ID: 1184724051

View in Genome Browser
Species Human (GRCh38)
Location 22:46332728-46332750
Sequence GGTGATACACAGGGGCCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184724041_1184724051 7 Left 1184724041 22:46332698-46332720 CCTGGCCATAACTAGCCTGTAGT 0: 1
1: 0
2: 1
3: 8
4: 69
Right 1184724051 22:46332728-46332750 GGTGATACACAGGGGCCTCTTGG 0: 1
1: 0
2: 1
3: 10
4: 159
1184724046_1184724051 -8 Left 1184724046 22:46332713-46332735 CCTGTAGTGGACCTGGGTGATAC 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1184724051 22:46332728-46332750 GGTGATACACAGGGGCCTCTTGG 0: 1
1: 0
2: 1
3: 10
4: 159
1184724043_1184724051 2 Left 1184724043 22:46332703-46332725 CCATAACTAGCCTGTAGTGGACC 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1184724051 22:46332728-46332750 GGTGATACACAGGGGCCTCTTGG 0: 1
1: 0
2: 1
3: 10
4: 159
1184724040_1184724051 23 Left 1184724040 22:46332682-46332704 CCTGGGATGTCGTCATCCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 135
Right 1184724051 22:46332728-46332750 GGTGATACACAGGGGCCTCTTGG 0: 1
1: 0
2: 1
3: 10
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184724051 Original CRISPR GGTGATACACAGGGGCCTCT TGG Intronic
900528931 1:3143229-3143251 GCTGAGACACAGGGACCCCTGGG + Intronic
900543342 1:3215276-3215298 GATGATCCACAGGTGCCACTGGG + Intronic
901427720 1:9193228-9193250 GGTGCTATACAGAGGCTTCTTGG + Intergenic
903172091 1:21560745-21560767 GGTGAGGCCCAGGGGCCTGTGGG + Exonic
905872982 1:41415625-41415647 AGTGATTCACAGCAGCCTCTAGG - Intergenic
906676469 1:47697240-47697262 GGTGACACAGAGGTGACTCTAGG + Intergenic
907284080 1:53369218-53369240 GGTAATACACAGGTGACTCTCGG + Intergenic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
920297487 1:204967890-204967912 GGGGCCACACAGTGGCCTCTGGG + Intronic
921162569 1:212483508-212483530 GGTGTCAGACACGGGCCTCTAGG + Intergenic
922566414 1:226604458-226604480 GGAGACAGGCAGGGGCCTCTTGG - Exonic
1063484883 10:6410555-6410577 GGAAATGCACAGGGGCATCTGGG + Intergenic
1067295333 10:44972308-44972330 GGGGCTACACAGGGGCTTATAGG + Intronic
1068333229 10:55600034-55600056 GATGATACATTGGGGCCTGTTGG - Exonic
1069637806 10:69936249-69936271 GGTGATGCACAGGGGCCCCATGG - Intronic
1072535199 10:96357035-96357057 GGTGGAACACAGGGACGTCTGGG + Intronic
1074524229 10:114250503-114250525 GGGGTTGCACAGTGGCCTCTGGG + Intronic
1074885292 10:117688631-117688653 GGTGATAAAAACGGTCCTCTGGG + Intergenic
1077402314 11:2365265-2365287 GGTGATACACTGGGGAGACTTGG + Intergenic
1081155449 11:39684187-39684209 GGTTATACTCAGGGGCTCCTTGG - Intergenic
1082558862 11:54595457-54595479 CGTCACACACAGGGGCCTGTTGG - Intergenic
