ID: 1184724303

View in Genome Browser
Species Human (GRCh38)
Location 22:46334693-46334715
Sequence CAGTTTGAGCACGTGTTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 884
Summary {0: 1, 1: 0, 2: 12, 3: 114, 4: 757}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184724303_1184724306 -4 Left 1184724303 22:46334693-46334715 CCTGAGAACACGTGCTCAAACTG 0: 1
1: 0
2: 12
3: 114
4: 757
Right 1184724306 22:46334712-46334734 ACTGGTGGTGCTACAGCTTTTGG 0: 1
1: 0
2: 0
3: 8
4: 130
1184724303_1184724308 13 Left 1184724303 22:46334693-46334715 CCTGAGAACACGTGCTCAAACTG 0: 1
1: 0
2: 12
3: 114
4: 757
Right 1184724308 22:46334729-46334751 TTTTGGTTTCGTACGTTTTAGGG No data
1184724303_1184724307 12 Left 1184724303 22:46334693-46334715 CCTGAGAACACGTGCTCAAACTG 0: 1
1: 0
2: 12
3: 114
4: 757
Right 1184724307 22:46334728-46334750 CTTTTGGTTTCGTACGTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184724303 Original CRISPR CAGTTTGAGCACGTGTTCTC AGG (reversed) Intronic
900721163 1:4176691-4176713 CACCTTGGGCACCTGTTCTCAGG + Intergenic
902429887 1:16354683-16354705 CACCTTGGGCACATGTTCTCAGG + Intronic
902947197 1:19850295-19850317 GAGTTTCAACACGTGGTCTCTGG + Intergenic
904394563 1:30210085-30210107 CACCTTGGGCACATGTTCTCAGG + Intergenic
904577679 1:31515557-31515579 CAGTTTGAGCTGGTTTTATCTGG + Intergenic
905047563 1:35019359-35019381 CAGTTTGTGCAGGTTTTCTTGGG + Exonic
906841625 1:49145570-49145592 CAGTTTGAGAATTTGGTCTCAGG + Intronic
907657270 1:56356997-56357019 CACCTTGAGCACGTGTTGTCAGG - Intergenic
908239656 1:62178089-62178111 CACCTTGGGCACATGTTCTCAGG + Intergenic
908522179 1:64955118-64955140 CAATTTGAGCAAGTGTACACAGG + Intronic
908574296 1:65442493-65442515 CACCTTGGGCACATGTTCTCAGG + Intronic
908662151 1:66448369-66448391 CACATTGGGCACATGTTCTCAGG + Intergenic
908748611 1:67398807-67398829 CACTTTGGGCACATGTCCTCCGG - Intergenic
908910161 1:69063858-69063880 CACCTTGGGCACATGTTCTCAGG - Intergenic
909079759 1:71095872-71095894 GAGTTTGAGCAGGAATTCTCGGG + Intergenic
909204092 1:72731134-72731156 CAGTTTTTGCAAGTGTTCTTTGG + Intergenic
909443200 1:75720719-75720741 CACCCTGAGCACATGTTCTCAGG - Intergenic
909760335 1:79278008-79278030 CACCTTGGGCATGTGTTCTCAGG + Intergenic
909857030 1:80548053-80548075 CACCTTGAGCACATGTTCTCAGG + Intergenic
910405491 1:86885230-86885252 CAGTTTGAGTAGCTGTTATCTGG - Intronic
910577192 1:88778180-88778202 CACCTTGGGCACGTGTTGTCAGG + Intronic
912260175 1:108103295-108103317 CAGTTTCACCAGTTGTTCTCAGG - Intergenic
912346424 1:108967365-108967387 CACCTTGGGCACATGTTCTCAGG - Intergenic
912388997 1:109288673-109288695 CACTTTGGGCACATGTTGTCAGG + Intergenic
912620443 1:111151076-111151098 TACCTTGGGCACGTGTTCTCAGG - Intronic
912938709 1:114025893-114025915 CACCTTGGGCACATGTTCTCAGG + Intergenic
912940307 1:114039035-114039057 CACCTTGGGCACATGTTCTCAGG + Intergenic
913669142 1:121079028-121079050 CACCTTGAGTACATGTTCTCAGG + Intergenic
914020887 1:143866425-143866447 CACCTTGAGTACATGTTCTCAGG + Intergenic
914659384 1:149774367-149774389 CACCTTGAGTACATGTTCTCAGG + Intergenic
914886923 1:151593148-151593170 CACCTTGGGCACATGTTCTCAGG - Intergenic
914886964 1:151593446-151593468 CACTTTGGGCACATGTTCTCAGG + Intergenic
915208587 1:154288939-154288961 CACTTTGTGCACAGGTTCTCAGG - Intergenic
915642102 1:157235837-157235859 CACTTTGGACACATGTTCTCAGG + Intergenic
915880573 1:159667102-159667124 CACCTTGTGCACATGTTCTCAGG - Intergenic
916326219 1:163562756-163562778 CAGATTCAGCACATGTTCCCAGG + Intergenic
917117924 1:171621146-171621168 CAACTTGGGCACGTGTTCTCAGG + Intergenic
917152980 1:171964557-171964579 CACCTTGGGCACATGTTCTCAGG + Intronic
917210152 1:172622955-172622977 CACCTTGGGCACATGTTCTCAGG - Intergenic
917409865 1:174748511-174748533 CACCTTGGGCACATGTTCTCAGG - Intronic
917556114 1:176090309-176090331 CACCTTGGGCACATGTTCTCAGG + Intronic
918061593 1:181066178-181066200 CACCTTGGGCACATGTTCTCAGG + Intergenic
918540950 1:185632452-185632474 CACCTTGAGCACATGTTATCAGG + Intergenic
918767852 1:188511650-188511672 CACCTTGGGCACATGTTCTCAGG + Intergenic
919503601 1:198369438-198369460 CACTTTGGGGACATGTTCTCAGG + Intergenic
921077039 1:211707990-211708012 GAGTTTCAACACGTGGTCTCTGG - Intergenic
922166271 1:223118060-223118082 CACCTTGGGCACATGTTCTCAGG - Intronic
922202989 1:223422382-223422404 CACCTTGGGCACATGTTCTCAGG - Intergenic
922337478 1:224629384-224629406 CACCTTGGGCACATGTTCTCAGG + Intronic
922694476 1:227721763-227721785 CATTTTGGGCACATGTTCTCAGG + Intergenic
922813633 1:228433363-228433385 CACCTTGGGCACATGTTCTCAGG + Intergenic
923074765 1:230600514-230600536 CACCTTGAGCATGTGTTCTCAGG - Intergenic
923380772 1:233415774-233415796 GACGTTGGGCACGTGTTCTCAGG - Intergenic
923755982 1:236791599-236791621 CACCTTGGGCACCTGTTCTCAGG + Intergenic
924928620 1:248707457-248707479 CATCTTGGGCACGTGTTCTCAGG - Intergenic
1063020177 10:2119163-2119185 CACTTTGGGCACGTGTCATCAGG + Intergenic
1063845296 10:10121148-10121170 CAGCTTGGGCACATGTTCTCAGG - Intergenic
1064804748 10:19118309-19118331 CACCTTGGGCACCTGTTCTCAGG - Intronic
1065156183 10:22872407-22872429 CACCTTGGGCACATGTTCTCAGG + Intergenic
1065265624 10:23972091-23972113 CACTTTGGGTACATGTTCTCAGG + Intronic
1065838802 10:29683033-29683055 CACCTTAAGCACATGTTCTCAGG - Intronic
1065847270 10:29756051-29756073 CACCTTGAGCACATGTTCTCAGG + Intergenic
1066192973 10:33072700-33072722 CACCTTGGGCACATGTTCTCAGG + Intergenic
1066195637 10:33096988-33097010 CACCTTGGGCACATGTTCTCAGG - Intergenic
1067266002 10:44745777-44745799 CACCTTGGGCACATGTTCTCAGG - Intergenic
1067856245 10:49796058-49796080 CACCTTGGGCACATGTTCTCAGG - Intergenic
1069048415 10:63766713-63766735 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1069119025 10:64545006-64545028 CACCTTGGGCACATGTTCTCAGG + Intergenic
1069134881 10:64751657-64751679 CACCTTGGGCACATGTTCTCAGG - Intergenic
1069178675 10:65327404-65327426 CACCTTGGGCATGTGTTCTCAGG + Intergenic
1069180634 10:65354126-65354148 CACCTTGGGCACATGTTCTCAGG + Intergenic
1069329764 10:67278314-67278336 CACCTTGGGCACATGTTCTCTGG - Intronic
1070171902 10:73939295-73939317 CACCTTGGGCACATGTTCTCAGG + Intergenic
1070255564 10:74810844-74810866 CACCTTGGGCACATGTTCTCAGG - Intergenic
1070904760 10:80062375-80062397 CAGCTTGGGCACACGTTCTCAGG - Intergenic
1070905425 10:80068238-80068260 CACCTTGGGCACATGTTCTCAGG + Intergenic
1070991513 10:80737140-80737162 CACCTTGGGCACATGTTCTCAGG + Intergenic
1071036448 10:81252276-81252298 CACTGTGGGCACGCGTTCTCAGG + Intergenic
1071426923 10:85566524-85566546 CACCTTGGGCACATGTTCTCAGG + Intergenic
1071863112 10:89696195-89696217 CACCTTGTGCACATGTTCTCAGG + Intergenic
1071897156 10:90080130-90080152 TACTTTGAGCACATGTTGTCAGG + Intergenic
1071926758 10:90417977-90417999 CACCTTGGGCACATGTTCTCAGG + Intergenic
1072480034 10:95802059-95802081 CACCTTGGGCACATGTTCTCAGG - Intronic
1073548555 10:104375645-104375667 CACTTTGGGCACATGTTCTCAGG - Intronic
1073560513 10:104492538-104492560 CAGTCTGAGCACTTCTTGTCTGG - Intergenic
1073926972 10:108527811-108527833 CACCTTGGGCACATGTTCTCAGG + Intergenic
1073995065 10:109306309-109306331 CACCTTGGGCACATGTTCTCAGG - Intergenic
1074002194 10:109384377-109384399 CACCTTGGGCACATGTTCTCAGG + Intergenic
1074215126 10:111376731-111376753 CACGTTGGGCACATGTTCTCAGG - Intergenic
1074986434 10:118664051-118664073 CACTTTGAGATCCTGTTCTCTGG + Intergenic
1075107681 10:119552580-119552602 CAGGTTGGGCCCTTGTTCTCTGG - Intergenic
1076150373 10:128157466-128157488 CAGTTTGAGTTCGGGTTCACTGG - Intergenic
1076329038 10:129651675-129651697 CAGGATGAGCACGTTCTCTCAGG - Intronic
1076977391 11:184622-184644 GACTTTGGGCACATGTTCTCAGG + Intronic
1077005030 11:350895-350917 AAGTTTCAACACGTGTTCTCTGG + Intergenic
1077671159 11:4158808-4158830 CACCTTGGGCACATGTTCTCAGG - Intergenic
1077873737 11:6284905-6284927 GAGTTTCAACATGTGTTCTCTGG - Intergenic
1077885699 11:6386160-6386182 CACCTTGGGCACATGTTCTCAGG - Intergenic
