Intergenic
1178613565 21:34109673-34109695 CACTGGGCACCTCTGGGAAGTGG - Intronic
1179243163 21:39609543-39609565 CCGGTGGCATCCATGGGCAGTGG - Intronic
1179605605 21:42513716-42513738 CCCTGGGCACGCCGGGGCCGGGG + Intronic
1180047710 21:45317460-45317482 GCCTGGGCACCCCTGGGCGCTGG - Intergenic
1180179734 21:46112602-46112624 CCGTGGCCACCCCTGGCGCGTGG - Intronic
1180186389 21:46141908-46141930 CCCTGGGCCCCCCCGGGGAGGGG + Intronic
1181037412 22:20176543-20176565 TTGGGTGCACCCCTGGGCAGTGG + Intergenic
1181121392 22:20670204-20670226 CCCTGGGAACCCCTGGCCTGAGG - Intergenic
1181163613 22:20971927-20971949 CCGTGGGCACGCTGGGGAAGTGG + Intronic
1181179134 22:21055017-21055039 CAGTGGGCACCCTGGGGCAGTGG + Intronic
1181330475 22:22086947-22086969 CCCTGGGCACCACTGGGCTCTGG + Intergenic
1181488153 22:23244608-23244630 CCGCTGGCTCCCATGGGCAGGGG + Intronic
1181496018 22:23287963-23287985 CCGTGAGCACACCTGGCCACTGG + Intronic
1181500610 22:23313645-23313667 CCTTGGGCTCCTCTGGGGAGGGG + Intronic
1182152997 22:28043601-28043623 CTGTGGGAACCCCTGGGCTGTGG - Intronic
1182283754 22:29232295-29232317 CTGTGGGCACCCCTGGAGAGAGG + Exonic
1183614773 22:38937266-38937288 CCGTGGGAAGCCCTGGGCTGGGG - Intergenic
1183726544 22:39593038-39593060 CCCCGGGCACCTCTGGGCAAGGG + Intronic
1183931757 22:41239524-41239546 CTGTGGGCAGCGCTGGGCGGCGG + Exonic
1184345138 22:43908586-43908608 TGGTGTTCACCCCTGGGCAGAGG - Intergenic
1184715702 22:46280581-46280603 CCGTGGGCACCCCTGGGCAGGGG - Intronic
1184998917 22:48230321-48230343 CAGTGGGAACACCTGGTCAGAGG - Intergenic
1185018939 22:48362309-48362331 CCCTGTGCTCCCCAGGGCAGGGG + Intergenic
951921781 3:27862636-27862658 GCGTGGTCAGCTCTGGGCAGAGG - Intergenic
953025736 3:39143862-39143884 GGGTGGGCTGCCCTGGGCAGGGG + Exonic
954096543 3:48333046-48333068 CCGGGGGAACGCCGGGGCAGGGG + Intergenic
960702404 3:120451122-120451144 CCGCGGGCTCCCCGGAGCAGGGG - Exonic
961038406 3:123659770-123659792 CCCTGGGCATCTCTGGGCAAAGG + Intronic
961509257 3:127391105-127391127 CAGTGGGACCCCCTGGCCAGTGG + Intergenic
961525827 3:127496739-127496761 CCGTGGGCAGCCATGGTCGGTGG - Intergenic
961805672 3:129487747-129487769 CCGTGCACAGCCGTGGGCAGTGG - Intronic
965309887 3:167115572-167115594 CCATGGGCAGCCATGGGCGGTGG + Intergenic
967542245 3:190681001-190681023 CCTTGCGCATCCCTGGGCGGAGG - Intergenic
968093228 3:195910432-195910454 ACGGAGGCAGCCCTGGGCAGCGG + Intronic
968504429 4:965373-965395 CCTTGGGCAGCCCTGGGCTGGGG - Intronic
968612613 4:1564008-1564030 CCAGGGGCACCCCAGGGCTGGGG - Intergenic
969232545 4:5841706-5841728 TCGTGGCCATCCCTGGGCTGTGG + Intronic
969421037 4:7095959-7095981 CCGTGGCCAGCTCTGGCCAGTGG - Intergenic
973954377 4:56048920-56048942 TTCTGGGCACCCCTGGGGAGGGG + Intergenic
978689023 4:111484148-111484170 CCTTGGGCACCCCAGTGCAGTGG + Intergenic
979919494 4:126479595-126479617 CCCCCGGCAGCCCTGGGCAGTGG - Intergenic
982107299 4:152022203-152022225 GCGTGGGCCCCGCTTGGCAGAGG + Intergenic
