ID: 1184715849

View in Genome Browser
Species Human (GRCh38)
Location 22:46281404-46281426
Sequence ACCCATGAGCTGGTGTGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 178}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184715841_1184715849 21 Left 1184715841 22:46281360-46281382 CCTCCCTAAGACTCAGCTTCCTC 0: 1
1: 4
2: 45
3: 410
4: 2216
Right 1184715849 22:46281404-46281426 ACCCATGAGCTGGTGTGCCCGGG 0: 1
1: 0
2: 0
3: 20
4: 178
1184715846_1184715849 2 Left 1184715846 22:46281379-46281401 CCTCATCTGTGAACTGGGCAGTG 0: 1
1: 0
2: 14
3: 112
4: 934
Right 1184715849 22:46281404-46281426 ACCCATGAGCTGGTGTGCCCGGG 0: 1
1: 0
2: 0
3: 20
4: 178
1184715843_1184715849 17 Left 1184715843 22:46281364-46281386 CCTAAGACTCAGCTTCCTCATCT 0: 1
1: 15
2: 110
3: 628
4: 2238
Right 1184715849 22:46281404-46281426 ACCCATGAGCTGGTGTGCCCGGG 0: 1
1: 0
2: 0
3: 20
4: 178
1184715842_1184715849 18 Left 1184715842 22:46281363-46281385 CCCTAAGACTCAGCTTCCTCATC 0: 1
1: 6
2: 53
3: 408
4: 1754
Right 1184715849 22:46281404-46281426 ACCCATGAGCTGGTGTGCCCGGG 0: 1
1: 0
2: 0
3: 20
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184715849 Original CRISPR ACCCATGAGCTGGTGTGCCC GGG Intronic
900094040 1:933171-933193 GACCATGCGCTGATGTGCCCGGG + Intronic
902464616 1:16608309-16608331 GCCCATGAGCTGCAGTGCCGTGG - Intronic
902731616 1:18373636-18373658 GCCCAGGAGCCGGGGTGCCCTGG + Intronic
903127714 1:21259002-21259024 ACCCATGAGCTGGAGACCCATGG + Intronic
903173431 1:21567380-21567402 ACCCACCAGCTGGTGTGTGCGGG - Intronic
903326344 1:22570951-22570973 ACCCATGAGGAGGTGGGTCCTGG + Intronic
903694792 1:25198779-25198801 GCCCACGAGCTGGTGTGTCTTGG - Intergenic
904153364 1:28461806-28461828 AGGCGTGAGCTGCTGTGCCCAGG + Intronic
904332211 1:29767437-29767459 ACGCAGGCGCTTGTGTGCCCGGG - Intergenic
905521608 1:38604827-38604849 ACGGCTGTGCTGGTGTGCCCAGG + Intergenic
906153942 1:43603300-43603322 ACCCCTGGCCTTGTGTGCCCCGG + Intronic
908176972 1:61565629-61565651 ACCCTTGCACTGGTGTGCCCAGG - Intergenic
908788336 1:67756813-67756835 ACCAATCAACTGGTCTGCCCGGG + Intronic
910159762 1:84260326-84260348 AGCCCTGAGCAGGTGTGCACAGG + Intergenic
910512382 1:88021680-88021702 GCCTTTGAACTGGTGTGCCCTGG - Intergenic
912181690 1:107226605-107226627 ACCCCTGGGCTGATGTGGCCTGG - Intronic
913518616 1:119625027-119625049 AGCCTAGAGCTGGTGAGCCCAGG + Intronic
916597295 1:166256925-166256947 ACCCATGAGCACCTGTGCCCTGG - Intergenic
919615695 1:199806000-199806022 AGCCATGAGCTGGTGTGTTGTGG - Intergenic
920163028 1:204014324-204014346 ACCATTGTGCTGGTTTGCCCAGG + Intergenic
920264221 1:204709880-204709902 AGCCATGAGCAGGTCTGCGCAGG - Intergenic
923262798 1:232283592-232283614 TCCCATGAACTGGTCTGCCTGGG + Intergenic
923916565 1:238512260-238512282 ACCCTGGAGCTGGAGTGCACTGG - Intergenic
1063174013 10:3535528-3535550 AGCTCTGAGCTGGAGTGCCCGGG + Intergenic
1065126973 10:22583431-22583453 ACCGGAGAGCAGGTGTGCCCAGG + Intronic
1065839760 10:29692769-29692791 AGGCGTGAGCTGCTGTGCCCAGG + Intronic