1078536367 11:12178361-12178383 TACTTTGGGCACATGTTCTCAGG - Intronic
1078634691 11:13038342-13038364 CATATTGAGCAAGTTTTCTCTGG + Intergenic
1079235226 11:18683548-18683570 GAGTTTCAACACGTGGTCTCTGG - Intergenic
1079675799 11:23224900-23224922 CACCTTGAGCACATGTTCTCAGG - Intergenic
1079726581 11:23887042-23887064 CATCTTGGGCACATGTTCTCAGG + Intergenic
1079891016 11:26053260-26053282 CACCTTGGGCACATGTTCTCAGG - Intergenic
1079893674 11:26091633-26091655 CACTTTGGGCACATGTTCTTGGG - Intergenic
1080072193 11:28102484-28102506 CACTTTGGGCACATGCTCTCAGG + Intronic
1080867598 11:36209275-36209297 CAGTTTTAGCAGTTGTTCTGTGG + Intronic
1081328757 11:41778582-41778604 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1082103287 11:48192234-48192256 CAGCTAGGACACGTGTTCTCAGG + Intergenic
1082701949 11:56442742-56442764 CACCTTGAGCACATGTTCTCAGG - Intergenic
1082825376 11:57573985-57574007 CAGTTTGAGCCCATGTTCAAGGG + Intergenic
1082846242 11:57728062-57728084 CACCTTGGGCACATGTTCTCAGG + Intronic
1082950600 11:58811090-58811112 CACTTTGGGCACATGTTGTCAGG + Intergenic
1083055067 11:59811452-59811474 CACCTTGGGCACATGTTCTCAGG - Intergenic
1083056687 11:59828177-59828199 CAGTTTTAGGAAGTGTTCTGTGG + Intergenic
1083238957 11:61371686-61371708 CATCTTGGGCACGTGTTCTCAGG - Intergenic
1084074447 11:66762242-66762264 CAGTTTGCGCGCGTGTTCTGCGG - Intronic
1084933104 11:72572412-72572434 CACCTTGGGCACATGTTCTCAGG - Intergenic
1085451137 11:76634229-76634251 AAGTTTGAGAACGTGCTCTGTGG - Intergenic
1085988662 11:81813186-81813208 CACCTTGGGCACATGTTCTCAGG + Intergenic
1086203896 11:84235284-84235306 CATCTTGGGCACATGTTCTCAGG + Intronic
1086272449 11:85083490-85083512 CACCTTGGGCACATGTTCTCAGG - Intronic
1086390491 11:86358233-86358255 CACCTTGGGCACATGTTCTCAGG + Intergenic
1086501930 11:87462605-87462627 CACCTTGAGCACATGTTCTCAGG - Intergenic
1086856935 11:91876768-91876790 CACCTTGGGCACATGTTCTCAGG + Intergenic
1087090138 11:94262047-94262069 CAGCTTTTGCAGGTGTTCTCTGG + Intergenic
1087900204 11:103631909-103631931 CACTTTGGGCCCATGTTCTCAGG + Intergenic
1088087118 11:105994725-105994747 CACCTTGGGCACATGTTCTCAGG - Intergenic
1088129331 11:106468029-106468051 CACCTTGGGCACATGTTCTCAGG + Intergenic
1088313817 11:108487332-108487354 CACCTTGAGCACAGGTTCTCAGG + Intronic
1088561858 11:111123244-111123266 CATCTTGGGCACATGTTCTCAGG + Intergenic
1088877795 11:113950310-113950332 CACCTTGGGCACATGTTCTCAGG + Intergenic
1088948634 11:114541538-114541560 CACCTTGGGCACATGTTCTCAGG - Intronic
1089864113 11:121616832-121616854 CACCTTGGGCACATGTTCTCAGG - Intronic
1090108416 11:123876744-123876766 CACCTTGGGCACATGTTCTCAGG + Intergenic
1090825527 11:130382774-130382796 CACCTTGGGCACATGTTCTCAGG - Intergenic
1090877651 11:130805270-130805292 CACCTTGGGCACATGTTCTCAGG + Intergenic
1091242343 11:134062261-134062283 CACCTTGGGCACCTGTTCTCAGG + Intergenic
1091257133 11:134198490-134198512 CACCTTGGGCACATGTTCTCAGG + Intronic
1091574556 12:1721128-1721150 CACCTTGAGCACATGTTGTCAGG + Intronic
1094133581 12:27100668-27100690 CACCTTGGGCACATGTTCTCAGG + Intergenic
1094183732 12:27618715-27618737 CACCTTGGGCACATGTTCTCAGG + Intronic
1094421356 12:30274559-30274581 CAACTTGGGCACATGTTCTCAGG - Intergenic
1094522487 12:31207471-31207493 CACCTTGAGCGCATGTTCTCAGG + Intergenic
1094588644 12:31800840-31800862 CACCTTGGGCACATGTTCTCAGG - Intergenic
1094618687 12:32059569-32059591 CACCTTGGGCACATGTTCTCAGG + Intergenic
1095896410 12:47284339-47284361 CACTTTGAGCACATGTTCTCAGG + Intergenic
1095999344 12:48115684-48115706 CATCTTGGGCACATGTTCTCAGG + Intronic
1095999554 12:48117776-48117798 CATCTTGAACACATGTTCTCAGG - Intronic
1096034077 12:48448852-48448874 CACCTTGGGCACATGTTCTCAGG - Intergenic
1096353892 12:50923926-50923948 CACCTTGGGCACATGTTCTCAGG - Exonic
1096363344 12:51007226-51007248 CACCTTGGGCACATGTTCTCGGG + Intronic
1097058166 12:56263053-56263075 AAGTTTGAGCCCATCTTCTCTGG - Intergenic
1097858131 12:64489302-64489324 CTGTTTCAAAACGTGTTCTCAGG - Intronic
1098316164 12:69195531-69195553 CACCTTGGGCACATGTTCTCAGG - Intergenic
1098638652 12:72814582-72814604 CACCTTGGGCACATGTTCTCAGG - Intergenic
1098674674 12:73273976-73273998 CACCTTAAGCACATGTTCTCAGG - Intergenic
1098948146 12:76610374-76610396 CACTTTGGGCACATGATCTCAGG + Intergenic
1100000692 12:89831577-89831599 CAGTTTGAGCATGTGCATTCAGG - Intergenic
1100072519 12:90737663-90737685 CACCTTGGGCACATGTTCTCAGG - Intergenic
1100299218 12:93291806-93291828 CACCATGAGCACATGTTCTCGGG + Intergenic
1100362451 12:93891124-93891146 CACCTTGGGCACATGTTCTCAGG + Intronic
1100827556 12:98489144-98489166 CACTTTGAGCACACGTTCTCAGG - Intronic
1100929709 12:99592764-99592786 CACCTTGGGCACATGTTCTCAGG - Intronic
1100978806 12:100148310-100148332 CACCTTGGGCACATGTTCTCAGG + Intergenic
1101176303 12:102155338-102155360 CACCTTGGGCACATGTTCTCAGG + Intronic
1101679136 12:106947755-106947777 CACTTTGGGCACATGTTCTCAGG - Intergenic
1102415995 12:112763354-112763376 CACCTTGGGCACATGTTCTCAGG - Intronic
1104204118 12:126620015-126620037 CACCTTGGGCACATGTTCTCAGG - Intergenic
1104671592 12:130684349-130684371 CACCTTGGGCACATGTTCTCAGG + Intronic
1104948937 12:132430012-132430034 CAGTGTGTGCAGGTGTGCTCAGG - Intergenic
1105967465 13:25397707-25397729 CACCTTGGGCACATGTTCTCAGG - Intronic
1106114734 13:26807461-26807483 CACCTTGGGCACATGTTCTCAGG + Intergenic
1106119824 13:26850950-26850972 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1106397369 13:29394208-29394230 CACCTTGGGCACATGTTCTCAGG - Intronic
1106848781 13:33765873-33765895 CACCTTGGGCACGTGTTGTCAGG + Intergenic
1106927969 13:34632817-34632839 CACCTTGGGCACATGTTCTCAGG + Intergenic
1106987559 13:35372949-35372971 CAGTTTGAGCTCCTTTTCTCTGG + Intronic
1107079246 13:36356704-36356726 CACCTTGGGCACATGTTCTCAGG + Intronic
1107362928 13:39639385-39639407 CACCTTGGGCACATGTTCTCAGG + Intergenic
1107530797 13:41280460-41280482 CACTTTGGGCACAGGTTCTCAGG + Intergenic
1108258063 13:48629631-48629653 CACCTTGGGCACATGTTCTCAGG - Intergenic
1108279980 13:48851610-48851632 CACTTTGGACACATGTTCTCAGG + Intergenic
1108554819 13:51582690-51582712 CACCTTGGGCACATGTTCTCAGG - Intergenic
1109102903 13:58209113-58209135 CACCTTGGGCACATGTTCTCAGG - Intergenic
1109177601 13:59175690-59175712 CAACTTGGGCACATGTTCTCAGG - Intergenic
1109570264 13:64179440-64179462 TACCTTGAGCACATGTTCTCAGG - Intergenic
1109677216 13:65693447-65693469 CAGTTTAAGCAGGTATTCTGGGG - Intergenic
1109997472 13:70147778-70147800 CATCTTGGGCACATGTTCTCAGG - Intergenic
1110085173 13:71369372-71369394 CAGTTTGGGCACATGTCATCAGG - Intergenic
1111122495 13:83871896-83871918 CACCTTGGGCACATGTTCTCAGG + Intergenic
1111172120 13:84541257-84541279 CACGTTGGGCACATGTTCTCAGG - Intergenic
1111731038 13:92077200-92077222 CACCTTGGGCACATGTTCTCAGG + Intronic
1112177582 13:97042236-97042258 CAGTTTGAGGAGGTGGTGTCTGG + Intergenic
1112280818 13:98061467-98061489 CACCTTGGGCACATGTTCTCAGG + Intergenic
1112281336 13:98065402-98065424 CACCTTGGGGACGTGTTCTCAGG - Intergenic
1112886421 13:104177972-104177994 CACCTTGGGCACATGTTCTCAGG + Intergenic
1113161963 13:107391872-107391894 CACCTTGGGCACATGTTCTCTGG + Intronic
1114080177 14:19196981-19197003 CACCTTGGGCACATGTTCTCAGG - Intergenic
1114237773 14:20837164-20837186 CACCTTGGGCACATGTTCTCAGG - Intergenic
1114520998 14:23335896-23335918 CACTTTGGGCACGTGTCCTCAGG + Intergenic
1114521950 14:23345119-23345141 CACTTTGGGCACGTGTCCTCAGG + Intergenic
1115932372 14:38510757-38510779 CACCTTGGGCACATGTTCTCAGG + Intergenic
1116093654 14:40340068-40340090 CACCTTGAGCACATATTCTCAGG - Intergenic
1116310650 14:43322131-43322153 CAACTTGAGCACATGTTCTCAGG - Intergenic
1116471901 14:45295295-45295317 CACTTTGGGCACATGTTCTCAGG + Intergenic
1117209635 14:53482102-53482124 CACATTGGGCACATGTTCTCAGG - Intergenic
1118305597 14:64652436-64652458 CAGTTGGATCACTTGCTCTCTGG - Intergenic
