ID: 1184723710

View in Genome Browser
Species Human (GRCh38)
Location 22:46331043-46331065
Sequence CTTCTCAAGGGGTGTGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 235}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184723710_1184723723 26 Left 1184723710 22:46331043-46331065 CCTGAGACACACCCCTTGAGAAG 0: 1
1: 0
2: 1
3: 14
4: 235
Right 1184723723 22:46331092-46331114 GAGTGGAAAGAGGATGGGCGAGG 0: 1
1: 1
2: 5
3: 58
4: 676
1184723710_1184723720 16 Left 1184723710 22:46331043-46331065 CCTGAGACACACCCCTTGAGAAG 0: 1
1: 0
2: 1
3: 14
4: 235
Right 1184723720 22:46331082-46331104 ACGAGGGTATGAGTGGAAAGAGG 0: 1
1: 1
2: 0
3: 10
4: 178
1184723710_1184723724 29 Left 1184723710 22:46331043-46331065 CCTGAGACACACCCCTTGAGAAG 0: 1
1: 0
2: 1
3: 14
4: 235
Right 1184723724 22:46331095-46331117 TGGAAAGAGGATGGGCGAGGAGG 0: 1
1: 0
2: 9
3: 117
4: 1166
1184723710_1184723718 0 Left 1184723710 22:46331043-46331065 CCTGAGACACACCCCTTGAGAAG 0: 1
1: 0
2: 1
3: 14
4: 235
Right 1184723718 22:46331066-46331088 AAGCTGCTCTGGGGAGACGAGGG 0: 1
1: 0
2: 2
3: 21
4: 194
1184723710_1184723722 21 Left 1184723710 22:46331043-46331065 CCTGAGACACACCCCTTGAGAAG 0: 1
1: 0
2: 1
3: 14
4: 235
Right 1184723722 22:46331087-46331109 GGTATGAGTGGAAAGAGGATGGG 0: 1
1: 0
2: 3
3: 30
4: 319
1184723710_1184723721 20 Left 1184723710 22:46331043-46331065 CCTGAGACACACCCCTTGAGAAG 0: 1
1: 0
2: 1
3: 14
4: 235
Right 1184723721 22:46331086-46331108 GGGTATGAGTGGAAAGAGGATGG 0: 1
1: 0
2: 9
3: 58
4: 632
1184723710_1184723717 -1 Left 1184723710 22:46331043-46331065 CCTGAGACACACCCCTTGAGAAG 0: 1
1: 0
2: 1
3: 14
4: 235
Right 1184723717 22:46331065-46331087 GAAGCTGCTCTGGGGAGACGAGG 0: 1
1: 0
2: 1
3: 24
4: 283
1184723710_1184723719 9 Left 1184723710 22:46331043-46331065 CCTGAGACACACCCCTTGAGAAG 0: 1
1: 0
2: 1
3: 14
4: 235
Right 1184723719 22:46331075-46331097 TGGGGAGACGAGGGTATGAGTGG 0: 1
1: 0
2: 1
3: 34
4: 322
1184723710_1184723715 -10 Left 1184723710 22:46331043-46331065 CCTGAGACACACCCCTTGAGAAG 0: 1
1: 0
2: 1
3: 14
4: 235
Right 1184723715 22:46331056-46331078 CCTTGAGAAGAAGCTGCTCTGGG 0: 1
1: 0
2: 2
3: 20
4: 284
1184723710_1184723716 -9 Left 1184723710 22:46331043-46331065 CCTGAGACACACCCCTTGAGAAG 0: 1
1: 0
2: 1
3: 14
4: 235
Right 1184723716 22:46331057-46331079 CTTGAGAAGAAGCTGCTCTGGGG 0: 1
1: 1
2: 2
3: 27
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184723710 Original CRISPR CTTCTCAAGGGGTGTGTCTC AGG (reversed) Intronic