1067706282 10:48608562-48608584 ACCCAGGTGCTGGTGACCCCTGG - Intronic
1069603195 10:69722634-69722656 ACCCTTGAGCTTGGGTCCCCCGG + Intergenic
1071664728 10:87543373-87543395 AGGCATGAGCTACTGTGCCCTGG - Intronic
1073106818 10:101036907-101036929 AGACATGAGCTGCTGGGCCCTGG + Intronic
1073199705 10:101725385-101725407 AACCATAAACTGGTGTCCCCAGG + Intergenic
1075875232 10:125800461-125800483 ACACATGAGCTGATGAGGCCAGG - Intronic
1076109786 10:127851633-127851655 ATCCAAGAACTGGTGTGACCTGG + Intergenic
1077249817 11:1555997-1556019 GAGCAGGAGCTGGTGTGCCCCGG - Exonic
1077464903 11:2729115-2729137 ACCCATGAGCTGGGCTCTCCCGG + Intronic
1078068373 11:8092766-8092788 ACCCAGGAACTGGTGTTTCCAGG + Intronic
1079004921 11:16784717-16784739 ATCCATGACCTGATTTGCCCTGG - Intronic
1079225608 11:18602160-18602182 ACCCAGGAGCTGGTCTGCTAAGG - Intergenic
1079226972 11:18615117-18615139 ACCCCTGTGCTGGGCTGCCCAGG + Exonic
1082089307 11:48076196-48076218 CCCCAGGAGCTGGTGTGGCTGGG + Intronic
1082690468 11:56296730-56296752 ACCCATGAGGTGGAATGCGCAGG + Intergenic
1082866453 11:57904020-57904042 ACACATGAGGTGGTTGGCCCAGG - Intergenic
1083004986 11:59335694-59335716 ATGCATGGGCTGTTGTGCCCAGG - Intergenic
1083748367 11:64747205-64747227 ACCGGTGAGCTGGTTGGCCCGGG - Exonic
1084051045 11:66600089-66600111 ACCCCTGAGCTGGAGTGCCGTGG - Intronic
1084720046 11:70899677-70899699 ACCCATGCCCTGGTCTGCTCAGG + Intronic
1084830554 11:71765569-71765591 ACCCAGGAACTGATGTGCCTTGG + Intergenic
1085987528 11:81805081-81805103 ACCCATGAGCTGAAGAGGCCAGG - Intergenic
1090048710 11:123358713-123358735 AGCCAGCAGCTGGTGTGCCGTGG + Intergenic
1092412040 12:8260994-8261016 ACCCAGGAACTGATGTGCCTTGG - Intergenic
1093809515 12:23474657-23474679 GCACATGTGCTGGTGGGCCCAGG - Intergenic
1095099123 12:38163012-38163034 ACCTATGAGCTGCTTTCCCCAGG - Intergenic
1096126741 12:49125074-49125096 AGGCGTGAGCTGCTGTGCCCGGG + Intergenic
1096601674 12:52734234-52734256 ACCCCTGAGCTGGACTGGCCAGG - Intergenic
1097514288 12:60585168-60585190 ACACATGAGCTGAAGTGGCCGGG + Intergenic
1101736226 12:107465334-107465356 ACCCTGGAGCTGGTCTGCCTAGG - Intronic
1102232930 12:111276072-111276094 AGGCATGAGCTAGTGTGCCCGGG - Intronic
1102524329 12:113500554-113500576 ACCCATGAGATGGAGACCCCTGG + Intergenic
1104751763 12:131244633-131244655 ACCCCTGAGCTCTTCTGCCCTGG - Intergenic
1104780131 12:131414442-131414464 ACCCCTGAGCTCTTCTGCCCTGG + Intergenic
1105715428 13:23057799-23057821 ACCCAGGGGCTGGAGTGCCCAGG - Intergenic
1106383653 13:29264238-29264260 CCCCATGCACTAGTGTGCCCTGG - Intronic
1110604524 13:77416035-77416057 GCACATTAGCTGGTGTGCCCAGG - Intergenic
1119736286 14:76984832-76984854 AGCCCTAAGCTGGTATGCCCTGG + Intergenic
1122077179 14:99243559-99243581 ACAGATGAACTGGTTTGCCCTGG + Intronic
1124346298 15:28923676-28923698 ACCCCTGAGCAGGGATGCCCTGG - Intronic
1126225124 15:46261606-46261628 CCCCATAAGCAGGTGTGGCCAGG + Intergenic
1128892340 15:71342562-71342584 GCCCCTGCCCTGGTGTGCCCTGG + Intronic
1129085023 15:73080390-73080412 ACCCTTAAGTTGGTGAGCCCTGG + Intronic
