ID: 1184717798

View in Genome Browser
Species Human (GRCh38)
Location 22:46291662-46291684
Sequence TGCCACAGACAGGCCGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 604
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 538}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184717798 Original CRISPR TGCCACAGACAGGCCGGGCA CGG Intronic
900686130 1:3948817-3948839 TGCCACACACAGGTTGAGCATGG + Intergenic
900710781 1:4112265-4112287 TGCCACTGAAGGGCAGGGCATGG - Intergenic
900864725 1:5260229-5260251 TGCCACAGAGAAGAGGGGCAGGG - Intergenic
901185619 1:7371199-7371221 TGCCACATCCAGGCCAGGCACGG - Intronic
901198793 1:7455069-7455091 TGCCCCAGCCAGGCCGGCCCTGG - Intronic
901206046 1:7496492-7496514 TGCAGCAGACAGGGCGGACATGG + Intronic
901401786 1:9019631-9019653 AGACACAGCCAGGCTGGGCATGG + Intronic
901405903 1:9045595-9045617 TGGCAGAGACCGGCCGGGCATGG + Intronic
901769584 1:11523520-11523542 TGGCACAGAGAGGGCGAGCAGGG + Intronic
901769591 1:11523550-11523572 TGGCACAGAGAGGGCGAGCAGGG + Intronic
901769615 1:11523670-11523692 TGGCACAGAGAGGGCGAGCAGGG + Intronic
902792084 1:18776188-18776210 TAACACACAGAGGCCGGGCACGG + Intergenic
903355911 1:22747243-22747265 GGCCACAGATAGCCCAGGCAAGG + Intronic
903452014 1:23460214-23460236 TGGCAAAGGGAGGCCGGGCACGG + Intronic
904492685 1:30870537-30870559 TGCCCCGGTCAGGCCGGCCAGGG + Intronic
905057509 1:35108641-35108663 GTACACAGACAGGCTGGGCACGG - Intronic
906307006 1:44725799-44725821 TCACAAAAACAGGCCGGGCACGG + Intergenic
908452102 1:64265866-64265888 ATACACAGACAGACCGGGCATGG - Intronic
908469707 1:64431731-64431753 GGACAAAGACAGGCCGGGCGCGG - Intergenic
909239222 1:73191313-73191335 TGCCACAGACAGCCATGGCTAGG + Intergenic
909905617 1:81190967-81190989 TGCAACAAAGAGGCTGGGCATGG - Intergenic
912019551 1:105090154-105090176 AGAAACAAACAGGCCGGGCATGG + Intergenic
912529139 1:110307527-110307549 TGCCAGAGACAGTCCGAGGAAGG - Intergenic
913316879 1:117561226-117561248 TGCCTCAGACAGGCTGGAGAAGG + Intergenic
913594351 1:120359134-120359156 TGCCACTGACAGGCCGGAGGAGG + Intergenic
914092909 1:144519850-144519872 TGCCACTGACAGGCCGGAGGAGG - Intergenic
914596438 1:149158783-149158805 TGCCACTGACAGGCCGGAGGAGG - Intergenic
915872665 1:159577822-159577844 TGCCTTAAACAGGCTGGGCACGG + Intergenic
917283001 1:173397012-173397034 TGCCAAAGACAAGGTGGGCATGG + Intergenic
917358966 1:174156085-174156107 TGTCAAAATCAGGCCGGGCACGG + Intergenic
917538282 1:175890258-175890280 TCACACAGCTAGGCCGGGCACGG + Intergenic
918070014 1:181127885-181127907 AGCCACAGGCAGGCCAGGCGCGG - Intergenic
918198146 1:182242088-182242110 TGTCACAGAAAGGCGGGGCAAGG + Intergenic
918475231 1:184917497-184917519 TGGAAGAGACCGGCCGGGCAGGG - Intronic
920633391 1:207675367-207675389 GGCCATAGACAGGCCAGGGAAGG + Intronic
921216805 1:212944759-212944781 TGCCACAAACTGTCTGGGCACGG + Intergenic
921474311 1:215587417-215587439 ACCTACAGAAAGGCCGGGCATGG - Intronic
921853265 1:219953304-219953326 AGCCACCTTCAGGCCGGGCACGG + Intronic
922141554 1:222893458-222893480 TGCCAAAGGCAAGCCAGGCATGG + Intronic
922291001 1:224208771-224208793 TGCTCCAGGTAGGCCGGGCATGG + Intergenic
922385106 1:225074287-225074309 TTCCTAAGACAGGCCGGGCGCGG - Intronic
922461271 1:225816000-225816022 TGCCAAGGACTGGCCCGGCATGG + Intronic
922569137 1:226622911-226622933 TACAACAAACAGGCTGGGCACGG + Intergenic
922613519 1:226946771-226946793 TGCCACACACAGGCCAGGTGTGG - Intronic
923227195 1:231949156-231949178 TAACACAGGAAGGCCGGGCACGG - Intronic
923522323 1:234744999-234745021 TGCCACATGCAGGCCAGGCGTGG - Intergenic
923688457 1:236170683-236170705 TTGCATATACAGGCCGGGCACGG + Intronic
924238698 1:242021148-242021170 TGGCACAGCTTGGCCGGGCACGG - Intergenic
924623406 1:245681497-245681519 TACCAAAGACCGGCCGGGCGCGG - Intronic
924742432 1:246802890-246802912 AACCACAAACAGGACGGGCACGG + Intergenic
924851496 1:247835978-247836000 TGCAAAAGAGAGGTCGGGCACGG + Intergenic
1062895339 10:1098613-1098635 TAGCACAGAGAGGCTGGGCACGG - Intronic
1063688242 10:8258786-8258808 TGCCACAGACAGGCAGAGACAGG + Intergenic
1064196807 10:13250381-13250403 AACCATAGACAGGCTGGGCAGGG + Intergenic
1064560154 10:16588016-16588038 AGCCACAGACTGGCTGGGCATGG + Intergenic
1065584770 10:27206985-27207007 TGTAACTGAGAGGCCGGGCACGG + Intronic
1065977352 10:30854027-30854049 TATCACATATAGGCCGGGCACGG + Intronic
1066679209 10:37920457-37920479 AGCCACTGTCAGGCTGGGCATGG + Intergenic
1067065001 10:43099217-43099239 TTACATAGATAGGCCGGGCACGG + Intronic
1067091570 10:43268278-43268300 TCCCACAGAGAGGCCCAGCAGGG + Intergenic
1067121209 10:43473732-43473754 TACAACAGCCAGGCTGGGCAAGG + Intronic
1068858789 10:61825211-61825233 TGCCACAGACATGCAGCACAGGG + Intergenic
1069684649 10:70309830-70309852 TGCCACAGGCTTGCTGGGCATGG + Intronic
1069729107 10:70599733-70599755 CTCCACAGAGAGGCCGAGCATGG - Intronic
1071142139 10:82521627-82521649 TTCCACAGTCTGGCCGGGCACGG - Intronic
1071957645 10:90777190-90777212 TGCCTCCTACAGGCCGGGCGTGG + Intronic
1073175278 10:101552482-101552504 AGCCAGAGACAGGCCGGGTGCGG - Intronic
1073347775 10:102797406-102797428 TTCCTCAGACAGGACAGGCAAGG - Intronic
1073422384 10:103434712-103434734 AGCCACACACAGGCTGGGGAAGG - Intronic
1074159630 10:110826881-110826903 AGAAACAGACTGGCCGGGCACGG - Intronic
1075710774 10:124529486-124529508 TGCCACTGACAGGGCTGGCTGGG - Intronic
