ID: 1184716349

View in Genome Browser
Species Human (GRCh38)
Location 22:46284288-46284310
Sequence CAGGTACACCCTGCGGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 62}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184716349_1184716365 30 Left 1184716349 22:46284288-46284310 CCCAACTCCGCAGGGTGTACCTG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1184716365 22:46284341-46284363 AGGCTATGGGGCAGCTGCTCAGG 0: 1
1: 1
2: 1
3: 18
4: 239
1184716349_1184716356 2 Left 1184716349 22:46284288-46284310 CCCAACTCCGCAGGGTGTACCTG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1184716356 22:46284313-46284335 TGGGCCATGAGATCTTCCAACGG No data
1184716349_1184716363 18 Left 1184716349 22:46284288-46284310 CCCAACTCCGCAGGGTGTACCTG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1184716363 22:46284329-46284351 CCAACGGGAGCCAGGCTATGGGG 0: 1
1: 0
2: 0
3: 9
4: 116
1184716349_1184716361 17 Left 1184716349 22:46284288-46284310 CCCAACTCCGCAGGGTGTACCTG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1184716361 22:46284328-46284350 TCCAACGGGAGCCAGGCTATGGG No data
1184716349_1184716360 16 Left 1184716349 22:46284288-46284310 CCCAACTCCGCAGGGTGTACCTG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1184716360 22:46284327-46284349 TTCCAACGGGAGCCAGGCTATGG No data
1184716349_1184716357 3 Left 1184716349 22:46284288-46284310 CCCAACTCCGCAGGGTGTACCTG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1184716357 22:46284314-46284336 GGGCCATGAGATCTTCCAACGGG 0: 1
1: 0
2: 1
3: 8
4: 80
1184716349_1184716359 10 Left 1184716349 22:46284288-46284310 CCCAACTCCGCAGGGTGTACCTG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1184716359 22:46284321-46284343 GAGATCTTCCAACGGGAGCCAGG 0: 1
1: 0
2: 1
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184716349 Original CRISPR CAGGTACACCCTGCGGAGTT GGG (reversed) Intronic
907904212 1:58769467-58769489 AAGGAGCCCCCTGCGGAGTTGGG + Intergenic
1063548997 10:7010812-7010834 CAGGCTCACCCTGCAGATTTTGG - Intergenic
1067154146 10:43760733-43760755 CAGGCACAGCCAGCGGAGCTGGG + Intergenic
1067217166 10:44312768-44312790 CAGGCACAGCCTGAGGAGGTGGG - Intergenic
1067470951 10:46537246-46537268 CAGGGATACCCTTGGGAGTTTGG + Intergenic
1067667309 10:48289423-48289445 CAGGTACACTCTACAGAGTATGG + Intergenic
1077131088 11:973053-973075 CCAGGATACCCTGCGGAGTTGGG + Intronic
1080825633 11:35846618-35846640 CAGGGACACCTTGCAGGGTTGGG - Intergenic
1093449608 12:19300002-19300024 CAGGTACACCATGCAGAGAACGG - Intronic
1096380287 12:51151364-51151386 CAGGTACACCTTGGTGAGTGAGG + Intronic
1104981942 12:132577152-132577174 CAGGTCCACCCTGGGGAGGCTGG - Intronic
1106010789 13:25820116-25820138 CAGGTACAACCCGCCGAGGTTGG + Intronic
1107313936 13:39110807-39110829 CTGGTCCACCCTGCAGATTTTGG - Intergenic
1109429120 13:62209033-62209055 CAGGAACCCCCTGTGGAATTTGG - Intergenic
1111511386 13:89268307-89268329 CAGGTACACCCTGCTGAAATGGG + Intergenic
1122825796 14:104369806-104369828 CAGGGTCACCCTGCAGATTTTGG - Intergenic
1123186331 14:106520770-106520792 CAGGTACATACTCCTGAGTTAGG - Intergenic
1123849337 15:24339126-24339148 CAGGCACACCCTGGGGACTGCGG + Intergenic
1129255782 15:74333218-74333240 CAGGTGGACCCCGGGGAGTTGGG + Intronic