1130266797 15:82412885-82412907 AGGCATGAGCTGCTGTGCCTGGG + Intergenic
1130505227 15:84533993-84534015 AGGCATGAGCTGCTGTGCCTGGG - Intergenic
1130612745 15:85376385-85376407 ACCCATGAGCTGATGATCCCTGG - Intergenic
1130919801 15:88334555-88334577 AACCAGGAGCTGGTGAGGCCAGG - Intergenic
1132666494 16:1083425-1083447 CCCCATCAGCAGGGGTGCCCTGG + Intergenic
1133353285 16:5117195-5117217 ACCCAGGAACTGATGTGCCTTGG - Intergenic
1134023279 16:10936673-10936695 AACTATGAGCTGGTGTTCCAAGG + Intronic
1134388925 16:13800605-13800627 ACCCATCAGATGGTGTCACCAGG + Intergenic
1134468492 16:14500334-14500356 AGGCATGAGCTGCTGTGCCCAGG + Intronic
1138252067 16:55509178-55509200 AACTATGAGCCGGTGCGCCCAGG + Exonic
1141609252 16:85171768-85171790 ACCCATGAGCTGGAGCTCCCCGG + Exonic
1143096113 17:4479359-4479381 ACACACGAGCTGGTGTGGGCTGG - Intronic
1145821066 17:27835916-27835938 AGCCAGGGGCTGGTGTGCCATGG - Intronic
1147119731 17:38328920-38328942 AGACATGGGCTGGAGTGCCCAGG + Exonic
1148547695 17:48530069-48530091 ACCCAGGACCTGGTGTGCATGGG - Intronic
1148777676 17:50104816-50104838 ACCCCTGAGCTGGGGTGATCTGG - Intronic
1151315064 17:73316873-73316895 GCCCATCAGCTGGGGTGGCCTGG + Intergenic
1152643714 17:81459453-81459475 ACCCATGAGCAGGTGGGGCCTGG - Intronic
1152866629 17:82727519-82727541 ACCTATGAGCAGCAGTGCCCGGG - Exonic
1154470896 18:14699911-14699933 AGGCATGAGGTGCTGTGCCCAGG + Intergenic
1156994256 18:43447354-43447376 AGCAATGAGCTGGAGTGCTCAGG - Intergenic
1157622365 18:49023927-49023949 ACCCAGGATGTGGTCTGCCCCGG - Intergenic
1160333849 18:78019145-78019167 ACTCATGCGCTGGTCTTCCCAGG - Intergenic
1161143816 19:2665086-2665108 TCCCACGAGCTGGGGTCCCCTGG + Intronic
1162344692 19:10112402-10112424 GCCCCTGTGCTGCTGTGCCCTGG + Intronic
1163638260 19:18447585-18447607 AGCCATGTGGTGGGGTGCCCCGG + Intronic
1164748792 19:30635931-30635953 ACCCATCAGCTGGAGTACCCGGG - Intronic
1167188423 19:47964830-47964852 AGGCATTAGCTGCTGTGCCCAGG + Intergenic
1167623631 19:50572364-50572386 AGGCATGAGCTGCTGTACCCAGG + Intergenic
926111464 2:10186954-10186976 ACCCAGGAGCTCTGGTGCCCAGG + Intronic
929142001 2:38674894-38674916 AGCCATGAGTTACTGTGCCCAGG - Intronic
930719522 2:54625867-54625889 AAGCATGAGCTACTGTGCCCGGG + Intronic
932360358 2:71100329-71100351 ACACATGGGATGGTGTGCTCAGG + Intergenic
933043897 2:77508951-77508973 AGGCATGAGCTGCTGTGGCCTGG - Intronic
934859634 2:97753691-97753713 AAACATGAGCTGCTATGCCCAGG - Intergenic
936046515 2:109192247-109192269 TCCCATGAGCTGCAGTGCCAGGG - Intronic
938406777 2:131037172-131037194 ACACATGAGCCTGTGAGCCCAGG - Intronic
942147788 2:173043480-173043502 ACCAATGAGGTGGCGTGGCCTGG + Intronic
943248889 2:185492365-185492387 ACCCAGGTGCTGGAGTGCACTGG + Intergenic
948625749 2:239266883-239266905 ACTAATGACCTGGTGTCCCCTGG - Intronic
948980572 2:241492327-241492349 GGCCATAAGCTGGTGGGCCCAGG - Intronic
949076047 2:242058549-242058571 ACCCATGTGCTGGGGTGTCCAGG - Intergenic
1169546365 20:6654958-6654980 AGCCATGAGCTGGCGTGTCCTGG + Intergenic