1076461425 10:130649955-130649977 TGCCACTGACAAGCCTGGCTGGG + Intergenic
1076554108 10:131311213-131311235 GGCCAGAGCCGGGCCGGGCAGGG + Intronic
1076827730 10:132978004-132978026 TCCCACAGAGACGCGGGGCACGG + Intergenic
1076827736 10:132978032-132978054 TCCCACAGAGATGCGGGGCACGG + Intergenic
1077078592 11:712601-712623 TGCCACAAACAGCCCTGGCTGGG + Intronic
1077177976 11:1199198-1199220 TGCCACAAAGAGGAAGGGCAGGG + Intronic
1077374138 11:2197665-2197687 TGACACTGCCAGGCAGGGCAGGG + Intergenic
1078413154 11:11144024-11144046 TGCCAGGGACAGGCTGAGCAGGG - Intergenic
1078602585 11:12746887-12746909 TGCCACAGACCAGGCGGGCTGGG + Intronic
1078798960 11:14623740-14623762 TGCCAGAGACAGGCTATGCATGG + Intronic
1080479601 11:32632514-32632536 TTCCACCAACCGGCCGGGCACGG - Intronic
1081021013 11:37947775-37947797 TGCCACTGCCAGGCCAGGGATGG - Intergenic
1081935904 11:46903818-46903840 TGCCACAGACAGGAAGGCCCTGG - Intronic
1083678033 11:64338564-64338586 TGTCACTGACAGGCCGGGCGTGG + Intergenic
1084268223 11:68015773-68015795 TTGCACAGCAAGGCCGGGCATGG + Intronic
1084272485 11:68036682-68036704 GGCCTCAGGCAGGCCGGGAACGG - Intergenic
1084279658 11:68079618-68079640 TAGTACAGAGAGGCCGGGCATGG - Intronic
1084386223 11:68844075-68844097 TGCCACCTGCAGGCCGGGCGGGG + Intronic
1084435648 11:69137771-69137793 TGCCCAAGACAGGGCAGGCAGGG + Intergenic
1084768792 11:71329324-71329346 TTCCACAGACAGGGAGGGCGGGG + Intergenic
1085355799 11:75835801-75835823 TTCAACAAATAGGCCGGGCATGG + Intronic
1085381786 11:76126229-76126251 TGTGACTGCCAGGCCGGGCATGG - Intronic
1085465577 11:76721213-76721235 AGCCAGACACAGGCCAGGCACGG - Intergenic
1085644812 11:78216153-78216175 TTCCACAGACAGGCAGATCAAGG + Exonic
1086187273 11:84033746-84033768 TGCCACAGCCGGGCCGGGCGCGG + Intronic
1086200112 11:84192438-84192460 TGGCAAAGAAAGGCTGGGCACGG + Intronic
1086326746 11:85709126-85709148 TCACAGAGAAAGGCCGGGCACGG - Intronic
1087419112 11:97898116-97898138 TGACAATGACAGGCCGGGCACGG + Intergenic
1087991037 11:104745284-104745306 AGCCTCAGGCAGGCCTGGCACGG - Intergenic
1088643821 11:111899326-111899348 ATCAACAGACAGGCCAGGCACGG - Intergenic
1089273955 11:117320772-117320794 TGTCATAAACAGGCCGGGCGCGG - Intronic
1089445960 11:118552501-118552523 TGCTGCAGCCAGGCCAGGCATGG + Intronic
1090224159 11:125059137-125059159 TGAAAAAGACAGGCCAGGCACGG - Intergenic
1091674609 12:2479978-2480000 TGCCACAGAGGGGCAGGGGAAGG - Intronic
1091795289 12:3294493-3294515 TGCCAGAGCCAGCCTGGGCAGGG - Intergenic
1092254462 12:6918689-6918711 TGCCACTGGAAGGCCGGGCGCGG + Intronic
1092533701 12:9366645-9366667 AGCCAAGGAGAGGCCGGGCAAGG - Intergenic
1092847940 12:12601492-12601514 AGCCCCAAACAGGACGGGCATGG + Intergenic
1094609253 12:31977475-31977497 TTCCAGAAACAGGCCAGGCATGG - Intronic
1095709732 12:45275496-45275518 GGAGACAGACAGGCCGGGCATGG - Intronic
1095943334 12:47740106-47740128 TAGCAGAGCCAGGCCGGGCAGGG + Intronic
1096059276 12:48682590-48682612 TCAGACAGACAGGCCGGGCGCGG + Intergenic
1096811479 12:54173208-54173230 AGCCACAGACAGGCAGCGCAAGG + Intronic
1097162448 12:57057520-57057542 AGCCACAGGCAGGCAGGGCAAGG + Exonic
1097240326 12:57570673-57570695 TTACATATACAGGCCGGGCACGG - Intronic
1097880759 12:64684372-64684394 TTCCACACAAGGGCCGGGCACGG - Intronic
1098123329 12:67265549-67265571 AGCCAGAAACAGGCCAGGCACGG - Intergenic
1098964748 12:76775103-76775125 AACCACAAAGAGGCCGGGCATGG - Intronic
1099442647 12:82716650-82716672 TGTACCAGACAGGCCGGGCGCGG - Intronic
1099564630 12:84227974-84227996 TGGCATAGCCAGGCCGGGCGTGG + Intergenic
1100832788 12:98533028-98533050 TGCCACAAACTTGCCTGGCAGGG + Exonic
1101230237 12:102733460-102733482 TTGTACATACAGGCCGGGCATGG + Intergenic
1102037475 12:109780359-109780381 TCCCCCAGGCAGGCTGGGCACGG - Intergenic
1102274146 12:111567209-111567231 TTCCAGAAACAGGCCGGGCGTGG + Intronic
1102665891 12:114572517-114572539 TGACAGAGACAGGCCACGCATGG + Intergenic
1103455038 12:121058849-121058871 TGGCACTGACTGGCCGGGCGCGG - Intergenic
1103821350 12:123701446-123701468 TGCAACAGATCGGCTGGGCACGG + Intronic
1103867013 12:124060937-124060959 TACAATAGAGAGGCCGGGCACGG + Intronic
1104101811 12:125619653-125619675 TGCCACAGCAGGGCCGGGCATGG - Intronic
1104492601 12:129208081-129208103 TGCTACAGCCAGGGCGGTCACGG - Intronic
1104763400 12:131311645-131311667 TCCCACAGACATGCCCTGCAGGG + Intergenic
1104946202 12:132415862-132415884 GGCCACAGCCAGGCTGGGGAGGG + Intergenic
1105026417 12:132852276-132852298 TTCAACAGATCGGCCGGGCACGG - Intronic
1106044543 13:26126446-26126468 TGCCCCAGGGAGGCAGGGCAAGG + Intergenic
1106211618 13:27653188-27653210 TGGTAAATACAGGCCGGGCACGG - Intronic
1107757352 13:43639011-43639033 TGACATATACAGGCCGGGCGTGG + Intronic
1107832972 13:44390719-44390741 TGCCGGAGACAGGCAGGGCAAGG - Intronic
1108035387 13:46285377-46285399 AGCCTCCAACAGGCCGGGCACGG + Intergenic
1108056103 13:46486972-46486994 TTGAACATACAGGCCGGGCATGG + Intergenic
1108588235 13:51889929-51889951 TACCACAGATTGGCTGGGCATGG - Intergenic
1109071314 13:57772679-57772701 TACAACAGTTAGGCCGGGCACGG + Intergenic
1109516985 13:63456451-63456473 GGAGAAAGACAGGCCGGGCATGG - Intergenic
1109851935 13:68076265-68076287 TGCCAAAGGCAAGCCAGGCATGG - Intergenic
1110363905 13:74660016-74660038 CATCACAAACAGGCCGGGCACGG + Intergenic
1110364954 13:74672510-74672532 TTGCACACAGAGGCCGGGCATGG + Intergenic
