ID: 1184724385

View in Genome Browser
Species Human (GRCh38)
Location 22:46335256-46335278
Sequence CAGACTTAAGACTGTCTAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184724385_1184724390 14 Left 1184724385 22:46335256-46335278 CCGCCTAGACAGTCTTAAGTCTG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1184724390 22:46335293-46335315 CTGGTCCGAATTCCAAAGGGAGG 0: 1
1: 0
2: 2
3: 5
4: 71
1184724385_1184724387 -5 Left 1184724385 22:46335256-46335278 CCGCCTAGACAGTCTTAAGTCTG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1184724387 22:46335274-46335296 GTCTGTTTTGACGTTAATGCTGG 0: 1
1: 8
2: 114
3: 403
4: 554
1184724385_1184724393 20 Left 1184724385 22:46335256-46335278 CCGCCTAGACAGTCTTAAGTCTG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1184724393 22:46335299-46335321 CGAATTCCAAAGGGAGGAGGAGG 0: 1
1: 0
2: 6
3: 15
4: 184
1184724385_1184724391 17 Left 1184724385 22:46335256-46335278 CCGCCTAGACAGTCTTAAGTCTG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1184724391 22:46335296-46335318 GTCCGAATTCCAAAGGGAGGAGG 0: 1
1: 4
2: 63
3: 120
4: 277
1184724385_1184724389 11 Left 1184724385 22:46335256-46335278 CCGCCTAGACAGTCTTAAGTCTG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1184724389 22:46335290-46335312 ATGCTGGTCCGAATTCCAAAGGG 0: 1
1: 0
2: 0
3: 5
4: 162
1184724385_1184724394 21 Left 1184724385 22:46335256-46335278 CCGCCTAGACAGTCTTAAGTCTG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1184724394 22:46335300-46335322 GAATTCCAAAGGGAGGAGGAGGG 0: 1
1: 0
2: 1
3: 51
4: 543
1184724385_1184724388 10 Left 1184724385 22:46335256-46335278 CCGCCTAGACAGTCTTAAGTCTG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1184724388 22:46335289-46335311 AATGCTGGTCCGAATTCCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184724385 Original CRISPR CAGACTTAAGACTGTCTAGG CGG (reversed) Intronic
904285457 1:29450718-29450740 CAGACTCTAGAGTGTCCAGGGGG + Intergenic
909145226 1:71921876-71921898 CAGATTTTTGACTGTGTAGGAGG + Intronic
910912020 1:92245262-92245284 AAGACCTAAGTCTGCCTAGGGGG - Intronic
911357003 1:96834874-96834896 CACTCTTAAAACTGTCAAGGTGG - Intergenic
912361234 1:109097968-109097990 CAGACTTAGGGCTCTCTAAGTGG + Intergenic
916077106 1:161207757-161207779 CAGTCTTAAGAGTATCTGGGAGG - Intronic
916922075 1:169479257-169479279 CAGAATTAAGTCTCTCTAGATGG + Intronic
918134833 1:181662440-181662462 CAGACTCTAGACAGTCTAGCTGG + Intronic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
924423119 1:243927888-243927910 CTGAATTAAGAATGTCTAGGTGG - Intergenic
924608642 1:245556088-245556110 CAGACGTAAGACTGTCCACCTGG - Intronic
924937673 1:248785793-248785815 CAGACTGTAGAATGTCTAGGTGG - Intergenic
1066702956 10:38149270-38149292 TAGAATTAGCACTGTCTAGGAGG - Intergenic
1071251075 10:83820492-83820514 CAGATTTAAGAATCTCTAAGAGG - Intergenic
1073143390 10:101263435-101263457 CAGACCTAAGGCTGTCATGGAGG + Intergenic
1073422303 10:103434318-103434340 CAGACATAAGAGGGTCTTGGAGG - Exonic
1077907518 11:6545793-6545815 TAGTCTTAAGACTCTGTAGGGGG - Exonic
1078384074 11:10872202-10872224 CTGACTTAAGCCTGTCTTGTAGG + Intergenic
1081717269 11:45259259-45259281 CAGAACTAAGACTGTTTGGGTGG + Intronic
1083085287 11:60136457-60136479 AAGACTTAAGACTGGCTGGCAGG + Intergenic
1087292753 11:96338424-96338446 CAGAATTAAAACTGGCTTGGAGG + Intronic
1087464338 11:98486023-98486045 CAGACTTAAGACTGTACTGTCGG + Intergenic
1088781619 11:113140251-113140273 CAGAGTTAAGATTATCTTGGAGG + Intronic
1088867785 11:113865142-113865164 AAGACTTAATACTGTGAAGGTGG + Intronic
1089702591 11:120254533-120254555 CACTCCTAGGACTGTCTAGGAGG + Intronic
1093816877 12:23559628-23559650 CAGAATTAAGACCTTCTAGCTGG + Intronic
1097842278 12:64333149-64333171 CAGATTACAGAATGTCTAGGAGG + Intronic
1098042853 12:66369779-66369801 CAGACTTAGGACTGAATATGTGG + Intronic
1099073803 12:78080091-78080113 CAGGTTTAAGAATGTCTAGATGG - Intronic