1083403979 11:62444060-62444082 GGTGGCACAGAGCGGCCTCTTGG + Intronic
1084790269 11:71471160-71471182 GGTGTCACACTGGGCCCTCTGGG + Intronic
1084961286 11:72718075-72718097 GGTGGAACACAGGGGCCTCTCGG + Intronic
1087903706 11:103671340-103671362 GGTGATACTCAGGGGATTGTGGG - Intergenic
1088867867 11:113866054-113866076 GGTGATCCACATTGGCCTCCCGG - Intronic
1089647256 11:119888460-119888482 GGGGACCCACAGGGGACTCTTGG + Intergenic
1091147256 11:133290592-133290614 GGTGCCACTCAGGGGTCTCTGGG - Intronic
1091897812 12:4119192-4119214 CCAGATACACAGGGGCCTCACGG + Intergenic
1092198668 12:6566178-6566200 GGTGAACCACGGGGACCTCTGGG - Exonic
1092283536 12:7115301-7115323 GGTGGTAGACAGGTGCATCTGGG + Intergenic
1095241456 12:39864600-39864622 GGTGGTAGAGAGGGGCCCCTAGG - Intronic
1097070253 12:56349346-56349368 GGGGATAAACAGAAGCCTCTTGG - Intronic
1103592307 12:122000824-122000846 GGTGTTAAACAGGGTCCTCCAGG - Intronic
1104800822 12:131554393-131554415 GGTGATACAGAGGCACATCTGGG - Intergenic
1108941088 13:55953594-55953616 GATCACACACTGGGGCCTCTCGG + Intergenic
1111289497 13:86145639-86145661 CATCATACACTGGGGCCTCTTGG + Intergenic
1112155265 13:96810126-96810148 GGTGCCTCACAGCGGCCTCTGGG - Intronic
1113499039 13:110758936-110758958 GGTGATCCAGAGGGGCTTCTTGG - Intergenic
1122742338 14:103879588-103879610 CGTGTTTCACAGGGGCCACTCGG + Intergenic
1128674753 15:69600312-69600334 GGTTCTACAGAGGGGCCTCAGGG - Intergenic
1128881094 15:71243566-71243588 GATGGCACACAGAGGCCTCTGGG + Intronic
1130288128 15:82572234-82572256 GGTGCTGCTCAGGGGCCACTTGG - Intronic
1130338911 15:82982487-82982509 TGTGACACTTAGGGGCCTCTAGG - Intronic
1130907855 15:88252713-88252735 GTTGATACACAGGAACCTCATGG - Intronic
1130996097 15:88905155-88905177 AGAGAAACACAGGGGCTTCTTGG - Intronic
1131081523 15:89540369-89540391 GGGGACACACAGTGGCTTCTAGG + Intergenic
1132829223 16:1919312-1919334 CGTGAGATTCAGGGGCCTCTCGG + Intergenic
1138526416 16:57610323-57610345 GCTGCTACCCAGGGGCCACTTGG - Intergenic
1138552353 16:57754691-57754713 GGTGGGACCCAGGGGGCTCTAGG - Intronic
1138786526 16:59852966-59852988 GGTGAAACACAGGGGCTTGAGGG + Intergenic
1140157337 16:72445304-72445326 GGATATACACTGGGGCCTGTTGG - Intergenic
1143875613 17:9988422-9988444 GGAGATAAGCAGGGGCCTCCAGG - Intronic
1147330852 17:39698591-39698613 GTTGAGAAACAGGGGCCTCTGGG - Intronic
1147746773 17:42699463-42699485 GGTGCTAAACTGAGGCCTCTTGG - Exonic
1148142829 17:45340446-45340468 GGTGGTTCACAGGGGTCCCTGGG + Intergenic
1149487184 17:57051701-57051723 GGGGACACACAGGGGCTGCTGGG + Intergenic
1151910868 17:77082331-77082353 GGAGGTAGACAGGAGCCTCTGGG - Intergenic