1111129161 13:83952205-83952227 TACAAAAGACTGGCCGGGCAAGG + Intergenic
1112159858 13:96855814-96855836 ATGCAAAGACAGGCCGGGCATGG + Intergenic
1112279685 13:98051688-98051710 TGCCACAGCCGGGCCAGGCACGG + Intergenic
1112410278 13:99156915-99156937 TTCCACAGACGGGGCAGGCAGGG + Intergenic
1113531267 13:111029322-111029344 TGCCATAGAGATGCCGGGCAGGG + Intergenic
1113532763 13:111041344-111041366 AGCCACAGGTGGGCCGGGCACGG + Intergenic
1113675615 13:112204983-112205005 TCCCACAGACAGACAGGGCGCGG - Intergenic
1113827230 13:113265675-113265697 AGAAACAGGCAGGCCGGGCATGG - Intronic
1113855910 13:113445417-113445439 TGCCACAGCCTGTCCTGGCATGG - Intronic
1114198182 14:20497846-20497868 TGCAACTTACAGGCCGGGCGCGG + Intergenic
1114618245 14:24079870-24079892 AGCCACTGACAGGCCGAGCTGGG + Intergenic
1115096959 14:29648942-29648964 AGCCCCAGCCAGGCCGGGCATGG - Intronic
1115312786 14:31996104-31996126 AACCACAAAGAGGCCGGGCACGG - Intergenic
1115652131 14:35410245-35410267 AAACACAAACAGGCCGGGCATGG - Intergenic
1116010288 14:39343435-39343457 AACCAAAAACAGGCCGGGCATGG - Intronic
1116107998 14:40536583-40536605 AGACACACTCAGGCCGGGCAAGG + Intergenic
1117005027 14:51412559-51412581 TAACACGGACAGGCCGGGCGCGG + Intergenic
1117377644 14:55130086-55130108 GGGCACAGACAGTCTGGGCAGGG - Intronic
1117772000 14:59142955-59142977 TCCCAAAGGCAGGCTGGGCACGG + Intergenic
1118116701 14:62785900-62785922 TTCCACAGTTAGGCAGGGCACGG + Intronic
1118258061 14:64222424-64222446 AGCCACATGTAGGCCGGGCACGG + Intronic
1118330202 14:64808968-64808990 GGCCAAAGCTAGGCCGGGCATGG + Intronic
1119066132 14:71528820-71528842 TACTACAGACAGGCCGGGCGCGG + Intronic
1119223305 14:72926277-72926299 CGCCCCAGACAGGCCAGGCCTGG + Intergenic
1119257031 14:73207784-73207806 TGCCAAAGGCAAGCCAGGCATGG + Intronic
1119713394 14:76840017-76840039 TACCATAAACAGGCTGGGCACGG - Intronic
1120761202 14:88287110-88287132 TGCCACTAACAGGCAGGGCCAGG + Intronic
1121291621 14:92780310-92780332 TGTCACAGAGAGGCCGGGTGTGG - Intergenic
1121423784 14:93833848-93833870 TGTGACAGACAGACAGGGCATGG - Intergenic
1121725262 14:96142846-96142868 TGACTCAGGCTGGCCGGGCAGGG - Intergenic
1122252448 14:100449458-100449480 TGCAACAGCCAGCCAGGGCAGGG - Intronic
1122623971 14:103074979-103075001 GCACACAGACAGGCCTGGCAGGG - Intergenic
1122656611 14:103265897-103265919 TGGCAAAGAGAGGCTGGGCATGG - Intergenic
1122719184 14:103712666-103712688 TGTCACAGACAGGCTGGGCCTGG + Intronic
1122780175 14:104140158-104140180 TGCCCCAGACAGGGCAGTCAGGG - Intronic
1123834343 15:24172533-24172555 TCACACAGACAGGCCGGGCATGG - Intergenic
1125625808 15:41108297-41108319 AGCCACAGATAGGCCGGGCGTGG + Intronic
1125647432 15:41284164-41284186 TGGCCCAGACGGGCCGGGTACGG + Intergenic
1125872829 15:43117652-43117674 AGCCAAAGACAGGCCGGGCATGG + Intronic
1127006221 15:54572714-54572736 TTAAAGAGACAGGCCGGGCACGG - Intronic
1127589474 15:60409435-60409457 AGGTACAGACAGGCCGGGCGCGG + Intergenic
1127849137 15:62897822-62897844 GACCACAGACACGCGGGGCAGGG - Intergenic
1127857487 15:62964440-62964462 TGACACAGAGGGGCTGGGCATGG - Intergenic
1128078631 15:64843177-64843199 TCCCACAGAAAGGCAGGGCCTGG - Intronic
1128359035 15:66947779-66947801 TGCAACCCACAGGCGGGGCAGGG + Intergenic
1128561176 15:68668786-68668808 AGCCAAAGACAGGCCGAGCATGG + Intronic
1128830866 15:70767296-70767318 ATCCACACACAGGCCGGGCATGG + Intergenic
1129203049 15:74017085-74017107 TGCCACTGCCCGGCCGGGCGCGG - Intronic
1129542648 15:76363454-76363476 TGCCACAGAGAGGAGGGGTAGGG + Intronic
1130060528 15:80566581-80566603 TCCCACAGACACGTCTGGCAGGG - Intronic
1130385836 15:83411170-83411192 TAGAACAGACAGGCTGGGCACGG - Intergenic
1130551610 15:84893147-84893169 TGCCTCACACAGGGAGGGCATGG - Intronic
1130575133 15:85085407-85085429 AACCAGAAACAGGCCGGGCACGG + Intronic
1130836507 15:87654958-87654980 TGCCACAGAGGGACTGGGCATGG + Intergenic
1131170578 15:90175265-90175287 TAGGACAAACAGGCCGGGCACGG - Intronic
1131189702 15:90304236-90304258 TACTACAGACGGGCCGGGCATGG + Intronic
1132467191 16:82783-82805 GGCCACAGCCAGGCTGGGCTGGG - Intronic
1132515526 16:364153-364175 TTCCAGAGCCAGGCCGGGCTGGG - Intergenic
1132860092 16:2066308-2066330 TGCCACAGCCTGGACGGGCCTGG - Intronic
1133067008 16:3215369-3215391 AAACACAGACAGGCTGGGCATGG - Intergenic
1133165332 16:3942914-3942936 AGCAACACACAGGCTGGGCACGG + Intergenic
1134371161 16:13626120-13626142 AACAAAAGACAGGCCGGGCATGG - Intergenic
1134620376 16:15684300-15684322 TGCCACTGAAGGGCCAGGCATGG + Intronic
1134633321 16:15773072-15773094 TTCCACAGACTGGGCGGGCAGGG - Intronic
1134684886 16:16151607-16151629 AGCCATAAACAGGCCAGGCACGG - Intronic
1135611909 16:23875327-23875349 AGACACAGAGAGGCTGGGCATGG - Intronic
1136037682 16:27552663-27552685 TGCCACTTGCAGGCCAGGCATGG - Intronic
1139099332 16:63746299-63746321 TACTAAAAACAGGCCGGGCACGG + Intergenic
1139558601 16:67727995-67728017 TGCCAGAGGCAGGCAGGGCTGGG + Intronic
1139663083 16:68435553-68435575 GGCCACAGACAGGAAGGGCTGGG + Intronic
1139955786 16:70692370-70692392 TGCCACAGACAGGGTGGGGAGGG + Intronic
1140277239 16:73521479-73521501 CCCTACAGACAGGGCGGGCAGGG + Intergenic
1140680305 16:77378422-77378444 TGCTAAAAACAGGCTGGGCACGG + Intronic
1140877177 16:79163506-79163528 TGTTAGAGAAAGGCCGGGCATGG + Intronic
1141474292 16:84262053-84262075 AGTCACAGAGAGCCCGGGCAGGG - Intergenic
1141541418 16:84725692-84725714 GTCGTCAGACAGGCCGGGCACGG - Intronic