1118369306 14:65123675-65123697 CATTTTGGGCACATGTTCCCAGG - Intergenic
1118545592 14:66884399-66884421 AAGTTTGAACACTTGTTCTTTGG - Intronic
1119064661 14:71513080-71513102 CACCTTGGGCACGTATTCTCAGG + Intronic
1119835985 14:77749294-77749316 CAGTTTGATGAGGTGCTCTCTGG - Intronic
1120267663 14:82272193-82272215 CAGCTTGGGAACATGTTCTCAGG - Intergenic
1120690068 14:87582342-87582364 CACCTTGGGCACATGTTCTCAGG + Intergenic
1120771321 14:88383565-88383587 CACTTTGGGCACATGTTCTCAGG - Intergenic
1121069594 14:91005751-91005773 AAGTTTGAGCTCTTGTTCTTAGG - Intronic
1121163015 14:91762674-91762696 CACCTTGGGCACATGTTCTCAGG - Intronic
1121268482 14:92621399-92621421 CACCTTGGGCACATGTTCTCAGG - Intronic
1121466795 14:94120878-94120900 CTGTTTGAGCACGTGTGTCCTGG + Intergenic
1122062453 14:99145114-99145136 CAACTTGGGCACATGTTCTCAGG + Intergenic
1122653827 14:103243458-103243480 CACCTTGTGCACATGTTCTCAGG + Intergenic
1122659463 14:103285013-103285035 CCCTTGGGGCACGTGTTCTCAGG + Intergenic
1122709254 14:103643545-103643567 CACCTTGGGCACATGTTCTCAGG - Intronic
1122950264 14:105040588-105040610 CACCTTGGGCACATGTTCTCAGG - Intergenic
1123137396 14:106041267-106041289 CATTTTGGACATGTGTTCTCAGG - Intergenic
1123159200 14:106261133-106261155 CACTTTGGGCACATGTTATCAGG - Intergenic
1123669743 15:22643841-22643863 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1123876548 15:24629325-24629347 CACCTTGGGCACATGTTCTCAGG + Intergenic
1123883301 15:24696166-24696188 CATTTTGGGCACATGTTGTCAGG - Intergenic
1124064281 15:26325359-26325381 CACCTTGGGCACATGTTCTCAGG + Intergenic
1124208900 15:27746041-27746063 CACCTTGGGCACATGTTCTCAGG + Intergenic
1124525716 15:30450257-30450279 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1124772939 15:32557428-32557450 CACCTTGGGCACGTGTTCTCAGG - Intergenic
1124898612 15:33801012-33801034 CACCTTGGGCACATGTTCTCAGG - Intronic
1125022276 15:34997284-34997306 CATCTTGAGCACATGTTCTTAGG - Intergenic
1126118022 15:45226576-45226598 CACCTTGAGCACATGTTCTCAGG - Intergenic
1126662384 15:51045666-51045688 CACCTTGGGCACATGTTCTCAGG + Intergenic
1127305834 15:57705138-57705160 CACCTTAGGCACGTGTTCTCAGG + Intronic
1127648609 15:60983836-60983858 CACCTTGAGCATATGTTCTCAGG + Intronic
1128469565 15:67940847-67940869 CACCTTGGGCACATGTTCTCAGG + Intergenic
1130074502 15:80677004-80677026 CACCTTGGGCACATGTTCTCAGG + Intergenic
1130557428 15:84932500-84932522 CAGTTTGAGAACTCCTTCTCAGG - Intronic
1130695163 15:86123768-86123790 CACCTTGAGCACATGTTCTCAGG + Intergenic
1130742229 15:86613080-86613102 CACTTTGGGCACATGTTCTCAGG + Intronic
1130861640 15:87896090-87896112 CACATTGGGCACATGTTCTCAGG + Intronic
1131464887 15:92646945-92646967 CACCTTGGGCACATGTTCTCAGG + Intronic
1131636486 15:94238085-94238107 CACCTTGGGCACATGTTCTCAGG + Intronic
1132263664 15:100447469-100447491 CACCTTGGGCACATGTTCTCAGG + Intronic
1132407230 15:101551142-101551164 CACCTTGAGCATGTGTTATCAGG + Intergenic
1132983925 16:2753563-2753585 TAGTTTGAACACGAATTCTCGGG - Intronic
1133576825 16:7099602-7099624 CACCTTGGGCACGTGTCCTCAGG - Intronic
1133645912 16:7764369-7764391 CACCTTGGGCACATGTTCTCAGG + Intergenic
1133871367 16:9689467-9689489 TACCTTGAGCACATGTTCTCAGG + Intergenic
1133907064 16:10031979-10032001 CAGTTTCAGCCCATGTCCTCAGG + Intronic
1133949592 16:10379879-10379901 CACTTTGGGCACATGTTCTCAGG - Intronic
1134001901 16:10789448-10789470 CACCTTGGGCACATGTTCTCAGG - Intronic
1134592595 16:15467758-15467780 CACCTTGAGCATATGTTCTCAGG - Intronic
1135204765 16:20474133-20474155 CAATTTGGGCACGTGTTCTCAGG + Intronic
1135214128 16:20549680-20549702 CACCTTGGGCACGTGTTCTCAGG - Intronic
1135226158 16:20660038-20660060 CACCTTGGGCACATGTTCTCAGG + Intronic
1135236504 16:20761309-20761331 CACCTTGGGCACATGTTCTCAGG + Intronic
1135776210 16:25258892-25258914 CACCTTGGGCACATGTTCTCAGG - Intergenic
1137884495 16:52087988-52088010 CACCTTGGGCACATGTTCTCAGG + Intergenic
1138600435 16:58050883-58050905 CACCTTGGGCACATGTTCTCAGG - Intergenic
1138748188 16:59388311-59388333 CATATTGGGCACATGTTCTCAGG - Intergenic
1140054297 16:71512031-71512053 CAGCTTGGGCACATGTTCTCAGG - Intronic
1141030620 16:80584591-80584613 CACCTTGGGCACATGTTCTCAGG + Intergenic
1142879933 17:2876334-2876356 CACCTTGGGCACTTGTTCTCGGG - Intronic
1142930915 17:3283577-3283599 CAGTATGAGCTAGAGTTCTCAGG + Intergenic
1143420498 17:6787856-6787878 CACCTTGGGCACATGTTCTCAGG - Intronic
1144483095 17:15643586-15643608 CACCTTGGGCACATGTTCTCAGG + Intronic
1144570872 17:16398007-16398029 CACCTTGGGCACATGTTCTCAGG + Intergenic
1144915587 17:18721444-18721466 CACCTTGGGCACATGTTCTCAGG - Intronic
1145024731 17:19459555-19459577 CACTTTGGACACATGTTCTCAGG + Intergenic
1145223615 17:21109174-21109196 CACCTTGGGCACGTGGTCTCAGG + Intergenic
1145293294 17:21567356-21567378 CATCTTGTGCACATGTTCTCAGG - Intronic
1145386675 17:22418581-22418603 CATCTTGTGCACATGTTCTCAGG + Intergenic
1145774287 17:27516799-27516821 CACCTTGGGCACATGTTCTCAGG - Intronic
1145887128 17:28390033-28390055 CACCTTGGGCACGTGTTCTCAGG - Intronic
1146238612 17:31192270-31192292 CACTTTGGGCACATGTTCTCAGG - Intronic
1146602298 17:34228333-34228355 CACCTTGAGCACATGTTCTCAGG + Intergenic
1147920965 17:43916874-43916896 CACCTTGGGCACATGTTCTCAGG + Intergenic
1148166008 17:45484596-45484618 CACCTTGGGCACATGTTCTCAGG + Intronic
1148949942 17:51302005-51302027 CACCTTGGGCACATGTTCTCAGG - Intergenic
1149170427 17:53803616-53803638 CACTTTGGGCACATGTTCTCAGG - Intergenic
1149217497 17:54374967-54374989 CACCTTGGGCACATGTTCTCAGG - Intergenic
1150628201 17:66857344-66857366 CAGTTTAAAAACGTGTTCTCAGG - Intronic
1150956176 17:69862768-69862790 CACCTTGGGCACATGTTCTCAGG + Intergenic
1152859889 17:82690234-82690256 GAGTGTGCACACGTGTTCTCGGG + Intronic
1153042997 18:831645-831667 CACCTTGGGCACATGTTCTCAGG + Intergenic
1153121875 18:1738774-1738796 CACTTTGGGCACATGTTCTCAGG - Intergenic
1153138256 18:1942161-1942183 CACCTTGAGCACATATTCTCAGG - Intergenic
1153157173 18:2162816-2162838 CATCTTGGGCACATGTTCTCAGG + Intergenic
1153572672 18:6488719-6488741 CACCTTGAGCACATGTTCTCAGG + Intergenic
1153837492 18:8977079-8977101 CACCTTGGGCACATGTTCTCAGG - Intergenic
1153868151 18:9292094-9292116 CAACTTGGGCACATGTTCTCAGG + Intergenic
1154048494 18:10930542-10930564 CAGTTTGGGCACATGTTCTCAGG + Intronic
1154089212 18:11341989-11342011 CACCTTGGGCACATGTTCTCGGG - Intergenic
1154114467 18:11599110-11599132 CACCTTGGGCACATGTTCTCCGG + Intergenic
1154373972 18:13793592-13793614 CACCTTGGGCACATGTTCTCAGG + Intergenic
1155146182 18:23085611-23085633 CACCTTGGGCACATGTTCTCAGG - Intergenic
1155736364 18:29227269-29227291 CACTTTGCACACATGTTCTCAGG + Intergenic
1155850601 18:30769433-30769455 CACCTTGAGCACGTGTTGTCAGG + Intergenic
1155954836 18:31948235-31948257 CACCTTGGGCACATGTTCTCAGG - Intronic
1155955357 18:31952302-31952324 CACTTTGGGCACATGCTCTCAGG + Intronic
1156153243 18:34267920-34267942 CCGTTTGTGCATGTGTTCCCTGG - Intergenic
1156185733 18:34660932-34660954 TACTTTGGGCACATGTTCTCAGG + Intronic
1156585658 18:38428229-38428251 CATCTTGGGCACATGTTCTCAGG - Intergenic
1156881996 18:42091900-42091922 CACCTTGAGAACATGTTCTCAGG - Intergenic
1156882003 18:42091974-42091996 CACCTTGAGAACATGTTCTCAGG - Intergenic
1157365928 18:47064355-47064377 CAGTTTGTGCACATGTCCTGTGG + Intronic
1157947972 18:52002452-52002474 CACGTTGAGCACGTGTCATCAGG + Intergenic
1158084609 18:53635933-53635955 CACCTTGGGCACATGTTCTCAGG + Intergenic
1158164861 18:54528980-54529002 CACCTTGGGCACATGTTCTCTGG - Intergenic
1158170976 18:54599142-54599164 CACTTTGGACACATGTTCTCAGG + Exonic
1158894146 18:61897500-61897522 CACCTTGGGCACATGTTCTCGGG - Intergenic
1159786338 18:72718782-72718804 CACCTTGGGCACATGTTCTCAGG + Intergenic
1159937895 18:74383110-74383132 CACCTTGGGCACATGTTCTCAGG - Intergenic
1160408264 18:78657895-78657917 CAGTTAGAGCAGGGGTTTTCTGG + Intergenic
1164470167 19:28523315-28523337 GAGTTTCAACACGTGGTCTCTGG - Intergenic