1170580677 20:17697374-17697396 ACACATGAGCTGATATGCTCAGG - Intronic
1171173540 20:23035244-23035266 CCCCAGGAGCTGGGGTGCCGAGG + Intergenic
1171968556 20:31549052-31549074 ACCAAGGACCTGGTGTGCCTGGG + Exonic
1174506299 20:51019916-51019938 TTCCAAGAGCTGCTGTGCCCTGG + Intronic
1176107096 20:63394606-63394628 ACGCGGGAGCTGGTGCGCCCAGG + Intergenic
1176803587 21:13458019-13458041 AGGCATGAGGTGCTGTGCCCAGG - Intergenic
1179623833 21:42636324-42636346 ACCAAGGAGCTGTTTTGCCCTGG - Intergenic
1181045154 22:20210852-20210874 CCCCATGTGCTGGGGTGGCCAGG + Intergenic
1182393366 22:30018061-30018083 CCCCCTGAGCCGGTGAGCCCAGG + Exonic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1184715849 22:46281404-46281426 ACCCATGAGCTGGTGTGCCCGGG + Intronic
1185055745 22:48577445-48577467 AACCATGAGCAGGGGTGCCCGGG - Intronic
951635825 3:24774988-24775010 CCACATGATCTGATGTGCCCTGG + Intergenic
952311271 3:32192558-32192580 AGCCAGGGGCTGGTATGCCCTGG + Intergenic
954105360 3:48406910-48406932 ACCCAGCAGCTGCTGTGCCCTGG - Intronic
956073668 3:65482101-65482123 CCCCATGATATGGTGTGCCAAGG - Intronic
960966211 3:123106632-123106654 GCTCAGCAGCTGGTGTGCCCAGG + Intronic
961889595 3:130119642-130119664 ACCCAGGAACTGATGTGCCTTGG - Intergenic
962087191 3:132204166-132204188 ACCCAAGAACACGTGTGCCCAGG + Intronic
968427658 4:534244-534266 AACCATGTGCTGGTGTGACCTGG - Intronic
968688917 4:1979934-1979956 ACCCACGTGCTGGGGTCCCCGGG - Exonic
969000085 4:3973560-3973582 ACCCAGGAACTGATGTGCCTTGG - Intergenic
969471678 4:7392783-7392805 AGCCAGGAGCTCTTGTGCCCAGG - Intronic
969753936 4:9135047-9135069 ACCCAGGAACTGATGTGCCTTGG + Intergenic
969813826 4:9671243-9671265 ACCCAGGAACTGATGTGCCTTGG + Intergenic
970660298 4:18277999-18278021 ACGAATGAGCTTGTGGGCCCTGG + Intergenic
975407475 4:74007503-74007525 GCCCATCAGCTGGAGTGCCTTGG - Intergenic
975698895 4:77042848-77042870 AGGCATGAGCTACTGTGCCCAGG + Intergenic
981483308 4:145259671-145259693 ACCCTTGTGCCAGTGTGCCCTGG - Intergenic
981871175 4:149487555-149487577 CACCATGAGCTGAAGTGCCCTGG - Intergenic
983785630 4:171726550-171726572 AGGCATGAGCTGCTGTGCCCAGG + Intergenic
984543618 4:181072105-181072127 ACGCATGAGCCTGTGTGACCAGG - Intergenic
985711712 5:1433158-1433180 AACCATGAGTTGGGTTGCCCTGG - Intronic
985912255 5:2893575-2893597 ACCCATGACCTTGGGTGTCCAGG - Intergenic
986745125 5:10736977-10736999 ACCCAGGTGCTGGAGTGCCACGG - Intronic
992180617 5:74194192-74194214 AGCAATGAGCTGGTGTGACAAGG - Intergenic
992415373 5:76547712-76547734 AACCATGAGCTGGGGTGCAGAGG - Intronic
992745549 5:79816709-79816731 ACACAGGAGCTGATATGCCCTGG - Intergenic
995367494 5:111379941-111379963 ATCCATGATTTGTTGTGCCCAGG + Intronic
996415574 5:123206775-123206797 ACCCAGCTGCTGGGGTGCCCGGG - Intergenic
997842252 5:137252590-137252612 AACAATGAGCTGGCCTGCCCTGG - Intronic
998024471 5:138803191-138803213 ACCCATGCGCTGGAGTGCAGTGG + Intronic
998226206 5:140328414-140328436 AGGCATGAGCTACTGTGCCCAGG + Intergenic
1001672097 5:173482014-173482036 AGCCAAGAGCAGGTATGCCCAGG - Intergenic