1141761911 16:86034133-86034155 TGCCATTGCCAGGCTGGGCAAGG + Intergenic
1142102994 16:88285478-88285500 TGCCACAGCCAGCGTGGGCAGGG + Intergenic
1142621921 17:1170724-1170746 TGGAAGAGACAGGCCAGGCACGG - Intronic
1142995758 17:3759348-3759370 TGCCACAGAGACTCTGGGCATGG + Intronic
1143037289 17:4006645-4006667 TGCCTCAGAAAGGGTGGGCAGGG - Exonic
1143074911 17:4333385-4333407 TGTAAAAGACGGGCCGGGCACGG + Intronic
1143157053 17:4844289-4844311 TAAAACAGGCAGGCCGGGCACGG - Intronic
1143160087 17:4864077-4864099 TGACACAGCTAGGCCGGGCAAGG - Intronic
1143509137 17:7385853-7385875 TACCTCATCCAGGCCGGGCACGG - Intronic
1143800804 17:9378952-9378974 AGGAACAGACAGGCCAGGCACGG + Intronic
1144460868 17:15457752-15457774 GGCCACAGACAGGGAGGGCCAGG + Intronic
1144470868 17:15539801-15539823 TACAACATACAGGCTGGGCACGG + Intronic
1144925601 17:18804876-18804898 TACAACATACAGGCTGGGCACGG - Intronic
1146117374 17:30153205-30153227 TGCCGAAAATAGGCCGGGCACGG - Intronic
1146167112 17:30598927-30598949 TACCACAGATAGGCCGGGCAGGG - Intergenic
1146249306 17:31324355-31324377 TCACACATACAGGCAGGGCATGG - Intronic
1146270730 17:31483916-31483938 AGACACAGAGAGGCCAGGCATGG + Intronic
1147218112 17:38912573-38912595 TCCCAAAGACAGGCCTGCCAAGG - Intronic
1147224421 17:38965582-38965604 TTACACAAATAGGCCGGGCATGG + Intronic
1147268669 17:39251123-39251145 AACCATAGCCAGGCCGGGCACGG + Intergenic
1148831511 17:50435158-50435180 AGCCAGACACAGGCCAGGCACGG - Intronic
1149140519 17:53427921-53427943 TTCCACAGACCTGACGGGCAGGG - Intergenic
1149643130 17:58218156-58218178 TGCCACAAATAGGACGGGCGCGG + Intronic
1150335360 17:64326684-64326706 AGCCACAGACAGGAAGGGCTGGG + Intronic
1150441199 17:65192972-65192994 AGATACAGAAAGGCCGGGCATGG + Intronic
1150810113 17:68349591-68349613 TACAACAAACAGGCTGGGCATGG + Intronic
1151177998 17:72305071-72305093 TGGCCCAGCCAGGCCAGGCAGGG + Intergenic
1151426452 17:74033864-74033886 TGCCAAAGACAGACCCGGGAAGG - Intergenic
1151566485 17:74901323-74901345 TGGCCCAGAGAGGCAGGGCAGGG + Intergenic
1151680400 17:75619953-75619975 TGCTGCACACAGCCCGGGCAAGG + Intergenic
1152008396 17:77696290-77696312 TGCCACAGTCAGGCAGGGGGAGG + Intergenic
1152621279 17:81366125-81366147 TGCCACAGCCAGGCCTGCCCTGG + Intergenic
1152844998 17:82594206-82594228 TGCTCTAGACAGGCCGGGCACGG + Intronic
1153275532 18:3363849-3363871 TAGCACTCACAGGCCGGGCACGG + Intergenic
1153306379 18:3635427-3635449 TGGGACAGACAGGCCGGGCGCGG - Intronic
1153623143 18:6998740-6998762 AGCCCACGACAGGCCGGGCATGG + Intronic
1154491297 18:14924448-14924470 TGCCTAGCACAGGCCGGGCATGG - Intergenic
1154929336 18:20975899-20975921 TGCCACATATTGGCCGGGCATGG - Intronic
1156329735 18:36108580-36108602 TGCCACAGACAGGCCTAGTATGG + Exonic
1157128903 18:44984274-44984296 CTTCACAGACAGGCAGGGCAGGG + Intronic
1157577392 18:48752723-48752745 TACCCCAGACAGACCTGGCAAGG + Intronic
1158453025 18:57583668-57583690 GCCTACAAACAGGCCGGGCATGG + Intronic
1158518585 18:58151232-58151254 TGCCACAGACGGACCATGCATGG + Intronic
1160301250 18:77681640-77681662 TGAGACAAACAGGCCAGGCATGG + Intergenic
1160705910 19:530235-530257 ATCAACATACAGGCCGGGCACGG - Intergenic
1160840547 19:1145174-1145196 AGAAAGAGACAGGCCGGGCACGG + Intronic
1160984279 19:1830814-1830836 TGCCACAGACAGACCGCACAGGG + Intronic
1161045491 19:2132214-2132236 TGTCCCTGACAGGCCAGGCACGG - Intronic
1161275501 19:3414304-3414326 TGGAAAAGACAGGCCGGGCGCGG + Intronic
1161327611 19:3671137-3671159 GGCCCCAGACAGGCCGAGCAGGG - Intronic
1161328490 19:3674789-3674811 GTCCACAGATAGGCCGGGCACGG - Intronic
1161619054 19:5288925-5288947 AGGCACAGACAGGCAGGGCCTGG + Intronic
1162487325 19:10969183-10969205 TGGCAAAGACAGGCAGGGCCGGG - Intronic
1162822330 19:13230512-13230534 AGACAAAGACTGGCCGGGCACGG + Intronic
1163003338 19:14382398-14382420 TGACACAGACAGCCAGGGCGTGG - Intronic
1163013291 19:14438983-14439005 TTCCAAAACCAGGCCGGGCACGG - Intronic
1163088746 19:15003266-15003288 TGACTCAGGCAGGCCAGGCACGG - Intronic
1163302612 19:16457476-16457498 TGCCAGAGACAGGCTTGCCACGG + Intronic
1163377624 19:16943304-16943326 AGACAGACACAGGCCGGGCACGG - Intronic
1163581228 19:18140107-18140129 TGGCTAAAACAGGCCGGGCACGG - Intronic
1163842101 19:19617873-19617895 TCCCACCCACAGGCCGGGCTCGG + Intronic
1164975424 19:32569440-32569462 AGCCACAGACTGGCTGTGCATGG - Intergenic
1165821103 19:38676654-38676676 TACCACAGACAGGCCCGGAAAGG + Intronic
1166092322 19:40518013-40518035 TGCAAGAAACAGGCAGGGCATGG + Intronic
1166152785 19:40886233-40886255 ATCCACATACTGGCCGGGCACGG - Intronic
1166189343 19:41165428-41165450 GGTCACAGTCAGGCTGGGCACGG + Intergenic
1166685271 19:44792854-44792876 GGCCACAGTGAGGCTGGGCACGG + Intronic
1166694549 19:44845387-44845409 AGTGACAGACAGGCCGGGCTTGG + Intergenic
1166871266 19:45872545-45872567 TTCCCCAGACAAGCCTGGCAAGG + Exonic
1166919589 19:46220240-46220262 CACCACAGGCAAGCCGGGCATGG + Intergenic
1167484100 19:49750545-49750567 TGTCAATGATAGGCCGGGCACGG - Intronic
1167566892 19:50262265-50262287 TGGCTCAGAGAGGCCGGGCACGG + Intronic
1167621398 19:50563024-50563046 AGACAGAGACAGGCCAGGCATGG - Intronic
1167627571 19:50602748-50602770 TAGCAAAGACAGGCCGGGCACGG - Intergenic
1167927348 19:52832303-52832325 CTGCAGAGACAGGCCGGGCACGG + Intronic
1167996998 19:53413948-53413970 AGCTACATAGAGGCCGGGCACGG + Intronic
1168338310 19:55609309-55609331 TTCCAAAGTCAGGCCAGGCATGG - Intronic