1152585500 17:81187815-81187837 GGTGAGACCCAGGCACCTCTTGG - Intergenic
1156073864 18:33248431-33248453 CGTCATACACTGGGGCCTGTTGG - Intronic
1157770307 18:50339849-50339871 GGGGATACACATGGGTCCCTAGG - Intergenic
1160502167 18:79407073-79407095 GGTGATACCTGGGGGGCTCTGGG - Intronic
1160532305 18:79572565-79572587 GGAGAGACACGGGGGGCTCTGGG + Intergenic
1160967353 19:1752599-1752621 GGTGAGCCCCAGGGGCCCCTGGG - Exonic
1162039056 19:7958326-7958348 GGCCATACCCAGGGGCCACTCGG + Intergenic
1163032460 19:14553488-14553510 GGTCATACACTGAGGCCACTGGG + Intronic
1164700623 19:30281552-30281574 TGTGGTGCACTGGGGCCTCTGGG - Intronic
1165231995 19:34393148-34393170 GGTCTTGCACAGGGGCGTCTCGG - Intronic
1165648641 19:37467237-37467259 GGTGAGCCGCGGGGGCCTCTGGG - Exonic
1165658584 19:37555011-37555033 GGTGATAGACCGGGGGCTTTGGG + Intronic
1166749971 19:45159919-45159941 GCTGCTACACAGATGCCTCTGGG + Intronic
1167260810 19:48456613-48456635 GGGGATCCTCAGGGGCTTCTTGG - Exonic
1168115604 19:54220133-54220155 GGTGAGTCACTGAGGCCTCTTGG - Exonic
1168121420 19:54254343-54254365 GGTGAGTCACTGAGGCCTCTGGG - Exonic
1168305248 19:55431812-55431834 GGTGATCCAGAGTGGCCTCCTGG + Exonic
926295830 2:11567860-11567882 GGGGATACACAGGGACCTGTGGG - Intronic
931139049 2:59436868-59436890 GGTGAGACAAAGTGGCCTGTGGG + Intergenic
934852803 2:97712215-97712237 GGTGATAGACACGGGGCTTTGGG + Intergenic
937102808 2:119284495-119284517 GGTGATCCACTGAGGCCTCTTGG - Intergenic
938368968 2:130756724-130756746 GGGGAGACAAAGGGCCCTCTGGG - Intronic
938661960 2:133496237-133496259 GGTGATACATGGGCACCTCTGGG + Intronic
945445941 2:209938946-209938968 GGGCATACACATGGGGCTCTTGG - Intronic
946397592 2:219451176-219451198 TCTCAAACACAGGGGCCTCTAGG - Exonic
947313192 2:228826548-228826570 GGTGAGATACAGGGCTCTCTGGG - Intergenic
948832398 2:240604463-240604485 TGTGTCACCCAGGGGCCTCTAGG + Intronic
1168911596 20:1452419-1452441 AGTGATACACAGGGTCTGCTGGG + Intronic
1170174978 20:13459050-13459072 GGTGATGGAGAGTGGCCTCTAGG - Intronic
1170509850 20:17065296-17065318 CCTGATTCACAGGGGGCTCTAGG - Intergenic
1170604541 20:17865750-17865772 GATCATAGAGAGGGGCCTCTTGG + Intergenic
1171003924 20:21444334-21444356 CGTCATACACTGGGGCCTGTTGG + Intergenic
1173817293 20:45997904-45997926 GGTGCTACCCAGGGGGCTTTAGG + Intergenic
1173864389 20:46305084-46305106 GATGATACACAGTGGCTGCTTGG - Intronic
1174687243 20:52467729-52467751 GGGGACACACTGGGGCCTCTCGG - Intergenic
1175018427 20:55817296-55817318 GGTCATACTCAGGGTCCACTAGG + Intergenic
1175874769 20:62224160-62224182 TGTGAGACTCAGGGCCCTCTTGG + Intergenic
1176292861 21:5055483-5055505 GGTGATTCATCGGGGCCTCAGGG - Intergenic
