ID: 1184722950

View in Genome Browser
Species Human (GRCh38)
Location 22:46326028-46326050
Sequence AGAGCCGCAGCCTGTCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184722950_1184722953 -10 Left 1184722950 22:46326028-46326050 CCCACCAGACAGGCTGCGGCTCT 0: 1
1: 0
2: 0
3: 13
4: 135
Right 1184722953 22:46326041-46326063 CTGCGGCTCTGACTTCCTTATGG 0: 1
1: 0
2: 3
3: 13
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184722950 Original CRISPR AGAGCCGCAGCCTGTCTGGT GGG (reversed) Intronic
900289453 1:1917730-1917752 AAAGCAGCAGCCTGCCTAGTGGG + Exonic
900590695 1:3458234-3458256 GGAGCCGCAGGCTGGCTGGCTGG - Intronic
900788455 1:4664467-4664489 ACAGCAGCAGCCTGTCCGGGTGG + Intronic
903742644 1:25567121-25567143 AGAGCTGCAGCCAGTCAGGCAGG + Exonic
904809377 1:33153274-33153296 AGAGCAGCAGCCTGGTTGGCTGG - Intronic
905280588 1:36846579-36846601 ACAGCCCCAGCCTGTCTGGGAGG - Intronic
908794080 1:67814052-67814074 AGAGCAGGAGCCTGACTGGCAGG - Intronic
914511209 1:148334032-148334054 AGAACCGCAGTCTGACTTGTCGG - Intergenic
915117695 1:153610851-153610873 AGACCCGGGGCCTGGCTGGTGGG - Intronic
915125803 1:153663230-153663252 AGGGCCAAAGGCTGTCTGGTGGG + Exonic
917080768 1:171254954-171254976 AGAGCAGCAATCAGTCTGGTAGG - Intronic
920366363 1:205450191-205450213 TGAGCCTCTGGCTGTCTGGTCGG + Intronic
920381354 1:205536324-205536346 AGAGCAGCAGCAGGTGTGGTGGG + Intergenic
920965060 1:210694525-210694547 AGAGCCACAGCCTGTCCCCTAGG + Intronic
923017263 1:230136539-230136561 AGAGCCACAGCCTGCCCTGTCGG + Intronic
1063352706 10:5371555-5371577 ACAGCCTAAGGCTGTCTGGTTGG + Intronic
1067702758 10:48585573-48585595 TGAGCAGCAGCCTGTCTGGAGGG - Intronic
1069873818 10:71549377-71549399 AGAGTCCCAGCCTGTGGGGTTGG + Intronic
1072189522 10:93068625-93068647 AGAGCCGCAGCCCGTCCACTGGG - Exonic
1072283713 10:93893843-93893865 AGACCCGCTGCCTCCCTGGTCGG - Intergenic
1075298054 10:121295452-121295474 AGAGCCGAAGCCTGTCAGCTGGG - Intergenic
1075721419 10:124589798-124589820 GGTGCCGCAGCCCCTCTGGTTGG + Intronic
1075833212 10:125428629-125428651 AGAGCTGGAACCTGTCTGCTGGG - Intergenic
1077321145 11:1942614-1942636 AGGGCCGCAGGCTGTTTGGGGGG + Intergenic
1077490777 11:2859966-2859988 AGGGCCGCTGCCCGTCTGGCAGG - Intergenic
1079127806 11:17731221-17731243 AGAGCCTCAGCCCTCCTGGTGGG - Intergenic
1079184822 11:18227421-18227443 AGATCCTCAGCCATTCTGGTGGG + Intronic
1080776687 11:35393289-35393311 AGAGCAGCAGCCTCTCTGTAAGG + Intronic
1083897257 11:65626095-65626117 CGGGCTGCAGCCTGGCTGGTGGG + Intronic
1084580931 11:70022849-70022871 ATAGCCCCAGACTATCTGGTGGG + Intergenic
1087021817 11:93610803-93610825 AGAGCCTCAGACTGACTGTTTGG - Intergenic
1093256689 12:16876401-16876423 AGAGCCACAGCCTTCCAGGTGGG - Intergenic