1164473048 19:28551797-28551819 CATCTTGTGCACATGTTCTCAGG + Intergenic
1165124905 19:33587132-33587154 CACCTTGGGCACGTGTTGTCAGG + Intergenic
1165249734 19:34520217-34520239 CACCTTGTGCACGTGTCCTCAGG - Intergenic
1166592766 19:44015652-44015674 CACTTTGGGCACATGTTCTCAGG - Intergenic
1166627269 19:44369887-44369909 CACTTTGGGCACATGTTGTCAGG + Intronic
925078493 2:1040310-1040332 CAGTTTGAGAACCCCTTCTCTGG + Intronic
925229471 2:2220190-2220212 CACCTTGGGCACATGTTCTCAGG - Intronic
925800204 2:7591626-7591648 CACCTTGGGCACATGTTCTCAGG - Intergenic
926999277 2:18775415-18775437 CACCTTGGGCACATGTTCTCAGG + Intergenic
927125557 2:20009976-20009998 CATCTTGAGCACATGTACTCAGG + Intronic
927452272 2:23219303-23219325 CATTTTGAGAACATTTTCTCTGG - Intergenic
927539767 2:23898556-23898578 CACCTTGGGCACATGTTCTCAGG + Intronic
927589212 2:24338431-24338453 CACCTTGGGCACATGTTCTCAGG + Intronic
927754448 2:25697574-25697596 CACTTTGGTCAGGTGTTCTCTGG - Intergenic
927892825 2:26763137-26763159 CACTTTGGGCACATGTTCTCAGG + Intergenic
928243017 2:29602878-29602900 CACCTTGGGCACATGTTCTCAGG - Intronic
928350456 2:30548300-30548322 CACTTTGGGCACATGTTCTCAGG - Intronic
928671633 2:33609046-33609068 CACCTTGGGCACATGTTCTCAGG + Intergenic
928931525 2:36629826-36629848 CACCTTGGGCACATGTTCTCAGG + Intronic
929111097 2:38405805-38405827 CATCTTGGGCACGTGTTCTCAGG + Intergenic
929211662 2:39364508-39364530 CACTTTGGGCACATGTTCTCAGG - Intronic
930150085 2:48050527-48050549 CAACTTGAGCACGTGTTCTCAGG - Intergenic
930467806 2:51776472-51776494 CATTTTGGGCACATGTTCCCAGG - Intergenic
931068902 2:58622106-58622128 CACCTTGGGCACATGTTCTCAGG - Intergenic
931251477 2:60534609-60534631 CAGTTTGTGAACGTGTTGGCTGG - Intronic
931317005 2:61142405-61142427 CACCTTGGGCACATGTTCTCAGG - Intergenic
931418108 2:62100416-62100438 CACCTTGGGCACATGTTCTCAGG - Intronic
931423043 2:62145410-62145432 CATCTTGGGCACATGTTCTCAGG + Intronic
931541425 2:63333763-63333785 CACTTTGGGCACATGTCCTCAGG + Intronic
931561477 2:63566496-63566518 CACTTTGGGCACATGTTGTCAGG + Intronic
931635059 2:64333306-64333328 CACCTTGGGCACATGTTCTCAGG - Intergenic
932001661 2:67890699-67890721 CAGTTTTATCTTGTGTTCTCTGG - Intergenic
932762954 2:74451541-74451563 CACTTTGGGCACATGTTCTCAGG + Intergenic
932873861 2:75430669-75430691 CCCCTTGGGCACGTGTTCTCAGG - Intergenic
933503209 2:83142927-83142949 GACTTTGAGCACCTGTTCTGAGG - Intergenic
933514504 2:83283638-83283660 CACCTTGGGCACATGTTCTCAGG + Intergenic
933939037 2:87230342-87230364 CACCTTGGGCACATGTTCTCAGG - Intergenic
933999652 2:87697183-87697205 CACTTTGGGCCCATGTTCTCAGG + Intergenic
934537326 2:95145950-95145972 CACCTTGGGCACATGTTCTCAGG + Intronic
934626328 2:95858162-95858184 CACCTTGGGCACATGTTCTCAGG + Intronic
934830275 2:97514033-97514055 CACTTCGGGCACATGTTCTCAGG + Intronic
934940192 2:98495501-98495523 CACCTTGGGCACATGTTCTCAGG - Intronic
935364558 2:102275659-102275681 CACCTTGGGCACATGTTCTCAGG + Intergenic
935889589 2:107661984-107662006 CACCTTGGGCACATGTTCTCAGG - Intergenic
936294201 2:111253709-111253731 CACTTTGGGCCCATGTTCTCAGG - Intergenic
936354096 2:111735433-111735455 CACCTTGGGCACATGTTCTCAGG + Intergenic
936787685 2:116114144-116114166 CACCTTGGGCACATGTTCTCAGG - Intergenic
936871166 2:117135375-117135397 CACCTTGGGCACATGTTCTCAGG - Intergenic
937577558 2:123442488-123442510 CACTTTGAACACGTGTTCTCAGG + Intergenic
937644375 2:124249686-124249708 CACCTTGGGCACATGTTCTCAGG + Intronic
937775358 2:125769511-125769533 CACGTTGGGCACATGTTCTCAGG - Intergenic
938035954 2:128035110-128035132 CACCTTGGGCACATGTTCTCAGG - Intergenic
938875405 2:135527089-135527111 CACCTTGGGCACATGTTCTCAGG + Intronic
939324866 2:140674686-140674708 CACCTTGGGCACGTGTTCTCAGG + Intronic
940018771 2:149134744-149134766 CAGATTGACTACGTGGTCTCAGG - Intronic
940143964 2:150525556-150525578 CACCTTGGGCACATGTTCTCAGG - Intronic
940209890 2:151245499-151245521 CACCTTGGGCACATGTTCTCAGG - Intergenic
940260645 2:151776332-151776354 CACCTTGGGCACATGTTCTCAGG - Intergenic
940486463 2:154302620-154302642 CATCTTGGGCACATGTTCTCTGG - Intronic
941244460 2:163079460-163079482 AAGTTTCAACAGGTGTTCTCTGG - Intergenic
941619583 2:167761384-167761406 CAGGTTGGGCACGTGTTCCTAGG + Intergenic
941863265 2:170307357-170307379 CTGTTTGAGAACCTGTTCTTTGG - Intronic
941908067 2:170736111-170736133 CACATTGGGCACATGTTCTCAGG + Intergenic
942098333 2:172554966-172554988 CCCCTTGGGCACGTGTTCTCAGG + Intergenic
942174438 2:173318474-173318496 CACTTTGGGCACATGTTCTCAGG - Intergenic
942294022 2:174500147-174500169 CACCTTGGGCACATGTTCTCAGG - Intergenic
942358749 2:175148965-175148987 CACCTTGGGCACATGTTCTCAGG + Intronic
943729984 2:191292337-191292359 CATCTTGGGCACATGTTCTCAGG - Intronic
943750120 2:191502149-191502171 CACCTTGGGCACATGTTCTCAGG - Intergenic
944055688 2:195519854-195519876 CACCTTGGGCACATGTTCTCAGG + Intergenic
945114661 2:206399648-206399670 CACCTTGGGCACATGTTCTCAGG - Intergenic
945612752 2:212025693-212025715 CAGTTTGAGTATTTTTTCTCAGG - Intronic
945742518 2:213680747-213680769 CACCTTGAGCACATGTTCTCAGG - Intronic
946089847 2:217211295-217211317 CACCTTGGGCACGTGTTCTCAGG + Intergenic
946584797 2:221172989-221173011 CAGTTTGAGCAGGGTTTGTCAGG - Intergenic
946844485 2:223847336-223847358 CACCTTGGGCACATGTTCTCAGG - Intergenic
946943985 2:224800807-224800829 CACCTTGGGCACATGTTCTCAGG - Intronic
947171798 2:227320072-227320094 CACCTTGGGCACATGTTCTCAGG - Intergenic
947226071 2:227841545-227841567 CACCTTGAGCTCATGTTCTCAGG - Intergenic
947618000 2:231570570-231570592 CATCTTGGGCACATGTTCTCAGG - Intergenic
947711384 2:232318355-232318377 CAGTTTCGCCAAGTGTTCTCTGG + Intronic
947949762 2:234136955-234136977 CACGTTGGGCACATGTTCTCAGG + Intergenic
947996351 2:234531041-234531063 CATCTTGGGCACATGTTCTCAGG + Intergenic
948016384 2:234694195-234694217 CACCTTGGGCACATGTTCTCAGG + Intergenic
948020071 2:234724755-234724777 CACCTTGGGCACATGTTCTCAGG - Intergenic
948021921 2:234740604-234740626 CACCTTGGGCACATGTTCTCAGG + Intergenic
948091043 2:235296003-235296025 CACCTTGGGCATGTGTTCTCAGG - Intergenic
948321147 2:237070836-237070858 CACTTTGGGCCCATGTTCTCAGG + Intergenic
1168747170 20:253541-253563 CACCTTGGGCACATGTTCTCAGG - Intergenic
1168823089 20:790031-790053 CACCTTGGGCACATGTTCTCAGG - Intergenic
1168824870 20:803409-803431 CACCTTAGGCACGTGTTCTCAGG - Intergenic
1168843747 20:927593-927615 CACCTTGGGCACATGTTCTCAGG - Intergenic
1169160776 20:3376548-3376570 CATTTTGGGTACATGTTCTCAGG - Intronic
1169304387 20:4475800-4475822 CACCTTGGGCACATGTTCTCAGG - Intergenic
1170074495 20:12404871-12404893 CACTTTGGGCACATGTTCTCAGG - Intergenic
1170544451 20:17423141-17423163 CACCTTGGGCACCTGTTCTCAGG - Intronic
1170564355 20:17588396-17588418 CACCTTGGGCACATGTTCTCAGG + Intronic
1173746417 20:45440809-45440831 CACCTTGGGCACATGTTCTCAGG - Intergenic
1174143482 20:48433746-48433768 CCCCTTGGGCACGTGTTCTCAGG + Intergenic
1174888635 20:54364393-54364415 CACCTTGAGGACATGTTCTCAGG + Intergenic
1175176080 20:57113036-57113058 CACCTTGGGCACATGTTCTCAGG - Intergenic
1175421733 20:58839208-58839230 CTGTTTGAGCACGTATTGTTTGG + Intergenic
1175586721 20:60146960-60146982 CACCTGGAGCACATGTTCTCTGG - Intergenic
1176703725 21:10093073-10093095 CACCTTGGGCACATGTTCTCAGG - Intergenic
1177255876 21:18662300-18662322 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1177396698 21:20545540-20545562 CACTTTAAGCACTTTTTCTCAGG + Intergenic
1178247438 21:30967594-30967616 CACTTTAGGCACATGTTCTCAGG - Intergenic
1179024641 21:37669328-37669350 CACCTTGGGCACATGTTCTCCGG + Intronic
1179259989 21:39749583-39749605 CACTTTGGGCACATGTTTTCAGG - Intronic
1179423808 21:41256764-41256786 CACCTTGGGCACATGTTCTCCGG + Intronic
1179619379 21:42602752-42602774 CACCTTGGGCACATGTTCTCAGG - Intergenic
1179620030 21:42608071-42608093 TACCTTGGGCACGTGTTCTCAGG - Intergenic