982129242 4:152212491-152212513 CCTTGACTACCCCTGGGCAGTGG - Intergenic
983053472 4:163075651-163075673 CCTTGGTCACTCCTGGGCATAGG + Intergenic
984715183 4:182917916-182917938 CCGTGGGGACCCTTGGCCGGTGG + Intronic
985580615 5:693616-693638 TCGTGGGAACCGCTGGGCAGGGG + Intergenic
985595245 5:784949-784971 CCGTGGGAACCGCTGGGCAGTGG + Intergenic
985666410 5:1183656-1183678 CCGTGGTCAGGGCTGGGCAGAGG + Intergenic
985709904 5:1422365-1422387 CCTTGGGCAGCACTGGGCAGTGG - Intronic
985709960 5:1422591-1422613 CCATGGGCAGCACTGGGCAGCGG - Intronic
985709970 5:1422627-1422649 CCATGGGCAGCACTGGGCAGCGG - Intronic
985709980 5:1422663-1422685 CCATGGGCAGCACTGGGCAGCGG - Intronic
985710000 5:1422737-1422759 CCTTGGGCAGCACTGGGCAGCGG - Intronic
985710140 5:1423297-1423319 CCATGGGCAGCACTGGGCAGCGG - Intronic
987503646 5:18744107-18744129 CCGTGGGGAGCCCTGGGTATGGG + Intergenic
988285651 5:29212910-29212932 CCTTGGTCACCCCTGGGCGTGGG - Intergenic
990825422 5:59893345-59893367 CCGCGGGCAGCCCCGGGCGGCGG + Exonic
991586329 5:68205808-68205830 CCCTGTGCTCCCCTGCGCAGTGG - Intergenic
995370075 5:111408931-111408953 CAGTGGGCTCCCATGGGCATGGG + Intronic
997869777 5:137497595-137497617 CCTGGGGCACACCTGGGGAGTGG + Intronic
997976530 5:138444685-138444707 CCTTGTTCACCCCTGGACAGAGG - Intronic
1002099755 5:176851584-176851606 CCGGGGCCACACCTGGGCTGGGG + Intronic
1002299553 5:178249409-178249431 GTGTGGGCACCGCAGGGCAGGGG + Intronic
1002300814 5:178256475-178256497 CCCTGGGCCCTCCTGGGAAGAGG - Intronic
1002308255 5:178296972-178296994 CCGTGGGAAGCCCTGGAAAGGGG - Intronic
1002313286 5:178327703-178327725 CTGTCTGCACCCCTGGACAGAGG - Intronic
1003257901 6:4490037-4490059 CCGTGGGGACTCCTGGGAGGGGG + Intergenic
1003990278 6:11479999-11480021 CCGTGGGAACCTGTGGGGAGAGG + Intergenic
1006084573 6:31586935-31586957 ACGTGGTCAGCCCAGGGCAGAGG + Intronic
1006193369 6:32222795-32222817 CCAGGGGCACACCTGGGCAGGGG + Exonic
1009366692 6:62862142-62862164 GCGTAGACACCCCTGGGCCGTGG - Intergenic
1010392152 6:75349802-75349824 CCGTGGTCTCCGCTGGGGAGGGG + Intronic
1011189888 6:84717595-84717617 CCGGGGGAACACCGGGGCAGGGG + Intronic
1012252669 6:96996099-96996121 GCGTGGGCAGCCCTGGGCTGCGG + Intronic
1013099895 6:106977409-106977431 CAGGGGGAACTCCTGGGCAGAGG - Intergenic
1014485920 6:121999076-121999098 CCATTGGAACCCCTGGGAAGTGG + Intergenic
1015376049 6:132512087-132512109 CTCTGAGCACACCTGGGCAGAGG - Intronic
1017737759 6:157380396-157380418 CCGTGGAGCCCCCTCGGCAGCGG - Intergenic
1018816627 6:167337297-167337319 GCCTGGGCAGCCCTGGGAAGGGG + Intronic
1019180093 6:170181285-170181307 CCTAGGGCACCGCTGGGAAGAGG - Intergenic
1019365491 7:630487-630509 CCGTGGGACCCCCAGGGCAATGG - Intronic
1019497039 7:1345573-1345595 CCATGGGCCCCCCTGGGTGGAGG + Intergenic
1019731720 7:2632612-2632634 CCGTGAGCCCCCTTGGCCAGTGG + Intronic
1019915615 7:4130336-4130358 CCGTGGGCAGTGCTGGGGAGAGG + Intronic
1021941741 7:25685591-25685613 CCCTGGGCCCTGCTGGGCAGTGG - Intergenic
1023263823 7:38384399-38384421 ACGTGCTCACACCTGGGCAGGGG + Exonic