1097024641 12:56045765-56045787 AGAGTCACAGCCTGTCACGTGGG + Intergenic
1098730658 12:74033744-74033766 TGAGCAGCGTCCTGTCTGGTTGG + Intergenic
1103339270 12:120212624-120212646 AGAGCTGCACCCTGTGTGATGGG + Intronic
1103634020 12:122287519-122287541 AGAACCACAGCCTGTCCAGTGGG - Intronic
1105278409 13:18949333-18949355 AGAGCTGCAGCTTGTGTGGCAGG - Intergenic
1110656714 13:78008485-78008507 AGAGTCCCAGCCTGTGTGGTGGG - Intergenic
1112612396 13:100968557-100968579 AGAGCCACTGTCAGTCTGGTGGG + Intergenic
1113444067 13:110352196-110352218 AGAGCCTCAGGCTGTCAGGCAGG + Intronic
1113880467 13:113622700-113622722 AGAGCCGCAGCCTCTGTGGAAGG + Intronic
1120392198 14:83923745-83923767 AGAGAGGCAGCCTGCCTGGTTGG + Intergenic
1122080088 14:99261074-99261096 AGCGCCACAGCCTGGGTGGTGGG - Intronic
1122318952 14:100841754-100841776 AGACCAGCAGCCTGCCTGTTTGG - Intergenic
1122650557 14:103224044-103224066 GGAGCCGCAGCCTGGAGGGTGGG - Intergenic
1123759289 15:23420434-23420456 ACAGCCTCAGCCTGGCTGGCAGG + Intergenic
1128509307 15:68303724-68303746 GGAGCAGCATCCTGGCTGGTGGG - Intronic
1128559310 15:68654287-68654309 AGAGATGCAGCCTGGCTAGTGGG + Intronic
1129525687 15:76212664-76212686 AGAGCCTGAGCATGTCTGCTGGG - Intronic
1129869607 15:78932071-78932093 AAAGGCGGAGCCTGCCTGGTGGG - Intronic
1130938614 15:88489956-88489978 GGAGGAGCAGCCTGTATGGTAGG - Intergenic
1131052732 15:89359225-89359247 AGAGGCGCAGGCTGGATGGTGGG - Intergenic
1132342137 15:101085495-101085517 AGAGCCCCAGCCTGGCCAGTGGG + Intergenic
1132501080 16:284946-284968 AGAGCCGCGGCCGGTCTGTGAGG - Exonic
1134457061 16:14402424-14402446 ACAGCCTCAGCCTGGCTGGCAGG - Intergenic
1135989451 16:27208845-27208867 AGAGCCCCAGCCTGCCAGGGTGG - Intronic
1140782896 16:78312815-78312837 AGAGCCTAGGCCTGTCTGGTTGG - Intronic
1142033098 16:87848083-87848105 AAAGCCGCAGCCTGCCAGGGCGG - Intronic
1143107226 17:4535876-4535898 AGAGAAGCAGCCAGGCTGGTGGG + Intronic
1148207807 17:45790682-45790704 CAAGCCCCAGCCAGTCTGGTTGG + Intronic
1150270212 17:63859326-63859348 GGAGCTGCAGCCTGCCTGGGTGG + Intergenic
1151491697 17:74435496-74435518 AAAGCAGCAGCCTGGCTGCTGGG + Intronic
1151890684 17:76949035-76949057 AGAACCGGAGCCTGCCTGGGAGG - Exonic
1152217597 17:79042789-79042811 AGAGCCTCAGCCAGTCAGGCTGG - Intronic
1152471679 17:80493001-80493023 AGAACCGCAGCCTTTCCGGAGGG - Intergenic
1157320663 18:46631529-46631551 AAAGCCTCAGCCTCTCTGGACGG - Intronic
1158934731 18:62354279-62354301 AGAGCAGCAGCCCGCCTGGCAGG - Intronic
1160400503 18:78607499-78607521 AGAGGCTGAGCCTGTCTGGCTGG + Intergenic
1163796991 19:19343477-19343499 AGAGCCTCAGGCAGTCGGGTAGG - Intronic
1166076689 19:40417719-40417741 AGTCCCACAGCCTGTCTGCTGGG + Intergenic