1133893132 16:9900529-9900551 CAGGTATGCTCTGTGGAGTTGGG - Intronic
1144891885 17:18499101-18499123 CAGGTAGACCCAGGGGAGTCAGG - Intergenic
1145140337 17:20445216-20445238 CAGGTAGACCCAGGGGAGTCAGG + Intergenic
1145795536 17:27653455-27653477 CAGGTAGACCCAGGGGAGTCAGG - Intergenic
1152122981 17:78429978-78430000 CTGGTCCACACTGCCGAGTTTGG - Intronic
1157365009 18:47056546-47056568 TAGGTGCACCCTGTGGAATTTGG - Intronic
1160168246 18:76531902-76531924 CAGGTACATCCTGGGTAGGTGGG + Intergenic
1161704784 19:5814538-5814560 CAGGTGTCCCCTGGGGAGTTCGG + Intergenic
1162199582 19:9010709-9010731 CAGGTAGAACCTGGGGACTTTGG - Intergenic
1162753526 19:12843459-12843481 CACCCACACCCTGAGGAGTTGGG + Intronic
1164789386 19:30963247-30963269 CAGGAAGACCCTGAGGAGGTGGG - Intergenic
930573174 2:53112613-53112635 CAGGTACGCCCTGGGGGGGTGGG - Intergenic
932491984 2:72128189-72128211 CAGGCACACCCTGGGGTGTAGGG - Intergenic
935305560 2:101733196-101733218 CAGGTGTACCCTGCAGGGTTGGG - Intronic
936515474 2:113178787-113178809 CAGGTACAATGTGTGGAGTTGGG + Intronic
938060518 2:128251004-128251026 CCGCTGCACCCTGCTGAGTTAGG - Intronic
941472312 2:165903243-165903265 TAGTTACACCCTGGTGAGTTGGG + Intronic
944444672 2:199777361-199777383 CTGGTTGACCCTGCAGAGTTTGG - Intronic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1178989152 21:37337419-37337441 CAGGTGCACCCCACGGAGCTGGG + Intergenic
1179010268 21:37551178-37551200 CACGCACACCCTCCGGAGATGGG + Intergenic
1184716349 22:46284288-46284310 CAGGTACACCCTGCGGAGTTGGG - Intronic
966110842 3:176399441-176399463 CAGACACACCCTGTGGATTTGGG + Intergenic
972045681 4:34663160-34663182 CAGGTATACCCTGCAGACTCAGG - Intergenic
973917279 4:55648397-55648419 CAGGTCCATCCTTTGGAGTTTGG + Intergenic
985577848 5:681983-682005 CAGGGACAGCCTGTGGGGTTGGG - Intronic
985592782 5:774127-774149 CAGGAACAGCCTGTGGGGTTGGG - Intergenic
997281029 5:132645706-132645728 CAGGGAGACTCTGGGGAGTTTGG + Exonic
1000339865 5:160268802-160268824 CAGGTCTACCCAGCGGACTTTGG - Intronic
1000626826 5:163548200-163548222 CAGGTAGAAAATGCGGAGTTTGG - Intergenic
1001105613 5:168851654-168851676 CATGTAAACCTTGGGGAGTTGGG - Intronic
1008984823 6:57529878-57529900 CAGGTACACCCTCTGGACCTTGG - Intronic
1009172871 6:60422822-60422844 CAGGTACACCCTCTGGACCTTGG - Intergenic
1012487203 6:99735570-99735592 GAGGCACACCATGCAGAGTTAGG - Intergenic
1023564564 7:41510942-41510964 AAGGAACAGCCTGCGGATTTTGG + Intergenic
1024039304 7:45538110-45538132 CTGGTCCACCCTGCAGATTTTGG - Intergenic
1026664315 7:72329440-72329462 TAGGGTCACCCTGTGGAGTTTGG - Intronic
1035051494 7:156001459-156001481 CAGCCACACCCTGCCGAGCTGGG - Intergenic
1039659997 8:39450782-39450804 CAGGTACACCCTGGGAATTCTGG - Intergenic
1061357686 9:130118876-130118898 CAGGCACACCCAGCTGAGATGGG + Intronic
1185643246 X:1599892-1599914 CAGGTTCACGCTGCGGAGGAGGG - Intronic
1188978076 X:36700147-36700169 CAGGTACATACTTCTGAGTTAGG + Intergenic
1192863910 X:75109097-75109119 CAGTTACACCCTACTGAGTTTGG - Intronic
1194415733 X:93609522-93609544 CTGGCCCACCCTGCAGAGTTTGG + Intergenic
1198435059 X:136609080-136609102 CAGGTACTGGCTGAGGAGTTTGG + Intergenic
1199986404 X:152955129-152955151 CAGGTACACACTCCTAAGTTAGG + Intronic
1200039674 X:153356001-153356023 CGAGGACACCCTGGGGAGTTGGG - Intronic