1168695124 19:58399971-58399993 TGACCCAGACAGGCCAAGCAGGG + Intergenic
925603039 2:5628488-5628510 TGCCACTGACAGGCCGGAGGAGG + Intergenic
925689352 2:6505498-6505520 TGCCACAGACAGGAGGGCTATGG - Intergenic
926024460 2:9529157-9529179 AGCCACACACAGGCTGGGCGTGG + Intronic
926107423 2:10160933-10160955 TTCCACAGAGAGGCAGGGCTGGG - Intronic
926110537 2:10180338-10180360 CTACACAGACAGGCTGGGCATGG + Intronic
926184365 2:10677227-10677249 TGCCAAAGTTAGGCCAGGCATGG - Intronic
926817280 2:16811706-16811728 AGCCAGACACAGGCCAGGCACGG - Intergenic
927152028 2:20201744-20201766 CGCCACAGGCAGGACGGGCGTGG + Exonic
927314927 2:21670688-21670710 TTACAGAGTCAGGCCGGGCACGG - Intergenic
927483890 2:23475646-23475668 TGCCAGAGACGGGCGGCGCAAGG + Exonic
929466493 2:42149394-42149416 GACCAAAGACAGGCCAGGCACGG + Intergenic
929848870 2:45562520-45562542 AGCCAGTGACAGGCCGGGCGCGG - Intronic
929895566 2:45957754-45957776 AGACCCAGACAGGCAGGGCATGG + Intronic
930029345 2:47048891-47048913 AGCCAGAGACAGGCCAGGCATGG - Intronic
930791137 2:55330205-55330227 TGGGACAGTTAGGCCGGGCACGG + Intronic
931394307 2:61872635-61872657 CCCCACACCCAGGCCGGGCACGG + Intronic
932172695 2:69572022-69572044 AGCCACAGACAAACCTGGCAAGG + Intronic
932228315 2:70061103-70061125 GGCAAAGGACAGGCCGGGCACGG + Intergenic
932270790 2:70407646-70407668 AAACAAAGACAGGCCGGGCACGG + Intergenic
932760106 2:74433781-74433803 TGCCACAATGAGGCCGGGCGCGG - Intronic
932787584 2:74620989-74621011 TGCGCCAGAAAGGCCGGGCGCGG + Intronic
934566765 2:95345881-95345903 TGCCACGCACGGGCAGGGCAAGG - Intronic
934711707 2:96519677-96519699 AGACACTGGCAGGCCGGGCATGG + Intergenic
935192628 2:100791208-100791230 TGCCAGGCACAGGCAGGGCATGG + Intergenic
936279023 2:111122173-111122195 TGCCACAGCCAGGGCGGTGACGG + Intronic
938372498 2:130780880-130780902 TACCTAAGACTGGCCGGGCACGG + Intergenic
938872587 2:135496090-135496112 TTCCACAGACTGGCCAGGCGTGG + Intronic
939620386 2:144411977-144411999 TTCCCAAGATAGGCCGGGCACGG + Intronic
939755058 2:146099999-146100021 TGCCAAAGACAAGGTGGGCATGG + Intergenic
939867925 2:147495568-147495590 TGCCACAGCGAGGCCGGGCGTGG + Intergenic
941382999 2:164819059-164819081 TGACAGAAACAGGCCAGGCACGG - Intronic
941433422 2:165438483-165438505 AGGCACAGGCAGGCTGGGCATGG + Intergenic
941999005 2:171627643-171627665 TGCCAAAGGCAAGCCAGGCAGGG - Intergenic
942556238 2:177175206-177175228 TACCACACCCTGGCCGGGCATGG + Intergenic
942810095 2:179988826-179988848 TGCCACAGACAGGCCTATCTGGG - Intronic
943328364 2:186528605-186528627 TGCAGCTGGCAGGCCGGGCATGG + Intergenic
945253062 2:207780530-207780552 TGCAAGAGGCAGGCCAGGCATGG + Intergenic
945446109 2:209940521-209940543 AGCTTCAGACAGGCTGGGCAAGG + Intronic
945875320 2:215272184-215272206 TGCCACAGGAAGGCCTGGCCTGG + Intergenic
946256284 2:218444566-218444588 AGCTACAGGCCGGCCGGGCACGG - Intronic
947135661 2:226974525-226974547 AGCAACACCCAGGCCGGGCACGG - Intronic
947769011 2:232656094-232656116 GACCCCACACAGGCCGGGCACGG - Intronic
948015819 2:234689872-234689894 TCCCAAAAACAGGCCGGGCATGG - Intergenic
948435242 2:237948853-237948875 TACCACAGACTGGCCGGGGGTGG + Intergenic
948795506 2:240400315-240400337 AGCCACAGGCAGGGCTGGCAGGG + Intergenic
948852852 2:240716855-240716877 TGCTAGGGACAGGCAGGGCAGGG - Exonic
1168800339 20:640661-640683 GGCCACAGTGAGGCTGGGCAGGG - Intergenic
1169225232 20:3852282-3852304 TGCTACACATAGGCCGGGCACGG - Intronic
1169244651 20:4015782-4015804 TACGCCAGACAGGCCGGGCGAGG + Intergenic
1169298454 20:4420950-4420972 TGCCAAACAGAGGCCAGGCATGG - Intergenic
1169328217 20:4694208-4694230 TGACACATACTGGCTGGGCATGG + Intronic
1169634069 20:7667183-7667205 TGCAACAAATAGGCCAGGCAGGG - Intergenic
1170145425 20:13168471-13168493 TACTACATTCAGGCCGGGCACGG - Exonic
1171013237 20:21519883-21519905 TGCCAGAGATCTGCCGGGCACGG - Intergenic
1171389050 20:24789548-24789570 GGGCACAGCCAGGCAGGGCATGG + Intergenic
1171424892 20:25043073-25043095 TGCCAGGGACAGGGCAGGCAGGG + Intronic
1171977420 20:31604412-31604434 TGACACAGACCGGCCCGGGAAGG + Intergenic
1172152685 20:32801450-32801472 TGTCACAGACAGCCAGGGCAGGG + Intronic
1172347154 20:34210537-34210559 TGCCAAAGGCAAGCCAGGCATGG - Intronic
1173328126 20:42052140-42052162 TGGCACAGACAGACCAGGCCTGG + Intergenic
1173424615 20:42932028-42932050 TGCCACACACGGGCCTGGCTTGG + Intronic
1174484126 20:50850953-50850975 TCCTACAGGCAGCCCGGGCAGGG - Intronic
1174837028 20:53866182-53866204 AGCCACAGAAAGGACAGGCAAGG + Intergenic
1175820939 20:61908558-61908580 TGCCACAGGCAGGTCCTGCAAGG - Intronic
1176014592 20:62923544-62923566 AGCCGCAGACAAGCCGGCCAGGG + Intronic
1176248541 20:64109238-64109260 TGACACAGAGAGGCCAGGCCTGG + Intergenic
1176269199 20:64226835-64226857 TACAACAGCCAGGCCTGGCATGG + Intronic
1177326935 21:19602720-19602742 CACCACACGCAGGCCGGGCATGG + Intergenic
1178433582 21:32537421-32537443 TGCCACAAACTGGCCGGGCGCGG + Intergenic
1178462412 21:32815061-32815083 TTCCACAGACAGGCAGGGGTAGG - Intergenic
1178970815 21:37175295-37175317 TAGCATATACAGGCCGGGCACGG + Intronic
1179565321 21:42244107-42244129 AGCCAAAGATAGGCCGGGCGTGG - Intronic
1180218912 21:46345505-46345527 TCCCAGAAACAGGCCAGGCATGG - Intronic
1180412839 22:12632070-12632092 TACAAGAAACAGGCCGGGCACGG + Intergenic
1180559925 22:16608059-16608081 TGTAATAGAAAGGCCGGGCACGG + Intergenic