1167012629 19:46818957-46818979 AGGCCCGCAGCCAGTCTGATTGG + Intergenic
1167449743 19:49560172-49560194 GGAGCCGCTGCCTGTGTGCTGGG + Intronic
1167786847 19:51644327-51644349 AGATCCGCAACCTGTCAGGGAGG + Intronic
925187084 2:1855471-1855493 AGAGCCGCAGCCTCCCTGAAAGG - Intronic
925752833 2:7105179-7105201 AGAGGAGCTGCCTGTGTGGTGGG + Intergenic
925852342 2:8094694-8094716 AGAGCCGCAGCGTGTGCGGACGG + Intergenic
927843971 2:26461957-26461979 AGACCCGCAGCCAGGCTGGTGGG + Intronic
928105876 2:28470311-28470333 TGAGGAGCAGCCTGGCTGGTGGG + Intronic
931397739 2:61902908-61902930 ATAGGTGCAGCCTTTCTGGTGGG + Intronic
932756163 2:74411192-74411214 AGAGCTGCAGATTGTCTGGCTGG + Intergenic
934657088 2:96122058-96122080 TGAGCCCCAGCCTGGGTGGTGGG - Intergenic
936252183 2:110875490-110875512 ACAGCCTGAGCCTGTCTGCTGGG - Intronic
938972989 2:136449179-136449201 AGAGCCGCAGCCAGCCTGGGGGG - Intergenic
941305576 2:163861561-163861583 ATGGCAGCAGCCTGTTTGGTGGG - Intergenic
945955600 2:216083012-216083034 AGAACTGCAGCCTCGCTGGTGGG - Intronic
946284749 2:218694525-218694547 AGTGCAGCAGCCTGTCTATTGGG + Exonic
946367022 2:219254527-219254549 AGCCCCGCAGCCTGTCTGCCGGG + Intronic
947722580 2:232378793-232378815 AGGGCCCCAGCATGTCTGGAGGG - Exonic
949011156 2:241679329-241679351 AGAGCCGCAGGCTCTGTGGGAGG - Intronic
1169128455 20:3148524-3148546 AGAGCAGCATCCTGTCTTGCTGG - Exonic
1170626098 20:18031171-18031193 AGATCCGCAGCCTGGCTCTTCGG - Intronic
1171006543 20:21471445-21471467 AGCACAGAAGCCTGTCTGGTTGG + Intergenic
1171416394 20:24983898-24983920 AGATCCACAGCCTCTCAGGTAGG - Exonic
1172600568 20:36179911-36179933 GGAGCCCCAGCCTGGCTGGGAGG + Intronic
1174042972 20:47713023-47713045 AGAGCCAGACCCTGTCTGGGGGG + Intronic
1178708108 21:34890411-34890433 AGAGTCGCAGCCGGCCAGGTGGG + Intronic
1181480211 22:23194036-23194058 AGAGCCGCCGTCTGACTGGTTGG + Intronic
1183785764 22:40028283-40028305 GGAGCAGCAGCCTGTGTGGCAGG + Intronic
1184277389 22:43417814-43417836 ATAGCCCCAGCCTCTCTGATGGG - Intronic
1184722950 22:46326028-46326050 AGAGCCGCAGCCTGTCTGGTGGG - Intronic
1184733392 22:46383540-46383562 AGAGCAAAAACCTGTCTGGTTGG - Intronic
954704702 3:52473238-52473260 AGAGCCTCAGCCTGCTTGGCAGG - Intronic
957679742 3:83418373-83418395 AAAGCAGCAGCCTGTAAGGTTGG - Intergenic
960986984 3:123287129-123287151 AGAGACACAGCCAGTCTGATAGG - Intronic
962942048 3:140133965-140133987 ATAGCCACAGCCTGTCTTGTGGG + Intronic
964771048 3:160225150-160225172 AGAGCCCCCGCCCGTCTGGCGGG + Intergenic
966553296 3:181229873-181229895 ACAGCGGCAGCCTGCCTGTTGGG + Intergenic
969967084 4:11008053-11008075 AGAGCAGCAGCCTGTGAGGCTGG + Intergenic
975802805 4:78079975-78079997 AGAGCCGCCATCTGCCTGGTTGG + Intronic
980988397 4:139717680-139717702 AGAGTCGGAGCCTGTGGGGTTGG - Exonic