1179783141 21:43715457-43715479 CACCTTGGGCACATGTTCTCAGG + Intergenic
1180128871 21:45812278-45812300 CACTTTGGGCACATGTTCTCAGG - Intronic
1180500596 22:15925703-15925725 CACCTTGGGCACATGTTCTCAGG + Intergenic
1181452389 22:23032406-23032428 CACCTTGGGCACATGTTCTCAGG + Intergenic
1181533400 22:23529846-23529868 CAGGTGGAGCTGGTGTTCTCAGG + Intergenic
1182521337 22:30886125-30886147 CACCTTGGGCACATGTTCTCAGG - Intronic
1183113169 22:35668315-35668337 CACCTGGAGCACATGTTCTCAGG + Exonic
1183637460 22:39073095-39073117 CACCTTGGGCACATGTTCTCAGG - Intronic
1183644584 22:39116840-39116862 CACCTTGGGCACATGTTCTCAGG + Intergenic
1184579473 22:45404801-45404823 CACCTTGGGCACATGTTCTCAGG + Intronic
1184724303 22:46334693-46334715 CAGTTTGAGCACGTGTTCTCAGG - Intronic
1185313462 22:50169305-50169327 TATTTTGAGCCCGTGTTCACAGG - Intergenic
949107776 3:221206-221228 CACCTTGGGCACGTGTTCTCAGG + Intronic
949293535 3:2494210-2494232 CACCTTGGGCATGTGTTCTCCGG - Intronic
949611816 3:5710598-5710620 CACCTTGAGCACATGTTCTCCGG - Intergenic
949699176 3:6736169-6736191 CACCTTGAGCACATGTCCTCAGG - Intergenic
949811405 3:8010937-8010959 CACCTTGGGCACATGTTCTCTGG - Intergenic
950917500 3:16660814-16660836 CACCTTGGGCACATGTTCTCAGG - Intronic
951332591 3:21384427-21384449 CACCTTGGGCACATGTTCTCAGG - Intergenic
951526121 3:23654777-23654799 CGGTTTGAGCACCTGCTCTGTGG + Intergenic
951644195 3:24868956-24868978 CACCTTGGGCACATGTTCTCAGG + Intergenic
951773308 3:26282543-26282565 CACTTTGAGCACATGTTCTCAGG - Intergenic
952107394 3:30086004-30086026 CACCTTGGGCACATGTTCTCAGG + Intergenic
953048510 3:39317486-39317508 CACCTTGGGCACATGTTCTCAGG + Intergenic
953147676 3:40293762-40293784 CACTTTGGGCACATGTTCTCAGG + Intergenic
953422292 3:42763869-42763891 CACCTTGGGCACGTGGTCTCAGG - Intronic
953427358 3:42805782-42805804 CACCTTGGGCACATGTTCTCAGG - Intronic
953439435 3:42905599-42905621 CACGTTGGGCACATGTTCTCAGG + Intronic
953453994 3:43027883-43027905 TAGTCTGATCACCTGTTCTCAGG - Intronic
954067045 3:48115148-48115170 CACCTTGGGCACATGTTCTCAGG + Intergenic
954604259 3:51896436-51896458 CACCTTGGGCACATGTTCTCAGG + Intronic
954823375 3:53350159-53350181 CACCTTGGGCACATGTTCTCAGG - Intergenic
955612977 3:60777226-60777248 CACCTTGGGCACATGTTCTCAGG - Intronic
956708732 3:72022011-72022033 CACCTTGGGCACATGTTCTCTGG + Intergenic
956716021 3:72080724-72080746 CACCTTGGGCACATGTTCTCAGG - Intergenic
957299679 3:78375864-78375886 CACTTTGGGAACATGTTCTCAGG - Intergenic
957600233 3:82324368-82324390 CACCTTGGGCACATGTTCTCAGG + Intergenic
957724490 3:84046620-84046642 GAGTTTCAACACGTGGTCTCTGG - Intergenic
957965194 3:87313235-87313257 CACCTTGGGCACATGTTCTCAGG - Intergenic
958482898 3:94666928-94666950 CACCTTGAGCACGTGTCATCAGG - Intergenic
958566449 3:95817283-95817305 CATCTTGAGCACATGTTCTCAGG + Intergenic
959062717 3:101630659-101630681 CACCTTGGGCACATGTTCTCAGG + Intergenic
959405976 3:105962131-105962153 CACCTTGGGCACATGTTCTCAGG + Intergenic
960295414 3:115937127-115937149 CAGATAGAGCACATGTTTTCAGG - Intronic
960723820 3:120650348-120650370 CACCTTGGGCACATGTTCTCAGG + Intronic
961470934 3:127111784-127111806 CACCTTGGGCACATGTTCTCAGG + Intergenic
961790932 3:129376330-129376352 CACCTTGGGCACATGTTCTCAGG - Intergenic
961794333 3:129398778-129398800 CACCTTGGGCACATGTTCTCAGG + Intergenic
961800709 3:129446696-129446718 CACCTTGGGCACATGTTCTCAGG + Intronic
962749171 3:138420624-138420646 CACATTGGGCACATGTTCTCAGG - Intergenic
963637528 3:147817483-147817505 CAGTTTCAGCACTTGTTTCCTGG + Intergenic
963669297 3:148231722-148231744 CACCTTGGGCACATGTTCTCAGG - Intergenic
963760310 3:149281569-149281591 CACCTTGGGCACATGTTCTCAGG - Intergenic
964276173 3:155011153-155011175 CACTTTGGGCACATTTTCTCAGG - Intergenic
964458713 3:156897404-156897426 CACCTTGAGCACATGTTCTCAGG - Intronic
965278861 3:166722860-166722882 CACGTTGAGCACATGTTGTCAGG + Intergenic
965556600 3:170024847-170024869 CACCTTGGGCACATGTTCTCAGG + Intergenic
965586006 3:170319018-170319040 GAGTTTCAACACGTGGTCTCTGG + Intergenic
965588620 3:170341929-170341951 GAGTTTCAACACGTGGTCTCTGG + Intergenic
966135937 3:176698191-176698213 CAGTTTGAGAAGCTGTTCTATGG - Intergenic
966537558 3:181051485-181051507 CACTTTGGGCACATGTTCTCAGG - Intergenic
966642594 3:182207168-182207190 CAGTTTTAGAATGTTTTCTCTGG - Intergenic
967636359 3:191806562-191806584 CACTTTGGGCACATGTTCCCAGG + Intergenic
967748312 3:193084229-193084251 CACTTTGGACACATGTTCTCAGG - Intergenic
967991785 3:195136938-195136960 CAGTTTGAGAACCTGTTTTCTGG - Intronic
969346393 4:6573249-6573271 CACCTTGGGCACCTGTTCTCAGG + Intergenic
969420209 4:7089995-7090017 GAGTTTCAACACGTGGTCTCTGG + Intergenic
969653384 4:8481362-8481384 CACCTTGGGCACATGTTCTCAGG + Intronic
969960990 4:10944732-10944754 CACCTTGGGCACATGTTCTCAGG - Intergenic
970243991 4:14039605-14039627 CATCTTGGGCACATGTTCTCAGG - Intergenic
970359628 4:15295926-15295948 CAGTTTAAGGATGGGTTCTCTGG + Intergenic
970470679 4:16376333-16376355 CACGTTGGGCACATGTTCTCAGG - Intergenic
970740360 4:19230148-19230170 CACCTAGAGCACATGTTCTCAGG + Intergenic
970878790 4:20903704-20903726 CACCTTGGGCACATGTTCTCAGG + Intronic
971713597 4:30148361-30148383 CACCTTGGGCACATGTTCTCAGG + Intergenic
971719380 4:30226067-30226089 CACTTTGGGTACATGTTCTCAGG + Intergenic
971851626 4:31992530-31992552 CAACTTGTGCACATGTTCTCAGG - Intergenic
971975484 4:33680697-33680719 CACGTTGGGCACATGTTCTCAGG + Intergenic
972303262 4:37806305-37806327 CACCTTGGGCACATGTTCTCAGG + Intergenic
972322931 4:37989472-37989494 CACCTTGAGCACGTGTTCTCAGG + Intronic
972989361 4:44804541-44804563 CAGTTTGAGCTCTGTTTCTCTGG + Intergenic
973336925 4:48966032-48966054 CACCTTGAGCACATGTTCTCAGG + Intergenic
974460071 4:62175996-62176018 CAACTTGGGCACATGTTCTCAGG - Intergenic
974594928 4:64002157-64002179 CACTCTGAGCACATGTTCTCAGG - Intergenic
974935364 4:68404589-68404611 CACCTTGGGCACATGTTCTCAGG + Intergenic
975059768 4:69983532-69983554 CACCTTGGGCACGTATTCTCAGG - Intergenic
975346401 4:73296931-73296953 CAGCTTAGGCACATGTTCTCGGG + Intergenic
975614889 4:76236526-76236548 CACCTTGGGCACATGTTCTCAGG - Intronic
975797594 4:78025467-78025489 CACCTTGGGCACATGTTCTCAGG - Intergenic
976011263 4:80492247-80492269 CACCTTGGGCACGTGTTCTCAGG + Intronic
976112039 4:81685911-81685933 CACCTTGGGCACATGTTCTCAGG - Intronic
976507669 4:85868022-85868044 CACTTTGAGCACATGTTCTTAGG - Intronic
976696106 4:87921284-87921306 CACCTTGGGCACATGTTCTCAGG + Intergenic
976738172 4:88332082-88332104 CACCTTGGGCACGTGTTCTCAGG - Intergenic
976740280 4:88349392-88349414 CACTTTGGGCATGTGTTGTCAGG - Intergenic
977345513 4:95811712-95811734 CACCTTGGGCACATGTTCTCAGG + Intergenic
977525541 4:98141684-98141706 CACCTTGGGCACATGTTCTCAGG + Intronic
977578414 4:98699168-98699190 CACCTTGGGCACATGTTCTCAGG + Intergenic
977985235 4:103375274-103375296 CACCTTGGGCACATGTTCTCAGG + Intergenic
978575272 4:110183452-110183474 CACCTTGTGCACATGTTCTCAGG + Intronic
980052783 4:128054870-128054892 CATCTTGGGCACATGTTCTCAGG - Intergenic
980081809 4:128351955-128351977 CACTTTGGGCACATGTTCTCAGG + Intergenic
980279354 4:130699524-130699546 CATCTTGGGCACATGTTCTCAGG - Intergenic
980375943 4:131949426-131949448 CACCTTGGGCACATGTTCTCAGG - Intergenic
980777037 4:137451088-137451110 CACCTTGGGCACATGTTCTCAGG - Intergenic
980984953 4:139686027-139686049 CAAACTGGGCACGTGTTCTCAGG - Intronic
981805925 4:148715151-148715173 CACCTTGGGCACATGTTCTCAGG - Intergenic
981903233 4:149890870-149890892 CACCTTGAGCACATGTTCTCAGG - Intergenic
982391721 4:154871913-154871935 CACCTTGGGCACATGTTCTCAGG - Intergenic
982490132 4:156019936-156019958 CAGCTTGGGCACATGTTGTCAGG - Intergenic
983863753 4:172738695-172738717 CACCTTGGGCACGTGTTCTCAGG - Intronic
984049106 4:174841846-174841868 CACCTTGCGCACATGTTCTCAGG - Intronic
984093233 4:175401887-175401909 CACTTTGGGCACATGTTGTCAGG + Intergenic
984166108 4:176304805-176304827 CACCTTGGGCACGTGTCCTCAGG + Intergenic