1180881597 22:19208012-19208034 TTCCACAGACAGGTCGGGGGTGG - Intronic
1181302212 22:21888865-21888887 TGACTAAGACAGGCCAGGCACGG - Intergenic
1181594965 22:23908236-23908258 TTCCCCAGACAGGCAAGGCAGGG + Intergenic
1182075732 22:27494272-27494294 GGCCACAGAGTGGCAGGGCAGGG + Intergenic
1182101787 22:27662817-27662839 GGCCCCAGCCAGGCCGGGGAAGG + Intergenic
1182271699 22:29157864-29157886 TGTCACAAACAGGCAGGTCAGGG + Intronic
1182509287 22:30807535-30807557 TGCCACAGCCGGGCCTGGAAGGG + Intronic
1182567248 22:31209442-31209464 TTTCATAGACAGGCCAGGCAAGG - Intergenic
1183461663 22:37954589-37954611 TACTACAAGCAGGCCGGGCACGG - Intronic
1184717798 22:46291662-46291684 TGCCACAGACAGGCCGGGCACGG + Intronic
1184754246 22:46507475-46507497 GGCCACACAGAGGCCGGGGAGGG - Intronic
1185096046 22:48806624-48806646 TGCCCCAGTCAGGCAGGGCCCGG - Intronic
1185272030 22:49934223-49934245 AGCCACAGACAGGCAGCGCCAGG - Intergenic
949198501 3:1342416-1342438 AGAAACAGACAGGCCAGGCAGGG - Intronic
950056993 3:10033118-10033140 TGGTACAGTCAGGCCGGGCGCGG + Intronic
950167374 3:10811663-10811685 AGCCAAAGCAAGGCCGGGCATGG + Intergenic
951579716 3:24149202-24149224 TGTCACAGACAGGGAGGGGAGGG + Intronic
952804849 3:37339150-37339172 AGCCCGACACAGGCCGGGCACGG - Intronic
952856790 3:37778326-37778348 TTTTAAAGACAGGCCGGGCACGG + Intronic
953556056 3:43947864-43947886 TGACACAGACAGCCCCGGGAGGG + Intergenic
954311630 3:49773318-49773340 AGCCACATACTGGCCGGGCGCGG + Intronic
954773582 3:52996777-52996799 AGCTAAACACAGGCCGGGCACGG + Intronic
956197717 3:66669902-66669924 TGACAAGTACAGGCCGGGCACGG - Intergenic
956644922 3:71445976-71445998 AGACACACATAGGCCGGGCACGG - Intronic
956945524 3:74218134-74218156 TGCCACAGGCAGACCGGCTAGGG + Intergenic
957767872 3:84649106-84649128 AGCCAAAGACAGGCTGGGTATGG + Intergenic
958669701 3:97187285-97187307 TGCCATATATAAGCCGGGCACGG + Intronic
958930686 3:100204593-100204615 GTCCAAAGACAGGCCGGGCATGG - Intergenic
960637392 3:119796784-119796806 TGCCATAGACAGATCTGGCAGGG - Intronic
960928001 3:122815377-122815399 TGACACAAACAGGCCAGGCATGG - Intronic
961175419 3:124831242-124831264 TCCCAGAGGCAGGCCAGGCATGG + Intronic
961715223 3:128853293-128853315 TGCCACAGTTCGGCCGGGCGCGG - Intergenic
962276776 3:134020502-134020524 TGCCACACACTGCCCTGGCAAGG - Intronic
962556994 3:136563728-136563750 ATCCAGAGAAAGGCCGGGCACGG + Intronic
963164167 3:142183887-142183909 TTCCTAAGGCAGGCCGGGCATGG - Intronic
963674241 3:148288307-148288329 TGGCACAGGCAGGGAGGGCATGG - Intergenic
964172528 3:153787886-153787908 AGCCACTGACAGGCTGGGCGCGG - Intergenic
964619482 3:158706876-158706898 TGCTGCAGATAGGCCGGGCATGG + Intronic
966176461 3:177143959-177143981 TGACATATTCAGGCCGGGCATGG + Intronic
966800867 3:183762759-183762781 TAGCACATAGAGGCCGGGCATGG + Intronic
967382318 3:188872777-188872799 TGCCACAGACTGGCAGGGCAGGG - Intronic
967860706 3:194149193-194149215 TGTCCCAGGGAGGCCGGGCACGG - Intergenic
968001722 3:195211101-195211123 GGGCAAAGGCAGGCCGGGCATGG + Intronic
968142822 3:196272980-196273002 TGCCAAGGACAAGCCAGGCACGG + Intronic
968238133 3:197050075-197050097 AACCAAAAACAGGCCGGGCACGG + Intronic
968618481 4:1592942-1592964 TGCCATAGGCTAGCCGGGCAGGG - Intergenic
968695359 4:2022730-2022752 TGCCGCTGACTGGCCGGGCGTGG - Intronic
969485247 4:7468622-7468644 TGCAACAGCAAGGCCTGGCATGG + Intronic
969722944 4:8903191-8903213 TAATAAAGACAGGCCGGGCACGG - Intergenic
969859783 4:10026751-10026773 ACCCAGACACAGGCCGGGCATGG + Intronic
971332460 4:25693666-25693688 TTACACATACAGGCCAGGCATGG + Intergenic
973808486 4:54547969-54547991 CGCCAGATACAGGCAGGGCAGGG + Intergenic
974069424 4:57110423-57110445 TCCCGCGGACAGGCCGGGCGGGG - Intergenic
975374334 4:73626045-73626067 TGCCAGGGACAGGAAGGGCAGGG - Intergenic
976180141 4:82391089-82391111 TGCCAAAGGCTGGCCGGGCGCGG - Intergenic
977625631 4:99186989-99187011 ATCCACAGCCAGGCCAGGCATGG - Intergenic
977869838 4:102078265-102078287 TGAAAGAGACAGGCCGGGCGCGG - Intergenic
978620938 4:110633884-110633906 TGCCACAGGCAAGCCGGGAGAGG + Intronic
978774687 4:112493759-112493781 AGCCAAATACAGGCCGGGCGCGG + Intergenic
980821672 4:138024405-138024427 TACCAAAAAAAGGCCGGGCACGG + Intergenic
981557153 4:146007840-146007862 TGCCATACACAGGCCGGGCGCGG - Intergenic
982253997 4:153434853-153434875 TGCCACAGCACGGCCGGGCACGG + Intergenic
984082286 4:175262216-175262238 TGCCAATGCTAGGCCGGGCACGG - Intergenic
984166165 4:176305245-176305267 TGATAGAAACAGGCCGGGCACGG - Intergenic
985021061 4:185691188-185691210 AGAAACAAACAGGCCGGGCACGG - Intronic
987354660 5:17052719-17052741 AGAAACAAACAGGCCGGGCACGG - Intergenic
990574039 5:57107600-57107622 TCTCTCAGTCAGGCCGGGCATGG - Intergenic
992397159 5:76378730-76378752 TGCCAAAGATCAGCCGGGCACGG + Intergenic
992702278 5:79352882-79352904 TACCACATAAAGGCCAGGCACGG + Intergenic
993689308 5:90979458-90979480 TGACACAAATAGGCTGGGCACGG - Intronic
993716477 5:91280018-91280040 TTCCTGAGACAGGCCGGGCGCGG - Intergenic
994749954 5:103725426-103725448 AGCAAAAGACAGGCTGGGCACGG - Intergenic
997125859 5:131226108-131226130 TGCCAAAGACAGGATGGGTATGG + Intergenic
997156766 5:131569748-131569770 AGTCACAGACTGGCTGGGCACGG + Intronic
997206665 5:132054183-132054205 TGACACAGGCCGGCAGGGCAGGG + Intergenic
998828727 5:146134656-146134678 TACCAAATACAGGCCAGGCATGG + Intronic
999215273 5:149928524-149928546 TAGCACATACAGGCCGGGCGCGG - Intronic