985651346 5:1109171-1109193 AGTGCCCCGGCCTGTCTGGAAGG - Intronic
990909938 5:60843517-60843539 CGAGCCGCATCCTGTCTTGGTGG - Intronic
995036855 5:107544015-107544037 AGAGAAGCAGCTTGTCAGGTGGG + Intronic
997062992 5:130529292-130529314 AGAGCCTCAACCTGGCTGGCTGG - Intergenic
999875898 5:155805409-155805431 AGAGAGGCAGCATTTCTGGTAGG + Intergenic
1000191859 5:158918770-158918792 AGAGCAGCATCCTGTGTGCTGGG + Intronic
1007664726 6:43507472-43507494 GGAGCTGCTGCCTCTCTGGTGGG + Exonic
1007808857 6:44472414-44472436 AGAGCTGGAGGCTTTCTGGTGGG + Intergenic
1013851952 6:114526935-114526957 AGAGCAGCTGCCTCTCTGGTGGG - Intergenic
1017182408 6:151565488-151565510 AGAGAAGCAGCCTGCTTGGTTGG - Intronic
1017280599 6:152620216-152620238 GAAGCTGCAGCCTGTGTGGTAGG - Intronic
1019630512 7:2046423-2046445 CCAGCCGGAGCCTGTCTGGAGGG - Intronic
1020847970 7:13311331-13311353 AGACCAGAAGCCTGACTGGTAGG - Intergenic
1029658795 7:101945225-101945247 AGAGCCGGAGCCTGCCTGGGTGG - Intronic
1033600438 7:142885213-142885235 AGAGCCTCAGCCTGTAGGGCTGG - Intronic
1035024025 7:155814991-155815013 AGAGCAGCAGCTTCTCTGGGGGG - Intergenic
1035087069 7:156269556-156269578 AGAGCCGTAGCTTGTGTGGAGGG + Intergenic
1035446519 7:158946918-158946940 AGCGTCACAGCCGGTCTGGTGGG - Intronic
1035548561 8:502460-502482 AGATCAGCAGCCCCTCTGGTGGG - Intronic
1038271273 8:26078130-26078152 TTAGCCCCAGCCTGTCTGTTGGG + Intergenic
1042953891 8:74227959-74227981 AGATGCTCAGCCTGACTGGTAGG - Intergenic
1044740499 8:95321571-95321593 AGAGGAGCATCCTGTTTGGTAGG - Intergenic
1044867887 8:96590298-96590320 AGAGCTGCAGCCTGGCTGTAGGG - Intronic
1048044357 8:130759271-130759293 TGAGACGCAGCATGTGTGGTGGG + Intergenic
1048276349 8:133068859-133068881 AGAGCCACAGGCTGACTGGGTGG - Intronic
1053623014 9:39840028-39840050 AGAGACTAAGCCTGTCTGGAGGG + Intergenic
1053881859 9:42603199-42603221 AGAGACTAAGCCTGTCTGGAGGG - Intergenic
1054220883 9:62410664-62410686 AGAGACTAAGCCTGTCTGGAGGG - Intergenic
1054229831 9:62498508-62498530 AGAGACTAAGCCTGTCTGGAGGG + Intergenic
1056963122 9:91143906-91143928 AGAGTCTCAGCCTGCCTGGCTGG - Intergenic
1060435031 9:123585964-123585986 ATAGCCACAGCCAGTCTGGAAGG + Intronic
1060965861 9:127712062-127712084 CAAGCCTCAGCCTGTCTGGCAGG - Intronic
1061067098 9:128285346-128285368 ATAGCAGCAGCCTCTCAGGTAGG + Intronic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1185748629 X:2592540-2592562 AGAGCCACTGCCTCTCAGGTAGG + Intergenic
1186390699 X:9155821-9155843 AGAGCCTCTGACTCTCTGGTTGG + Intronic
1187298545 X:18026311-18026333 AGAGCCGCACCCTCTCGGGGAGG + Intergenic
1191913062 X:66172454-66172476 AGTGGCCCAGCCTGCCTGGTTGG + Exonic
1194624958 X:96216293-96216315 AGATCCGCTGCCAGTCTGATGGG - Intergenic