1178381131 21:32109831-32109853 GGTGAAGCACAGGGGGCTCGGGG + Intergenic
1179864399 21:44208167-44208189 GGTGATTCATCGGGGCCTCAGGG + Intergenic
1180078180 21:45473698-45473720 GGTGAGACCCAGGGGCGTCCTGG - Intronic
1180127751 21:45803741-45803763 GGAGAAGCTCAGGGGCCTCTTGG - Intronic
1182419729 22:30243129-30243151 GAAGATAGAGAGGGGCCTCTGGG - Exonic
1184724051 22:46332728-46332750 GGTGATACACAGGGGCCTCTTGG + Intronic
950297303 3:11843086-11843108 GGTGATAGACGGGAACCTCTTGG - Intronic
950483895 3:13261458-13261480 GGGGATACACTGGGAGCTCTCGG - Intergenic
955887285 3:63614043-63614065 GATGATCCACAGTGGCCTGTGGG - Intronic
957063402 3:75500508-75500530 GGTGATAGACACGGGACTTTGGG + Intergenic
960616443 3:119600188-119600210 GCTGACCCACATGGGCCTCTTGG + Intronic
960680859 3:120246242-120246264 GAAGATACCAAGGGGCCTCTTGG + Intronic
961624832 3:128254711-128254733 GGTGGTACACAAGGCCCTCTGGG - Intronic
962100665 3:132339042-132339064 GAAGACACACTGGGGCCTCTTGG - Intronic
967956938 3:194884623-194884645 GTTGATACACAAGGGCCCCAAGG + Intergenic
968556501 4:1248639-1248661 GGTGACACAAAAGGGCCTGTGGG - Intronic
970137697 4:12943965-12943987 GATGACACACTGGGGCCTATTGG - Intergenic
973157313 4:46972763-46972785 GGTGGTAGTCAGGGGCCTCCGGG - Intronic
973928150 4:55760934-55760956 CATCATACACAGGGGCCTGTCGG + Intergenic
975289756 4:72663972-72663994 GGAGAAAGACAGTGGCCTCTGGG - Intergenic
976002282 4:80387088-80387110 GGTGATGCTCCAGGGCCTCTGGG + Intronic
980831132 4:138130518-138130540 GGTTATAGACAGGGGCCACCAGG - Intergenic
981586861 4:146312947-146312969 AGAGATACTCAGAGGCCTCTAGG + Intronic
982418776 4:155168759-155168781 GGTGGTACAAAGGGGACTTTTGG + Intergenic
986273822 5:6256462-6256484 GGTGAAATCCAGGGGTCTCTTGG + Intergenic
987279191 5:16395161-16395183 GGTCACACACTGGGGCCTGTTGG - Intergenic
987564586 5:19567607-19567629 TGTCATTCACATGGGCCTCTGGG - Intronic
991102365 5:62806971-62806993 CATCACACACAGGGGCCTCTCGG - Intergenic
992097561 5:73377087-73377109 GTTGAAACCCTGGGGCCTCTGGG - Intergenic
994788716 5:104197141-104197163 GGAGATACACAGGGGCAGGTTGG + Intergenic
999101175 5:149027446-149027468 GATGAGACACAGGGCCCTCTGGG + Exonic
999791027 5:154939385-154939407 GGTGATAGACTGGGGGCTTTGGG + Intergenic
1001338292 5:170819964-170819986 GGTGAAAAGCAGGGTCCTCTAGG - Intergenic
1004176251 6:13342696-13342718 GATGATACACAGGGCCTTCGAGG + Intergenic
1006604036 6:35243707-35243729 AGTGATGCCCACGGGCCTCTTGG + Exonic
1006883947 6:37364339-37364361 GGAGACACACAGGGGTTTCTGGG + Intronic
1011355896 6:86473263-86473285 GGTGATAGACACGGGGCTTTGGG - Intergenic
1012303738 6:97623768-97623790 GGTGATACACGGAGGGCACTGGG + Intergenic