984364485 4:178781083-178781105 CACCTTGGGCACATGTTCTCAGG - Intergenic
985003596 4:185510686-185510708 CAGTTCAAACCCGTGTTCTCAGG + Intronic
986646930 5:9925872-9925894 CACCTTGGGCACTTGTTCTCAGG + Intergenic
986689603 5:10303303-10303325 CACCTTGGGCACATGTTCTCAGG + Intronic
986893044 5:12332348-12332370 CACTTTGGGCACGTGTTCTCAGG - Intergenic
987166274 5:15201800-15201822 GAGTTTCAACACGTGGTCTCTGG + Intergenic
987265753 5:16253342-16253364 CACTTTGGGCACATGTTCTCAGG - Intergenic
987462879 5:18235011-18235033 CACCTTGGGCACATGTTCTCAGG - Intergenic
987486703 5:18534936-18534958 CAACTTGGGCACATGTTCTCAGG + Intergenic
987586194 5:19859808-19859830 CACCTTGGGCACATGTTCTCAGG + Intronic
987680439 5:21129653-21129675 CACCTTGAGCACATGTTCTCAGG - Intergenic
987965202 5:24863857-24863879 CAACTTGGGCACATGTTCTCAGG - Intergenic
988040571 5:25883994-25884016 CACTTTGGTCACATGTTCTCAGG + Intergenic
988183731 5:27833552-27833574 CACTTTGGGCACATGTTCTCAGG - Intergenic
988314085 5:29601499-29601521 CACCTTGGGCACATGTTCTCAGG + Intergenic
988637791 5:33005862-33005884 CACCTTGGGCACATGTTCTCAGG + Intergenic
988927510 5:36004375-36004397 CACCTTGGGCACATGTTCTCAGG + Intergenic
989319292 5:40116595-40116617 CACCTTGGGCACATGTTCTCAGG - Intergenic
989320953 5:40133060-40133082 CACCGTGAGCACATGTTCTCAGG - Intergenic
989477544 5:41891459-41891481 CACCTTGGGCACATGTTCTCAGG + Intergenic
989541614 5:42625520-42625542 CACCTTGGGCACATGTTCTCAGG - Intronic
989830171 5:45907118-45907140 CACTTTAGGCACATGTTCTCAGG - Intergenic
990186219 5:53212690-53212712 CACCTTGGGCACATGTTCTCAGG - Intergenic
990614165 5:57490159-57490181 CACTTTGGGAACATGTTCTCAGG - Intergenic
991082866 5:62620142-62620164 CACCTTGGGCACATGTTCTCAGG - Intronic
991234634 5:64379367-64379389 CACCTTGAGCACATGTTCTCAGG + Intergenic
991255317 5:64607349-64607371 CACCTTGGGCACATGTTCTCAGG - Intronic
991424781 5:66479189-66479211 CACCTTGGGCACATGTTCTCAGG + Intergenic
991644834 5:68791410-68791432 CACATTGGGCACATGTTCTCAGG - Intergenic
992291675 5:75285811-75285833 CAGTTTGGGCGCATGTTGTCAGG + Intergenic
992453482 5:76894363-76894385 CACCTTGGGCACATGTTCTCAGG + Intronic
992542760 5:77780644-77780666 CACCTTGGGCACATGTTCTCAGG + Intronic
993652818 5:90542700-90542722 AATTCTGGGCACGTGTTCTCAGG - Intronic
993983751 5:94572988-94573010 CACCTTGGGCACATGTTCTCAGG - Intronic
994198358 5:96944359-96944381 CATGTTGGGCACATGTTCTCAGG - Intronic
994641266 5:102412283-102412305 CACCTTGAGCACACGTTCTCAGG + Intronic
995105176 5:108369391-108369413 CACCTTGGGCACATGTTCTCAGG + Intronic
995285722 5:110386081-110386103 CACTTTGGGCACATGTTCTCAGG + Intronic
995325163 5:110881762-110881784 GAGTTTCAGCATGTGTTCTCTGG - Intergenic
995477391 5:112561988-112562010 CACCTTGGGCACATGTTCTCAGG + Intergenic
995741305 5:115358716-115358738 CACCTTGGGCACATGTTCTCAGG + Intergenic
995823331 5:116263871-116263893 CACCTTGGGCACATGTTCTCAGG + Intronic
996708272 5:126519002-126519024 CACCTTGGGCACATGTTCTCAGG + Intergenic
996964706 5:129294222-129294244 CACCTTGGGCACATGTTCTCAGG - Intergenic
997077646 5:130699267-130699289 TAGTTTTTGCATGTGTTCTCTGG - Intergenic
997258102 5:132444611-132444633 CACTTTGGGTACATGTTCTCAGG - Intronic
998066831 5:139166035-139166057 CACCTTGGGCACATGTTCTCAGG + Intronic
998262017 5:140638930-140638952 CACCTTGGGCACATGTTCTCAGG + Intronic
999870078 5:155740939-155740961 CACTTTGGGCACATGTTCTCAGG - Intergenic
999929483 5:156415437-156415459 AGATTTGAGCACGTGGTCTCAGG + Intronic
999956667 5:156710495-156710517 CACCTTGGGCACGTGTTCTCAGG - Intronic
1000104767 5:158048962-158048984 CACTTTGAGAAGGTTTTCTCAGG + Intergenic
1001696664 5:173675349-173675371 CAGTTTGAGGCCATTTTCTCTGG - Intergenic
1002090474 5:176802654-176802676 CAGTATGAGGGTGTGTTCTCAGG + Intergenic
1002371843 5:178761132-178761154 CACTTTGGGCACAGGTTCTCAGG - Intergenic
1002676520 5:180918628-180918650 CACCTTGGGCACATGTTCTCAGG - Intronic
1002870018 6:1158176-1158198 CACCTTGGGCACATGTTCTCAGG + Intergenic
1002994570 6:2270711-2270733 CACCTTGGGCACATGTTCTCAGG - Intergenic
1003068025 6:2919839-2919861 CACCTTGGGCACGTGTTCTCAGG - Intergenic
1003070451 6:2941483-2941505 CACCTTGGGCACGTGTTCTCAGG - Intergenic
1003075162 6:2977262-2977284 CACCTTAGGCACGTGTTCTCAGG - Intergenic
1003195839 6:3913802-3913824 CACCTTGGGCACGTGTTCTCAGG - Intergenic
1003202399 6:3973931-3973953 CACCTTGGGCACATGTTCTCAGG + Intergenic
1003321407 6:5055283-5055305 CACCTTGGGCACATGTTCTCAGG + Intergenic
1003560473 6:7175730-7175752 AAGTTTGAGCAAGTCTGCTCTGG - Intronic
1003844523 6:10159163-10159185 CAGTGTGGACAGGTGTTCTCTGG + Intronic
1004433522 6:15567716-15567738 CACTTTGGGCACATGTCCTCAGG + Intronic
1004604863 6:17184626-17184648 CACCTTGGGCACATGTTCTCAGG - Intergenic
1005331817 6:24758033-24758055 CACCTTGGGCACATGTTCTCAGG - Intergenic
1005449194 6:25956539-25956561 CACCTTGAGCGCTTGTTCTCAGG - Intergenic
1005600279 6:27419876-27419898 CAGTTTTAGCAGGAGTTTTCTGG - Intergenic
1005652841 6:27900341-27900363 CACCTTGGGCACGTGTTCTTAGG + Intergenic
1005784935 6:29235286-29235308 CACCTTGGGCACTTGTTCTCAGG - Intergenic
1005820757 6:29596762-29596784 CACCTTGGGCACATGTTCTCAGG + Intronic
1006042090 6:31264913-31264935 CACATTGAGTACATGTTCTCAGG - Intergenic
1006051636 6:31349777-31349799 CACCTTGAGCACATGTTCTCAGG - Intronic
1006393948 6:33774850-33774872 CAGCTGGAGCATTTGTTCTCAGG - Intronic
1006413678 6:33890969-33890991 CACCTTGAACACATGTTCTCAGG + Intergenic
1006993695 6:38238231-38238253 CACCTTGAGCACTTGTTCTCAGG - Intronic
1007311458 6:40949540-40949562 CACCTTGGGCACATGTTCTCAGG + Intergenic
1007337490 6:41163918-41163940 CAGTGTGAGCATGTGTGCACAGG - Intergenic
1007881172 6:45168472-45168494 CACCTTGGGCACATGTTCTCAGG + Intronic
1008226552 6:48925368-48925390 CATCTTGAGCACATGTTCTCAGG + Intergenic
1008464265 6:51813107-51813129 CACCTTGAGCACAAGTTCTCAGG + Intronic
1008650287 6:53554145-53554167 CACCTTGGGCACATGTTCTCAGG + Intronic
1009511365 6:64553106-64553128 CACCTTGGGCACATGTTCTCAGG + Intronic
1009523301 6:64712020-64712042 CAGATTGAGAACTTGTCCTCTGG - Intronic
1009750798 6:67877248-67877270 CAGCATGAGCACATGTTCTCAGG - Intergenic
1011121284 6:83956236-83956258 CACCTTGGGCACATGTTCTCAGG - Intronic
1011363451 6:86552905-86552927 CACCTTGGGCACATGTTCTCAGG + Intergenic
1011434219 6:87320561-87320583 CACCTTGGGCACATGTTCTCAGG - Intronic
1012227276 6:96718497-96718519 CACCTTGGGCACATGTTCTCAGG + Intergenic
1012249158 6:96960679-96960701 CACCTTGGGCACATGTTCTCAGG - Intronic
1012395387 6:98790603-98790625 CAGTTTGAGGCTGTATTCTCCGG - Intergenic
1012650153 6:101742487-101742509 CACCTTGAGGACGTGTTCTCAGG - Intronic
1013211256 6:107988941-107988963 CACCTTGGGCACATGTTCTCAGG + Intergenic
1013412673 6:109895784-109895806 CATCTTGGGCACATGTTCTCAGG - Intergenic
1014159918 6:118156329-118156351 CACCTTGGGCACATGTTCTCAGG - Intronic
1014200835 6:118607218-118607240 GAGTTTCAACACGTGGTCTCTGG + Intronic
1014252536 6:119129239-119129261 CACTTTGAGCACATGTTCTCAGG + Intronic
1014315967 6:119864959-119864981 CACCTTGGGCACATGTTCTCAGG + Intergenic
1014442953 6:121494351-121494373 CACCTTGGGCACATGTTCTCAGG + Intergenic
1014816328 6:125939614-125939636 CACCTTGGGCACATGTTCTCAGG + Intergenic
1014931148 6:127337602-127337624 CACCTTGGGCACATGTTCTCAGG + Intronic
1015704043 6:136068153-136068175 CACCTTGGGCACATGTTCTCAGG - Intronic
1016374018 6:143402204-143402226 CACCTTGAACACATGTTCTCAGG - Intergenic
1016521556 6:144952207-144952229 CACTTGGGGCACATGTTCTCAGG + Intergenic
1016557866 6:145359957-145359979 CACCTTGGGCACATGTTCTCAGG - Intergenic
1016602466 6:145877987-145878009 CACCTTGGGCACATGTTCTCAGG + Intronic
1016681142 6:146830600-146830622 AACCTTGGGCACGTGTTCTCAGG + Intergenic
1016854264 6:148650768-148650790 CATCTTGGGCACATGTTCTCAGG - Intergenic
1016871088 6:148817428-148817450 CACCTTGGGCACGTGTTCTCAGG - Intronic
1016964951 6:149710203-149710225 CACCTTGGGCACATGTTCTCAGG + Intronic