1000681750 5:164193819-164193841 TACTATAGAAAGGCCGGGCATGG - Intergenic
1000844994 5:166268855-166268877 AGTAACAGACAGGCCGGGCGCGG + Intergenic
1001135595 5:169100059-169100081 TGCCAGAGAGAGGCTTGGCAGGG - Intronic
1001403247 5:171458829-171458851 AGCCACAGACATGCGGGACAGGG - Intergenic
1001483014 5:172101584-172101606 GGGCACTGACATGCCGGGCAGGG + Intronic
1002112128 5:176924025-176924047 TACCACAATCTGGCCGGGCACGG + Intronic
1002129561 5:177071897-177071919 TGGGAGAGACAGGCCGGGGACGG - Intronic
1002719195 5:181247394-181247416 TCCCAAGGAGAGGCCGGGCACGG + Intronic
1002898098 6:1390656-1390678 TGCCACAGCCAGGGCGGCTACGG + Exonic
1004059319 6:12176520-12176542 TACCCAAGACTGGCCGGGCACGG - Intergenic
1004931979 6:20471290-20471312 TTGCACATATAGGCCGGGCACGG + Intronic
1005527604 6:26666480-26666502 TTCCACAGACTGGTGGGGCAAGG + Intergenic
1006594451 6:35182536-35182558 AGTCACAGACAGGCCCGGCTTGG - Intergenic
1006621240 6:35365779-35365801 TGGCACATCCAGGCCGTGCATGG - Intronic
1006641279 6:35491015-35491037 TGAGACAGACAGGAGGGGCAGGG + Intronic
1006857794 6:37147701-37147723 AGGCACACACAGGCTGGGCACGG + Intergenic
1006969945 6:38032121-38032143 TGCAGCATACAGGCCAGGCATGG - Intronic
1007726445 6:43919016-43919038 TGCCAAAGATGGGCTGGGCATGG + Intergenic
1008277128 6:49554670-49554692 TAACTCAAACAGGCCGGGCATGG - Intronic
1010970024 6:82253296-82253318 TGGCACACACAGGGAGGGCATGG + Intergenic
1011347632 6:86389348-86389370 TTCCACAGACATCCAGGGCAGGG - Intergenic
1013217886 6:108046633-108046655 AACCAGAGACAGGCCGGGCGCGG - Intronic
1013652763 6:112212512-112212534 TGACAGAAACTGGCCGGGCACGG - Intronic
1014754945 6:125292380-125292402 TGCCACAGAGATGCCTGGCATGG - Intronic
1015275990 6:131383943-131383965 TGCCACAGCCAGGCCCCACAGGG + Intergenic
1017016620 6:150106274-150106296 TGTCAAATCCAGGCCGGGCACGG + Intergenic
1017426006 6:154322224-154322246 GGCCACCTACAGGCTGGGCAAGG + Intronic
1018696462 6:166395358-166395380 TTCCACACACAGGACTGGCAGGG - Intergenic
1018982341 6:168611207-168611229 AGCCACAGCCAGGCCCGACACGG - Intronic
1018982363 6:168611280-168611302 AGCCACAGCCAGGCCCGACACGG - Intronic
1018982472 6:168611645-168611667 AGCCACAGCCAGGCCCGACACGG - Intronic
1018982494 6:168611718-168611740 AGCCACAGCCAGGCCCGACACGG - Intronic
1019320437 7:412918-412940 AACCACAGCCAGGCCGGGCGCGG + Intergenic
1019414440 7:920817-920839 ACCCACACACAGGCCCGGCACGG + Intronic
1019686013 7:2382661-2382683 CGCCAAAGCCAGGCCGGGCGTGG - Intergenic
1020092674 7:5350178-5350200 ATCCACGGACAGCCCGGGCAGGG + Intronic
1021131688 7:16920062-16920084 TGTTAAAAACAGGCCGGGCACGG + Intergenic
1021788357 7:24175136-24175158 AGCAAGACACAGGCCGGGCATGG + Intergenic
1021972336 7:25977783-25977805 TACCATAAACAGGCCGGGCATGG - Intergenic
1023254813 7:38302386-38302408 TGCCACAGCCAGGGCAGCCACGG + Intergenic
1023793078 7:43769318-43769340 TATCTCAGAAAGGCCGGGCACGG - Intronic
1023818143 7:43965781-43965803 GGCTACAGGCAGGCAGGGCAGGG - Intergenic
1024321933 7:48079388-48079410 TGTCACAGTGAGGCCGGGCACGG - Intergenic
1024323420 7:48090513-48090535 AGCCAAAGAAAGGCCAGGCAGGG - Intronic
1025746221 7:64245314-64245336 TCCCTGAAACAGGCCGGGCATGG - Intronic
1025909403 7:65815880-65815902 AGTCACAGACAGCCCAGGCATGG - Intergenic
1025999830 7:66552101-66552123 AGGCAGAGACAGGCCGGGCGCGG + Intergenic
1026043966 7:66892390-66892412 AGACACAGACAGCCCAGGCATGG - Intergenic
1026650488 7:72212060-72212082 TACCAGAGAGGGGCCGGGCACGG + Intronic
1027140734 7:75655286-75655308 AGCCAGACACAGGCCGGGCACGG + Intronic
1027980561 7:85214784-85214806 AGCCAAAAACAGGCCGGGCACGG - Intergenic
1028289717 7:89049719-89049741 TCCCACAGTCTGGCCAGGCATGG + Intronic
1029093184 7:98064564-98064586 TGCAACAGAGAGGCTGGGCATGG + Intergenic
1029196625 7:98810084-98810106 TGCCACAGAGAGCCTGGGCTGGG + Intergenic
1029274358 7:99395438-99395460 TTCCACAACCAGGCCGGGCATGG - Exonic
1029349904 7:100005812-100005834 AGACAGAGACAGGCCGGGCCTGG - Intergenic
1029418008 7:100455811-100455833 AGCAACAGCAAGGCCGGGCACGG - Intergenic
1029556708 7:101275356-101275378 AGCCAGAAAGAGGCCGGGCACGG + Intergenic
1029742769 7:102500613-102500635 GGCTACAGGCAGGCAGGGCAGGG - Intronic
1029760759 7:102599774-102599796 GGCTACAGGCAGGCAGGGCAGGG - Intronic
1031040465 7:116833737-116833759 TACCACAAACAGCCCAGGCAGGG + Intronic
1032030216 7:128476891-128476913 GGCCAGCGACAGGCCGGGCGAGG - Intronic
1032226212 7:130033740-130033762 TGCTACAGACAGGCCAGGCGTGG - Intronic
1033934692 7:146569307-146569329 AACCACAGAGAGGCCGGGCGCGG - Intronic
1034059445 7:148072996-148073018 TACAAAAGACAGGCCAGGCACGG - Intronic
1034495749 7:151421106-151421128 AGTCACAGAAAGGCTGGGCATGG + Intergenic
1034545209 7:151784824-151784846 TTCCAGAGACAGGACTGGCAGGG - Intronic
1034632458 7:152541205-152541227 TCTCTCAAACAGGCCGGGCACGG + Intergenic
1034925990 7:155122378-155122400 TTGCACATACAGGCCAGGCACGG + Intergenic
1035225969 7:157432384-157432406 TGAGACAGGCAGGCCGGGCCAGG - Intergenic
1035672764 8:1432861-1432883 TGACACAGACTGGCCGAGCTGGG + Intergenic
1037162513 8:15790471-15790493 TGCCATGGTGAGGCCGGGCATGG - Intergenic
1037240790 8:16775458-16775480 AACCAGAAACAGGCCGGGCACGG + Intergenic
1037722811 8:21459309-21459331 AACCCCACACAGGCCGGGCACGG + Intergenic
1038591109 8:28838806-28838828 TTACACAGACAGACCGGGCTTGG - Intronic
1038696055 8:29807338-29807360 TGTCACAGGCAGGGCGGGGAAGG - Intergenic