1018044023 6:159950423-159950445 GGTGAGACACAGGGGGCCTTCGG + Intergenic
1018246834 6:161831928-161831950 GGGGAGCCACAAGGGCCTCTTGG + Intronic
1018845321 6:167551743-167551765 GGTGAGAGGCAGAGGCCTCTGGG + Intergenic
1019175318 6:170156624-170156646 GGTGACTCACAAGGGCCCCTTGG - Intergenic
1019438749 7:1036125-1036147 GGTGGTGCACAGGGCCCTTTTGG + Intronic
1023818931 7:43969710-43969732 GGTGAGACTCAGGGGCCTGGGGG - Intergenic
1024092688 7:45958594-45958616 GGTGAGAAACTGAGGCCTCTTGG + Intergenic
1026382462 7:69813264-69813286 GGTGACACTCAGGGGCCTGAAGG - Intronic
1027267124 7:76500607-76500629 GGTGCTTCCCAGGTGCCTCTGGG + Intronic
1027318937 7:77000475-77000497 GGTGCTTCCCAGGTGCCTCTGGG + Intergenic
1029114308 7:98229475-98229497 CGTGTTTCACAGGGGCCCCTTGG + Intronic
1029743981 7:102506673-102506695 GGTGAGACTCAGGGGCCTGGGGG - Exonic
1029761970 7:102605836-102605858 GGTGAGACTCAGGGGCCTGGGGG - Exonic
1031352401 7:120750917-120750939 GGTGATATATATGGTCCTCTTGG + Intergenic
1032472609 7:132189461-132189483 GGTGTTAATCTGGGGCCTCTTGG + Intronic
1032493805 7:132345694-132345716 GGTGAGACACTGGAGCCCCTGGG - Intronic
1032520947 7:132544579-132544601 GGTGATCCATGGGGGCTTCTAGG + Intronic
1036601554 8:10265343-10265365 GGTGTGTCACAGGGGCTTCTGGG + Intronic
1036632106 8:10523248-10523270 AATGCTACCCAGGGGCCTCTCGG + Intergenic
1040031978 8:42832997-42833019 GGTGATAGACACGGGGCTTTGGG + Intergenic
1045402319 8:101831652-101831674 GGTGATTCTCAGGGGCCACAAGG - Intronic
1049175021 8:141186918-141186940 GGAGCTACTCAGCGGCCTCTCGG - Intronic
1051486376 9:17612854-17612876 AGTGATAATCAGGGGCTTCTCGG - Intronic
1051490487 9:17658807-17658829 GGTGATTTCCAGGGGCATCTTGG - Intronic
1057729195 9:97594129-97594151 GGTGATAAAATTGGGCCTCTGGG + Intronic
1060778477 9:126393901-126393923 GCTGATACAAAGGCGGCTCTGGG - Intronic
1061297311 9:129683802-129683824 AGAGAAGCACAGGGGCCTCTGGG + Intronic
1061870411 9:133517281-133517303 GGTGACTCCCAGGGGCCTCCTGG + Intronic
1062220685 9:135413568-135413590 TGTGCAACGCAGGGGCCTCTCGG - Intergenic
1185531341 X:821405-821427 GGTGGGACACAGGGGTCTCTGGG - Intergenic
1186413854 X:9366385-9366407 GGTGATAAGCAGAGTCCTCTAGG + Intergenic
1192947620 X:75983156-75983178 GTTGAAACACAGAGGCCTATGGG + Intergenic
1196777410 X:119352131-119352153 TGGCATACACAGGGGCCTATTGG + Intergenic
1198259348 X:134952007-134952029 CATCATACACTGGGGCCTCTCGG + Intergenic
1199582672 X:149376066-149376088 TCTGATGCCCAGGGGCCTCTTGG + Intergenic
1200786221 Y:7263222-7263244 GGTGATAGACACGGGGCTTTGGG - Intergenic
1200807976 Y:7452146-7452168 GGTGATAGACATGGGGCTTTGGG - Intergenic