1017349085 6:153418727-153418749 CACCTTGAGCACATGTTCTCAGG - Intergenic
1017404869 6:154108302-154108324 CAGTTTCAACACGTGCTCTCTGG + Intronic
1017778530 6:157698423-157698445 CACCTTGGGCACATGTTCTCAGG - Intergenic
1017863395 6:158420979-158421001 CACTTTGGGCACATGTTCTCAGG - Intronic
1018076121 6:160215121-160215143 CACCTTGGGCACATGTTCTCAGG + Intronic
1018454119 6:163937062-163937084 CACCTTGGGCACATGTTCTCAGG + Intergenic
1018561297 6:165103284-165103306 CACCTTGGGCACATGTTCTCGGG - Intergenic
1018807479 6:167272515-167272537 CACCTTGGGCACATGTTCTCAGG - Intronic
1018808848 6:167282733-167282755 CACCTTGGGCACATGTTCTCAGG - Intronic
1018992042 6:168681613-168681635 CACTTTGGACACATGTTCTCAGG + Intergenic
1019030335 6:169004645-169004667 CACCTTGGGCACATGTTCTCAGG + Intergenic
1019063008 6:169270527-169270549 CACCTTGGGCACATGTTCTCAGG + Intergenic
1019099703 6:169619470-169619492 CACTTTGGGCACATGTTCTGAGG - Intronic
1019151472 6:170008852-170008874 CACCTTGGGCACGTGTTCTCAGG - Intergenic
1019823173 7:3261364-3261386 CAGGTTGAGCACATGTCATCAGG - Intergenic
1020340953 7:7110535-7110557 CACCTTGAGCACATGTTGTCAGG + Intergenic
1020794759 7:12665975-12665997 CACCTTGGGCACATGTTCTCAGG - Intergenic
1020808479 7:12821285-12821307 CACCTTGGGCACATGTTCTCAGG + Intergenic
1020851257 7:13356205-13356227 CACCTTGGGCACATGTTCTCAGG + Intergenic
1021099857 7:16575171-16575193 CACCTTGGGCACATGTTCTCAGG + Intronic
1021102047 7:16595493-16595515 CACCTTGGGCACGTGGTCTCAGG - Intergenic
1021387669 7:20051565-20051587 CACCTTGGGCACATGTTCTCAGG + Intergenic
1021673603 7:23058177-23058199 CACCTTGGGCACGTGTACTCAGG + Intergenic
1021738684 7:23663769-23663791 CATCTTGGGCACATGTTCTCAGG + Intergenic
1021788057 7:24172436-24172458 CACTTTGGGCACATGTTCTCAGG + Intergenic
1021978291 7:26030282-26030304 CACTTTGGGCACATGTTCTCAGG - Intergenic
1022985406 7:35649513-35649535 CACCTTGGGCACATGTTCTCAGG - Intronic
1023391918 7:39719008-39719030 CACCTTGGGCACATGTTCTCAGG - Intergenic
1023411681 7:39894426-39894448 CACTTTGGGCACATGTTCTCAGG + Intergenic
1023667543 7:42540569-42540591 CACCTTGGGCACATGTTCTCAGG - Intergenic
1024160677 7:46671875-46671897 CACCTTGAGTACATGTTCTCAGG + Intergenic
1024388365 7:48779542-48779564 CAGCTTGGCCACATGTTCTCAGG - Intergenic
1024821117 7:53330886-53330908 CACCTTGAGCAGGTTTTCTCAGG - Intergenic
1024928741 7:54646839-54646861 CACTTTGGACACATGTTCTCAGG - Intergenic
1025005365 7:55350070-55350092 CACCTTGGGCACATGTTCTCAGG + Intergenic
1026143159 7:67723384-67723406 CACCTTGGGCACATGTTCTCAGG + Intergenic
1026308714 7:69165957-69165979 CACCTTGAGCCCATGTTCTCAGG - Intergenic
1026496617 7:70909123-70909145 CAGCTTGGGCACATGTTCTCAGG - Intergenic
1026538054 7:71256629-71256651 CACCTTGCGCACGTGTTCTCAGG + Intronic
1026606484 7:71820392-71820414 CACCTTGGGCACATGTTCTCAGG + Intronic
1027517868 7:79164819-79164841 CATCTTGGGCACATGTTCTCAGG + Intronic
1028914398 7:96242866-96242888 CACCTTGGGCACATGTTCTCAGG + Intronic
1029885526 7:103866370-103866392 CAGTTTGAGGACTTGCTTTCGGG + Intronic
1030118118 7:106079180-106079202 CACCTTGGGCACATGTTCTCAGG + Intergenic
1030467194 7:109917862-109917884 CAGTTTGAGCAAGTATAATCAGG + Intergenic
1030495130 7:110289153-110289175 CACCTTGGGCACATGTTCTCAGG + Intergenic
1031534599 7:122917474-122917496 CACCTTGGGCACATGTTCTCAGG + Intergenic
1032420352 7:131774387-131774409 CACTTTGGGCACATGTTCTCAGG + Intergenic
1032612138 7:133426005-133426027 CACCTTGGGCACGTGTTCTCAGG + Intronic
1033610402 7:142959075-142959097 CACCTTGGGCACATGTTCTCAGG + Intronic
1033626956 7:143119723-143119745 CACTTTGGGCACATGTTCTCAGG - Intergenic
1033635383 7:143207245-143207267 CACTTTGGGCATATGTTCTCAGG - Intergenic
1033942804 7:146677037-146677059 CACCTTGGGCACATGTTCTCAGG - Intronic
1034060833 7:148087096-148087118 TAGTTCGGGCACGTGTTCTGAGG - Intronic
1035449548 7:158967576-158967598 CACCTTGGGCACATGTTCTCAGG - Intergenic
1035810979 8:2490962-2490984 CACCTTGGGCACATGTTCTCAGG - Intergenic
1035835132 8:2741898-2741920 CATCTTGGGCACATGTTCTCAGG + Intergenic
1036057979 8:5281024-5281046 CACCTTGGGCACATGTTCTCAGG + Intergenic
1036455626 8:8904170-8904192 CACCTAGGGCACGTGTTCTCAGG + Intergenic
1036525343 8:9529534-9529556 CACCTTGGGCACATGTTCTCAGG + Intergenic
1036595477 8:10207962-10207984 TAGTTTTAGCAAGTGTTCTCAGG + Intronic
1036636718 8:10555835-10555857 CACCTTGGGCACATGTTCTCAGG + Intergenic
1037413079 8:18618344-18618366 CACCTTGGGCACATGTTCTCAGG + Intronic
1037613162 8:20493594-20493616 CAGTTTGAGCGACTGTGCTCAGG - Intergenic
1037653143 8:20858796-20858818 CACTTTGAGTACTTCTTCTCTGG - Intergenic
1038739120 8:30201181-30201203 CACCTTGGGCACATGTTCTCAGG + Intergenic
1038988543 8:32840583-32840605 CACCTTGGGCACATGTTCTCAGG - Intergenic
1039220002 8:35320079-35320101 CACCTTGGGCACATGTTCTCAGG - Intronic
1039354346 8:36798847-36798869 CACCTTGGGCACATGTTCTCAGG + Intronic
1039757422 8:40538455-40538477 CACCTTAAGCACATGTTCTCAGG + Intronic
1039761684 8:40583657-40583679 CACTTTGGGCACATGTCCTCAGG - Intronic
1039799339 8:40940750-40940772 TACCTTGGGCACGTGTTCTCAGG - Intergenic
1039813662 8:41072862-41072884 CACCTTGGGCACATGTTCTCAGG - Intergenic
1040664644 8:49618459-49618481 CACCTTGGGCACATGTTCTCAGG + Intergenic
1040838890 8:51762733-51762755 CACCTTGGGCACATGTTCTCAGG + Intronic
1040853140 8:51922894-51922916 CACCTTGGGCACATGTTCTCAGG - Intergenic
1040921891 8:52629936-52629958 CACCTTGGGCACATGTTCTCAGG + Intronic
1040997932 8:53420539-53420561 CACCTTGGGCACATGTTCTCAGG + Intergenic
1041177506 8:55211870-55211892 CACCTTGGGCACATGTTCTCAGG - Intronic
1041364441 8:57086548-57086570 CATTTTGGGCACATGTTGTCAGG - Intergenic
1041609372 8:59826705-59826727 CACCTTGGGCACATGTTCTCAGG + Intergenic
1041741980 8:61165734-61165756 CACCTTGGGCACATGTTCTCAGG + Intronic
1041805386 8:61843729-61843751 CACCTTGGGCACATGTTCTCAGG + Intergenic
1042184504 8:66123333-66123355 CACCTTGGGCACCTGTTCTCGGG + Intergenic
1042520051 8:69701758-69701780 CACCTTGGGCACATGTTCTCAGG + Intronic
1043222933 8:77689283-77689305 CACCTTGGGCACATGTTCTCAGG + Intergenic
1043535336 8:81196949-81196971 CACCTTGGGCACATGTTCTCAGG + Intergenic
1043740784 8:83808780-83808802 CACCTTGGGCACATGTTCTCAGG + Intergenic
1044019248 8:87083967-87083989 CACCTTGGGCACATGTTCTCAGG + Intronic
1044083133 8:87909407-87909429 CTGTTTGGGCACATGTTCTCAGG + Intergenic
1045099829 8:98833071-98833093 CACCTTGGGCACGTATTCTCAGG - Intronic
1045556987 8:103224285-103224307 CACCTTGGGCACATGTTCTCGGG - Intronic
1045579473 8:103462983-103463005 CACCTTGGGCACATGTTCTCAGG - Intergenic
1045877701 8:107001421-107001443 CATCTTGGGCACATGTTCTCAGG - Intergenic
1047522457 8:125605585-125605607 CATCTTGGGCACATGTTCTCAGG - Intergenic
1048383287 8:133887755-133887777 TAGTTTGAGAACATGTTCTGAGG - Intergenic
1048655989 8:136536389-136536411 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1048777935 8:137968089-137968111 CACCTTGCGCACATGTTCTCAGG + Intergenic
1048800635 8:138190991-138191013 CACCTTGGGCACGTGTTCTCAGG + Intronic
1048892888 8:138963649-138963671 CACCTTGAGCACGTGTCGTCAGG - Intergenic
1049454367 8:142679506-142679528 CACCTTGGGCACATGTTCTCAGG - Intronic
1049467660 8:142759509-142759531 CACCTTGGGCACATGTTCTCAGG + Intergenic
1049964392 9:765335-765357 CACTTTGGGCACATGTTTTCAGG + Intergenic
1050060748 9:1707177-1707199 CATCTTGGGCACATGTTCTCAGG + Intergenic
1050495767 9:6240201-6240223 CACTTTGAGCACATGTTCTCAGG - Intronic
1050657779 9:7847951-7847973 GAGTTTCAACACGTGGTCTCTGG - Intronic
1050797407 9:9561367-9561389 CAGTGTGGGCACATGTTCTCAGG + Intronic
1051050560 9:12927559-12927581 CACGTTGGGCACATGTTCTCAGG + Intergenic
1051065701 9:13099671-13099693 CACCTTGGGCACATGTTCTCAGG + Intergenic
1051626682 9:19105503-19105525 CATCTTGGGCACATGTTCTCAGG - Intergenic
1052176981 9:25473940-25473962 CACCTTGGGCACATGTTCTCAGG + Intergenic
1052180493 9:25520143-25520165 CACCTTGGGCACCTGTTCTCAGG + Intergenic
1053076248 9:35137257-35137279 GAGTTTCAACACGTGGTCTCTGG + Intergenic