1038963179 8:32544811-32544833 AGTGATAGACAGGCCGGGCATGG - Intronic
1039431284 8:37527102-37527124 TGCCACAGAAAGGCAAAGCAGGG + Intergenic
1039873367 8:41566097-41566119 TACGACAAACAGGCTGGGCACGG + Intergenic
1040687285 8:49890218-49890240 AGGCAAAGACAGGCTGGGCATGG + Intergenic
1040789608 8:51210955-51210977 ATTCACAGACAGTCCGGGCACGG + Intergenic
1041369732 8:57145956-57145978 AGACACAAACAGGCCGGGCATGG - Intergenic
1041899085 8:62960987-62961009 TGGGACAACCAGGCCGGGCATGG + Intronic
1041937601 8:63351229-63351251 AGCCTCAGTCAGGCCGGGCGCGG + Intergenic
1043846808 8:85173070-85173092 TGCAACATACAGGCCAGGCACGG - Intergenic
1044030776 8:87233758-87233780 TGCCACAGCCAAACTGGGCATGG - Intronic
1044362023 8:91296895-91296917 AGCCTCATACAGGCCAGGCAAGG - Intronic
1045040275 8:98217101-98217123 TGCAGCAGACAGGCTGGGAAAGG + Intronic
1045303560 8:100936523-100936545 ATCACCAGACAGGCCGGGCACGG + Intronic
1045636815 8:104200616-104200638 TGCCAGTGAGAGGCCGGGCGTGG + Intronic
1047136560 8:122085483-122085505 TAGCACATACAGGCCGGGCATGG + Intergenic
1047769817 8:128021581-128021603 TGGCCCAGACAGGCCGGGCGCGG - Intergenic
1048494035 8:134920612-134920634 TGACACAAACAGGCCTGGGATGG - Intergenic
1048645803 8:136417840-136417862 AGGGACACACAGGCCGGGCACGG - Intergenic
1048999411 8:139815232-139815254 TGCCACAGGGAAGGCGGGCAGGG - Intronic
1049913591 9:294867-294889 AGCCAGACAAAGGCCGGGCATGG + Intronic
1050152126 9:2627572-2627594 TGCAACAAAGAGGCCGGGCGCGG + Intronic
1050523084 9:6521884-6521906 TGTCACTGCGAGGCCGGGCATGG - Intergenic
1050746844 9:8885785-8885807 AGACAGAGGCAGGCCGGGCACGG - Intronic
1051088403 9:13378822-13378844 TGCCACACCCAGGCTGGGCATGG + Intergenic
1053016997 9:34667562-34667584 TGCCAGAGACAGCCCTGGCCTGG - Intergenic
1053097172 9:35338778-35338800 TGCCAGAGACAGGCTGGGTCAGG - Intronic
1053506536 9:38648361-38648383 TGCAACAGTCAGGCCAGGCATGG + Intergenic
1055092083 9:72373360-72373382 TGCTTCACATAGGCCGGGCATGG + Intergenic
1056233523 9:84570059-84570081 ACCCACAGAGAGGCTGGGCACGG + Intergenic
1056568500 9:87796003-87796025 TTCCACAGCCAGGCTTGGCATGG + Intergenic
1056885050 9:90433742-90433764 GGCCACAGACAGGCCCGGGGTGG - Intergenic
1057132395 9:92663341-92663363 TGCCCCACACAGCCTGGGCATGG + Intronic
1057205077 9:93166941-93166963 TCCCACAGCCGGGCTGGGCAAGG + Intergenic
1057347495 9:94263677-94263699 AGGCACAGACTGGCTGGGCACGG - Intronic
1057805517 9:98217069-98217091 AGGCACAGACATGCCGGACAGGG + Intronic
1057956028 9:99408714-99408736 TGCCCTATGCAGGCCGGGCATGG + Intergenic
1058021061 9:100089287-100089309 TGCCAAAGAGAGGCCAGGCGTGG + Intronic
1058434982 9:104954384-104954406 TAATACAGATAGGCCGGGCATGG + Intergenic
1059004895 9:110391560-110391582 TGACACATCAAGGCCGGGCATGG - Intronic
1059115217 9:111595143-111595165 TACCAAAAACAGGCTGGGCATGG - Intronic
1059201267 9:112419292-112419314 TGTCAAGGACAGGCCGGGCGTGG - Intronic
1059204568 9:112452454-112452476 AGGAACAGAGAGGCCGGGCACGG + Intronic
1059669280 9:116477728-116477750 AGACAGAGACAGGCCAGGCACGG + Intronic
1060594413 9:124839835-124839857 TGCCCCAGACAGGCCGAGGAGGG + Intergenic
1060843730 9:126817399-126817421 TGTCACAGTCCAGCCGGGCATGG - Intronic
1060847055 9:126845805-126845827 TGTCCCAGTTAGGCCGGGCACGG - Intergenic
1061097775 9:128469702-128469724 TAACAAAAACAGGCCGGGCATGG + Intronic
1061495026 9:130968663-130968685 AGCCAGACACAGGCCAGGCACGG + Intergenic
1061953630 9:133950153-133950175 TGGCACAGGCAGGCAGGGCCAGG + Intronic
1185455424 X:307972-307994 TCCCAACGACAGGCTGGGCATGG + Intronic
1185505612 X:630716-630738 TGCACCAGACAGGCAGCGCATGG + Exonic
1186071220 X:5822735-5822757 AGCCAAAGGCAGGCCGGGCGTGG - Intergenic
1186530230 X:10287638-10287660 GGCCACAGACATGCAGGGAAAGG + Intergenic
1187665723 X:21607511-21607533 TTCCATGGTCAGGCCGGGCATGG + Intronic
1187908262 X:24087259-24087281 TGGCACAGCCTGGCTGGGCATGG - Intergenic
1187926254 X:24252930-24252952 GTCAACAAACAGGCCGGGCACGG - Intergenic
1187996948 X:24936819-24936841 TAACACAACCAGGCCGGGCACGG - Intronic
1188020305 X:25149802-25149824 TGCCAAGAACAGGCCGGGCGCGG - Intergenic
1188459073 X:30401900-30401922 AGTCACATACTGGCCGGGCATGG - Intergenic
1189446688 X:41086384-41086406 GGCCCCAGACAGGACGGGAAGGG - Intronic
1189982522 X:46525310-46525332 TGGCAAAAAGAGGCCGGGCATGG + Intronic
1190656424 X:52617056-52617078 TTCCAGAGATAGGCCAGGCACGG + Intergenic
1190660641 X:52651582-52651604 AACTACAAACAGGCCGGGCATGG + Intronic
1190762927 X:53451464-53451486 TGCCCCAGATAGGCTGGGCGCGG - Intergenic
1190783807 X:53624273-53624295 AAACACAGAGAGGCCGGGCATGG - Intronic
1190950893 X:55141486-55141508 TACCCAAGACTGGCCGGGCACGG - Intronic
1191844486 X:65536416-65536438 AACCATAGGCAGGCCGGGCACGG - Intergenic
1192191629 X:68994638-68994660 TCCCACAGTCAGGCCAGTCAAGG + Intergenic
1192295798 X:69846583-69846605 TAAAACAAACAGGCCGGGCACGG - Intronic
1192474681 X:71430088-71430110 TGGCACATCTAGGCCGGGCACGG + Intronic
1193559929 X:83006231-83006253 TTGCACAAAAAGGCCGGGCACGG + Intergenic
1195230859 X:102845445-102845467 TTCCACATAAAGGCCAGGCATGG + Intergenic
1196114658 X:111985839-111985861 TGCCAAAGACAAGGTGGGCATGG - Intronic
1199032440 X:143016108-143016130 AGCAAGAGACAGGCCAGGCACGG + Intergenic
1199835144 X:151582435-151582457 ATCCAAAGACAGGCCAGGCATGG - Intronic
1200921575 Y:8618073-8618095 TGCCACAGGCAGAGCCGGCATGG - Intergenic