1001911013 5:175517829-175517851 GCCCATGCGGTGGTGTGCCTTGG + Intronic
1002428181 5:179187956-179187978 ACCCAGGGGATGGTGAGCCCTGG + Intronic
1006677428 6:35774410-35774432 ACCCAGGAGCTAGAATGCCCTGG + Intergenic
1007717808 6:43867447-43867469 ACCCTAGAGCAGGTTTGCCCTGG + Intergenic
1008691056 6:53979347-53979369 GCTAATGAGCTGGTGTGCTCAGG + Intronic
1012282267 6:97342262-97342284 ACCCAGGAGCTGGAGTGCAGTGG - Intergenic
1012581803 6:100879208-100879230 TTCCTTGAGGTGGTGTGCCCAGG - Intronic
1017485432 6:154897873-154897895 AGCCATGAGCCACTGTGCCCGGG + Intronic
1017654368 6:156613637-156613659 ACCACTGCACTGGTGTGCCCTGG - Intergenic
1019196310 6:170285205-170285227 ACCCGGAAGCTGGGGTGCCCTGG - Intronic
1020253905 7:6491016-6491038 ACCCATGCGCTGGTGTATTCTGG + Intergenic
1021947503 7:25742728-25742750 ACCCTTGAGCAGGTCTGACCTGG - Intergenic
1027178274 7:75918843-75918865 CCCCCAGAGCTGGTGTGCCTGGG - Intronic
1031814652 7:126418336-126418358 ACCCATAAGCATGTGTGCCCTGG - Intergenic
1035353503 7:158263640-158263662 AGCCAGGAGCTGGAATGCCCGGG - Intronic
1036852396 8:12212753-12212775 ACCCAGGAACTGATGTGCCTTGG - Intergenic
1036873764 8:12455276-12455298 ACCCAGGAACTGATGTGCCTTGG - Intergenic
1037616944 8:20527838-20527860 AGGCATGAGCTGTTGTGCCCAGG + Intergenic
1040497286 8:47977455-47977477 ACCAATGAGGTGATATGCCCAGG - Exonic
1041083715 8:54237410-54237432 AGGCATGAGCTACTGTGCCCAGG - Intergenic
1041911876 8:63097603-63097625 ACACATGAGCTGGAGAGGCCAGG - Intergenic
1042514178 8:69642514-69642536 ATCCTTGAGCTGGTCTCCCCTGG + Intronic
1043174105 8:77001952-77001974 TCCCATGAGCTGGTGAGCTGAGG + Intergenic
1046041680 8:108913542-108913564 ACCCAGGAGGTGGGGTGACCAGG - Intergenic
1050475171 9:6033715-6033737 AGACATGAGCCGCTGTGCCCAGG - Intergenic
1053414039 9:37935150-37935172 ACGCAGGAGATGGTGTGACCCGG - Intronic
1055813350 9:80177659-80177681 ACCCCTGAACTGTTGTGCCCTGG - Intergenic
1057140715 9:92725314-92725336 ACCCATGACATGGTATGGCCAGG - Intronic
1059468571 9:114485724-114485746 AGGCCTGAGCTGCTGTGCCCAGG - Intronic
1061403795 9:130382777-130382799 AGCCATGAGATGGTGGGCACGGG - Intronic
1061545348 9:131301286-131301308 ACCCATCAGCTGCTGAGTCCTGG + Intronic
1185705072 X:2260737-2260759 AGGCATGAGCCAGTGTGCCCAGG + Intronic
1186336964 X:8599596-8599618 ACACATGAGCTGGTCTTACCAGG - Intronic
1189074834 X:37905014-37905036 ACTCATGACCTGGTGTGTTCTGG - Intronic
1189473139 X:41329772-41329794 ACCCAGGGGCTGGAGTGCCATGG - Intergenic
1190370142 X:49732430-49732452 AGGCATGAGCTTCTGTGCCCGGG + Intergenic
1190750594 X:53358381-53358403 ACCCAAGAGCTGCTGGGCCAAGG + Intergenic
1190801779 X:53795826-53795848 ACCCAAGAGCTGCTGGGCCAAGG + Intergenic
1192260144 X:69501221-69501243 CCCCCAGAGCTGGTGGGCCCTGG - Intergenic
1197639393 X:128951324-128951346 AGCCCTGAGCTGCTGTGCTCTGG - Intergenic
1199128653 X:144157459-144157481 CCCCTTGCACTGGTGTGCCCCGG + Intergenic
1202364723 Y:24150631-24150653 AGGCATGAGCTGCTGTGCCTGGG + Intergenic
1202506058 Y:25519491-25519513 AGGCATGAGCTGCTGTGCCTGGG - Intergenic