1053640992 9:40080093-40080115 CACCTTGGGCACATGTTCTCAGG - Intergenic
1053765144 9:41385375-41385397 CACCTTGGGCACATGTTCTCAGG + Intergenic
1054321736 9:63676389-63676411 CACCTTGGGCACATGTTCTCAGG - Intergenic
1054543760 9:66296537-66296559 CACCTTGGGCACATGTTCTCAGG + Intergenic
1054711008 9:68510714-68510736 CACCTTGGGCACATGTTCTCAGG - Intronic
1054858021 9:69922100-69922122 CACCTTGGGCACATGTTCTCAGG + Intergenic
1055013853 9:71595048-71595070 CCACTTGAGCACATGTTCTCAGG + Intergenic
1055164671 9:73176503-73176525 AAGTTTCAACACGTGGTCTCTGG - Intergenic
1055449480 9:76418006-76418028 CACCTTGGGCACATGTTCTCAGG - Intergenic
1055708613 9:79035171-79035193 CAGCTTTGGCACATGTTCTCAGG - Intergenic
1055776796 9:79775133-79775155 CACCTTGGGCACATGTTCTCTGG - Intergenic
1056705353 9:88947904-88947926 GAGTTTTTGCACATGTTCTCAGG + Intergenic
1056876059 9:90331784-90331806 CACCTTGGGCACATGTTCTCAGG + Intergenic
1056902052 9:90608966-90608988 CACCTTGGGCACATGTTCTCAGG - Intergenic
1056921230 9:90790985-90791007 CACCTTGGGCACATGTTCTCAGG - Intergenic
1057943991 9:99308781-99308803 CACCTTGGGCACATGTTCTCAGG + Intergenic
1058125460 9:101189109-101189131 CACTTTGAGCACATGTTCTGAGG - Intronic
1058531861 9:105913920-105913942 TACCTTGGGCACGTGTTCTCAGG + Intergenic
1059408115 9:114114812-114114834 CACCTTGGGCCCGTGTTCTCAGG - Intergenic
1059546681 9:115183036-115183058 CATTTTGGGCACATGTTCTCAGG - Intronic
1059963815 9:119593768-119593790 CAGAAAGAGCATGTGTTCTCAGG + Intergenic
1060057361 9:120426289-120426311 CACTTTGGGCACATGTTCTCAGG - Intronic
1060980626 9:127789523-127789545 GAGTTTGAGCGCGTCTTCTGAGG + Exonic
1061736989 9:132668534-132668556 CACCTTGGGCACATGTTCTCAGG - Intronic
1061742694 9:132718685-132718707 CACCTGGAGCACATGTTCTCAGG + Intergenic
1062202985 9:135317155-135317177 CACCTTGGGCACGTGTTGTCAGG + Intergenic
1202788762 9_KI270719v1_random:63168-63190 CACCTTGGGCACATGTTCTCAGG - Intergenic
1185590773 X:1275475-1275497 CAGCTTGGATACGTGTTCTCAGG - Intronic
1185788758 X:2912472-2912494 CACCTTGAGTACATGTTCTCAGG + Intronic
1185803969 X:3040098-3040120 CACCTTGGGCACTTGTTCTCAGG + Intergenic
1185849524 X:3472602-3472624 CACCTTGGGCACATGTTCTCAGG - Intergenic
1185852220 X:3499816-3499838 CACTTTGTGCACATGTTGTCAGG - Intergenic
1185894403 X:3844514-3844536 CACCTTGGGCACATGTTCTCAGG + Intergenic
1185899521 X:3882938-3882960 CACCTTGGGCACATGTTCTCAGG + Intergenic
1185904637 X:3921367-3921389 CACCTTGGGCACATGTTCTCAGG + Intergenic
1185951918 X:4446748-4446770 CACCTTGGGCATGTGTTCTCAGG + Intergenic
1185983384 X:4804262-4804284 CATTTTGGGCACATGTTCTCAGG - Intergenic
1186328477 X:8506731-8506753 CACCTTGGGCACATGTTCTCAGG - Intergenic
1186329764 X:8519475-8519497 CACCTTGGGCACGTGTTCTCAGG + Intergenic
1186691168 X:11977580-11977602 CACCTTGGGCACATGTTCTCAGG - Intergenic
1187057176 X:15752070-15752092 CACCTTGGGCATGTGTTCTCAGG - Intronic
1187057303 X:15753115-15753137 CACCATGAGCACATGTTCTCAGG + Intronic
1187125039 X:16446888-16446910 CACCTTGGGCACATGTTCTCAGG + Intergenic
1187324655 X:18275162-18275184 CACCTTGGGCACATGTTCTCAGG + Intronic
1187388169 X:18867244-18867266 CACCTTGGGCACATGTTCTCAGG + Intergenic
1187806790 X:23129340-23129362 CACCTTGGGCACGTGTCCTCAGG + Intergenic
1188074162 X:25754871-25754893 CGATTTGGGCACATGTTCTCAGG + Intergenic
1188390320 X:29611532-29611554 CACCTTGGGCACATGTTCTCAGG + Intronic
1188401861 X:29755389-29755411 TAATTTGAGCAGGTGTTGTCAGG - Intronic
1188876068 X:35431605-35431627 CACCTTGGGCACATGTTCTCAGG - Intergenic
1188876780 X:35440433-35440455 CACTTTGAACACATGTTCTTAGG + Intergenic
1188902710 X:35753709-35753731 CATCTTGGGCACATGTTCTCAGG - Intergenic
1188916778 X:35920718-35920740 CAGTATGATCACATTTTCTCAGG + Intronic
1188939561 X:36219874-36219896 CACCTTGAGCACATGTTGTCAGG + Intergenic
1189186546 X:39060133-39060155 CAATGTGAGCAAGTGTTCTATGG - Intergenic
1190408278 X:50109575-50109597 CACCTTGAGCACATGTTGTCAGG + Intergenic
1190408752 X:50113935-50113957 CACCTTGGGCACATGTTCTCTGG - Intergenic
1190498270 X:51048877-51048899 CACCTTGGGCACATGTTCTCAGG - Intergenic
1190569822 X:51769802-51769824 CACCTTGAGCACATGTTCTTAGG + Intergenic
1190951820 X:55153159-55153181 CACCTTGAGCACATGTTGTCAGG + Intronic
1190962673 X:55267769-55267791 GAGTTTCAACACGTGGTCTCTGG - Intronic
1191021549 X:55866268-55866290 CACCTTGGGCACATGTTCTCAGG - Intergenic
1191088888 X:56598809-56598831 CATTGTGGGCACATGTTCTCAGG + Intergenic
1191200852 X:57779744-57779766 CACCTTGGGCACATGTTCTCAGG - Intergenic
1191624458 X:63255377-63255399 CACCTTGGGCACATGTTCTCAGG - Intergenic
1191823278 X:65336587-65336609 GAGTTTCAACATGTGTTCTCTGG + Intergenic
1192703933 X:73508694-73508716 CACATTGGGCACATGTTCTCAGG - Intergenic
1192728932 X:73782812-73782834 CACCTTGGGCACATGTTCTCAGG - Intergenic
1193708708 X:84855032-84855054 CACCTTGGGCATGTGTTCTCAGG - Intergenic
1193718295 X:84957756-84957778 CACCTTGGGCATGTGTTCTCAGG - Intergenic
1193809605 X:86036172-86036194 CACCTTGGGCACATGTTCTCAGG - Intronic
1193880343 X:86913350-86913372 CACTTTGGCCCCGTGTTCTCAGG + Intergenic
1194010789 X:88558611-88558633 CACTTTGAGCACATGTTCTCAGG + Intergenic
1194075009 X:89380412-89380434 CACCTTGGGCACATGTTCTCAGG - Intergenic
1194138877 X:90182555-90182577 CACCTTGGGCACATGTTCTCAGG + Intergenic
1194204882 X:91001340-91001362 CACCTTGGGCACATGTTCTCAGG + Intergenic
1194289215 X:92048806-92048828 CACCTTGGGCACATGTTCTCAGG - Intronic
1194292436 X:92091517-92091539 CACCTTGGGCACATGTTCTCAGG - Intronic
1194294163 X:92107778-92107800 CACCTTGGGCACATGTTCTCAGG + Intronic
1194456893 X:94115922-94115944 CACCTTGGGCACATGTTCTCAGG - Intergenic
1194480110 X:94411488-94411510 CATCTTGGGCACATGTTCTCAGG + Intergenic
1195034455 X:100959722-100959744 CAGTTTAAGACCCTGTTCTCTGG + Intergenic
1195493097 X:105496275-105496297 CACCTTGGGCACATGTTCTCAGG + Intronic
1195547006 X:106123989-106124011 CACTTTGGGCACACGTTCTCAGG - Intergenic
1196287343 X:113897968-113897990 CACCTTGGGCACATGTTCTCAGG - Intergenic
1196301950 X:114058101-114058123 CACCTTGGGCACTTGTTCTCAGG + Intergenic
1196566731 X:117215275-117215297 CATCTTGAGCACATGTTGTCAGG - Intergenic
1196763042 X:119217398-119217420 CACCTTGGGCACATGTTCTCAGG - Intergenic
1196884292 X:120228262-120228284 CACTTTGACCACATGTTGTCAGG + Intergenic
1197352514 X:125395471-125395493 CACCTTGGGCACATGTTCTCAGG - Intergenic
1197930942 X:131695695-131695717 CACCTTGAGCACATGTTCTCAGG - Intergenic
1198150192 X:133900748-133900770 CAGTTACAGCCCATGTTCTCTGG + Intronic
1198880092 X:141271786-141271808 CACTTTGGGCACATGTCCTCAGG - Intergenic
1199171495 X:144739392-144739414 CACCTGGAGCACGTGTTCTCAGG + Intergenic
1199184912 X:144904892-144904914 CACCTTGGGCACATGTTCTCAGG + Intergenic
1199260481 X:145767745-145767767 CTCTTTGGGCACATGTTCTCAGG + Intergenic
1199367446 X:147003432-147003454 CACCTTGGGCACATGTTCTCAGG + Intergenic
1200056082 X:153461999-153462021 CACCTTGTGCACATGTTCTCAGG + Intronic
1200293399 X:154893266-154893288 CACCTTGAGCACATGTTCTCAGG + Intronic
1200293502 X:154894211-154894233 CATCTTGGGCACATGTTCTCAGG + Intronic
1200484680 Y:3752788-3752810 CACCTTGGGCACATGTTCTCAGG + Intergenic
1200550709 Y:4576485-4576507 CACCTTGGGCACATGTTCTCAGG + Intergenic
1200609944 Y:5316093-5316115 CACCTTGGGCACATGTTCTCAGG - Intronic
1200730609 Y:6734582-6734604 CACCTTGGGCACATGTTCTCAGG - Intergenic
1201234567 Y:11896833-11896855 CATTTTGAACATGTGTTTTCAGG - Intergenic
1201276759 Y:12305844-12305866 CACCTTGGGCACTTGTTCTCAGG - Intergenic
1201286177 Y:12380645-12380667 CACCTTGAGTACATGTTCTCAGG - Intergenic
1201328882 Y:12797270-12797292 CACCTTGGGCACATGTTCTCAGG - Intronic
1201384689 Y:13425890-13425912 CAGTTTTTGCAAGTGTTCTTTGG - Intronic
1201725356 Y:17144368-17144390 CACCTTGGGCACATGTTCTCAGG - Intergenic
1201891735 Y:18949844-18949866 CACCTTGAGCACATATTCTCAGG - Intergenic
1202050311 Y:20774044-20774066 CACTTTGGGCACGTGTTCTCAGG + Intronic