1024060280 7:45692362-45692384 CTGTGAGCACCCAAGGGCAGGGG - Intronic
1026828802 7:73599570-73599592 CCGGGGGCACCTCTGGGCCCAGG + Exonic
1030081507 7:105782596-105782618 CTGTGGCCAGCCCTGGGCGGGGG + Intronic
1031484340 7:122310286-122310308 CCCTGGGCAGCCGGGGGCAGGGG - Intronic
1033355716 7:140597803-140597825 CTGTGGGAAGCACTGGGCAGGGG + Intronic
1033543195 7:142376107-142376129 CTGTGGGGAACCCTGGGGAGGGG + Intergenic
1034527356 7:151673924-151673946 CCGTGGGAACCCAGAGGCAGAGG - Intronic
1034743999 7:153504980-153505002 CCGCAGCCACCCCTGGGCTGTGG - Intergenic
1034859813 7:154585511-154585533 CCCTCAGCACCCCTGGGGAGTGG + Intronic
1038647451 8:29373335-29373357 CCGGTGGCCCCTCTGGGCAGTGG - Intergenic
1041107537 8:54457916-54457938 CTGCGGGCGCCCCTGGGCCGCGG - Exonic
1041967098 8:63691181-63691203 CGTTGGGCACCCATGGGCATTGG - Intergenic
1045663963 8:104466617-104466639 CCGTGGGTACCGCGGGGCGGGGG + Intronic
1049009103 8:139875542-139875564 CAGTTGGCATCCCTGGGCATGGG - Intronic
1049368855 8:142253905-142253927 CAGTGGGCAGCCCTGGGTCGGGG - Intronic
1049673689 8:143880481-143880503 CCGTGGGCAGTACTGGGCATGGG - Intergenic
1051932777 9:22406609-22406631 CCATGGGGCTCCCTGGGCAGAGG - Intergenic
1055928764 9:81538378-81538400 CCCTGTGTACCCCAGGGCAGAGG - Intergenic
1057220632 9:93256080-93256102 GCCCGGGCACCCCTGGGCTGGGG + Intronic
1060148718 9:121272920-121272942 CCCTGGGGACCCCTGGGCAAAGG - Intronic
1060723094 9:125991008-125991030 CTGGGGGCAGCTCTGGGCAGAGG - Intergenic
1061085132 9:128393848-128393870 CAGTGGAAGCCCCTGGGCAGGGG - Intergenic
1061135346 9:128730382-128730404 GCGTGGGGTCCTCTGGGCAGCGG + Exonic
1061215811 9:129221425-129221447 CTGGGGGCAGCCCTGTGCAGAGG + Intergenic
1061370062 9:130193055-130193077 CCGGGCCCACCCCTGGGGAGGGG - Intronic
1061406675 9:130396158-130396180 TGGTGGGCACCGCTGGGGAGGGG - Intronic
1061486400 9:130922641-130922663 CGGTGTGCATCCTTGGGCAGTGG - Intronic
1061832483 9:133304575-133304597 CCCTGGGCCCCCATGGCCAGGGG + Intergenic
1062038535 9:134393470-134393492 CCTGGGGCATCCCTGGACAGTGG + Intronic
1062124577 9:134853143-134853165 CAGTGGTCACCCCAGGGCTGTGG - Intergenic
1062323693 9:136002830-136002852 CCAGGGCCACCCCTGGGCTGAGG + Intergenic
1062391495 9:136335767-136335789 CCGAGGGCAGCCCTGGGTATGGG - Intronic
1062436382 9:136548249-136548271 CGGGAGGCAGCCCTGGGCAGCGG + Intergenic
1062628446 9:137453339-137453361 CTGTGGACACCACTGGGCAGCGG + Intronic
1185458020 X:320066-320088 ACGTGGGGGCCCCTGGGCGGTGG - Intergenic
1185788418 X:2909905-2909927 CCGGGAGCACCCCCGGCCAGTGG + Exonic
1185792524 X:2938183-2938205 CCGGGAGCACCCCGGGCCAGCGG + Exonic
1189414563 X:40802821-40802843 CAGTGGGCACCACTGGGGGGTGG - Intergenic
1189985790 X:46552358-46552380 CCTTGGTCATCCCTGGGCATGGG + Intergenic
1196756329 X:119160513-119160535 TTGTGGGCAGCCCTGGCCAGTGG - Intergenic
1199542566 X:148973317-148973339 CAGTTGTCACCCCTGGGGAGAGG - Intronic
1200130937 X:153845373-153845395 CAGTGTGAACCCCTGGGGAGGGG + Intergenic