1100531599 12:95466555-95466577 CAGACTAAAGAGTGTTGAGGAGG - Intergenic
1104634273 12:130427857-130427879 GAGACTTAAGGCTGTGGAGGGGG + Intronic
1106317478 13:28607482-28607504 CAGACTTAAACCTGTATATGAGG - Intergenic
1107437689 13:40394703-40394725 CAGACTTAAGAAGGTCTCTGAGG + Intergenic
1108411576 13:50153796-50153818 CAGACTGAAAACTGTCTTGTAGG + Intronic
1109744723 13:66609647-66609669 CAGAATTAAGGCAGTTTAGGTGG - Intronic
1110375113 13:74784479-74784501 CAGAATTCAGACTGGATAGGTGG - Intergenic
1116368363 14:44098552-44098574 CAGAATTAATATTGTCTAGATGG - Intergenic
1119741677 14:77017818-77017840 CAGCTTTAGGCCTGTCTAGGAGG - Intergenic
1120864930 14:89287553-89287575 GAGAGTTAAGGATGTCTAGGAGG - Intronic
1122999480 14:105285059-105285081 AAGACTTTACACTGTTTAGGCGG + Intronic
1128101514 15:65004311-65004333 CATACTTAAGAGTGTTTAGCCGG - Intronic
1131167742 15:90154682-90154704 CAGACTTCAGACTGTACCGGGGG - Intergenic
1134303302 16:13010440-13010462 TAGACTTAACACTGTCTCTGAGG + Intronic
1137993877 16:53187068-53187090 CAGAGTTAATAATGACTAGGTGG + Intronic
1139319611 16:66103203-66103225 AAGAATGAAGACTGTGTAGGGGG + Intergenic
1140499636 16:75422693-75422715 CAGTTTTAAGACTCTCTAAGAGG - Intronic
1150098009 17:62395871-62395893 CACACTTAAGTCTCTCTAGGTGG - Intronic
1153797475 18:8637651-8637673 CAGATTTCTGACTGTTTAGGGGG - Intronic
1156899224 18:42281364-42281386 CAGACTTTAAACTGTTTTGGAGG + Intergenic
1160441965 18:78899890-78899912 GAGAATTGAGACTGTCTGGGTGG - Intergenic
1161263245 19:3349388-3349410 CAGACTTAACACTGGCTGTGTGG + Intergenic
1166968844 19:46548514-46548536 CTGACTTAAGACAGTCCAGAGGG + Intronic
927094787 2:19739318-19739340 CAGACTTAGGGCTGTTTTGGAGG + Intergenic
930610270 2:53534824-53534846 CAGATTTTAGACTGTGCAGGGGG + Intronic
933646229 2:84814810-84814832 GAGACTTCAGACTGTCTAACTGG + Intronic
933839567 2:86275598-86275620 CAGATTTCAGATTGGCTAGGTGG - Intronic
936978281 2:118240721-118240743 CTGACTTTAGAATGTCAAGGAGG + Intergenic
939956509 2:148531902-148531924 CTGCCTTAAGCCTGTCTGGGAGG - Intergenic
942408872 2:175685579-175685601 CAGAATTAAGACTGTTTTAGAGG - Intergenic
948328278 2:237144017-237144039 CAGACTTTAGAGTGTCTGGAGGG + Intergenic
948753113 2:240143858-240143880 CACACACAAGACTGTCTTGGTGG + Intronic
1169844714 20:9977196-9977218 CAGATTTTAGACTGTACAGGGGG + Intergenic
1170576617 20:17667614-17667636 CAGACCTAAGACCTTGTAGGTGG - Intronic
1170696761 20:18666129-18666151 CCTCCTTAAGACTGTCAAGGTGG - Intronic
1171341718 20:24434564-24434586 CAGACTCAAGACCATCTAAGAGG + Intergenic
1172960044 20:38792449-38792471 CAGACCTAAGACTGTGTAAGTGG - Intergenic
1175708582 20:61201359-61201381 CAGACTACAGTCTCTCTAGGTGG - Intergenic
1176163478 20:63660689-63660711 CAGACTTAGGAGTGCCTTGGGGG + Intronic
1177195618 21:17901043-17901065 CAGACTCAAGGCTGTTTGGGGGG - Intergenic
1179075732 21:38119621-38119643 CAGTCATAAGAATGTCTATGTGG + Intronic
1184658384 22:45953400-45953422 CAGACTTGACACTGTCCTGGAGG - Intronic
1184724385 22:46335256-46335278 CAGACTTAAGACTGTCTAGGCGG - Intronic
953510730 3:43535572-43535594 CTTCCTTAAGAATGTCTAGGAGG - Intronic
954992255 3:54851629-54851651 TAGACTTAACACTGTCCAGTAGG + Intronic
960078314 3:113513893-113513915 CAGAGTTAAGAGTTTCTAAGAGG + Intronic
962626280 3:137228942-137228964 AATATTGAAGACTGTCTAGGTGG + Intergenic
962980945 3:140489520-140489542 CATACAGAAGACTGTCTGGGAGG + Intronic
971187598 4:24395527-24395549 CAGACTTATTAATGTCCAGGAGG - Intergenic
977279975 4:95027624-95027646 CAAACTGAAGACTGCCTATGTGG - Intronic
980581332 4:134756664-134756686 CAGACTGATCACTTTCTAGGGGG + Intergenic
981489286 4:145322604-145322626 TAGACACAAGACTGTGTAGGGGG + Intergenic
984424845 4:179570346-179570368 CAGACTTTTGGCTGTGTAGGTGG - Intergenic
991552391 5:67854606-67854628 AAGACTCAAGACTGTTTAGATGG + Intergenic
993922056 5:93817371-93817393 AAGACTTAAGATTGTCAAGATGG + Intronic
994638431 5:102373741-102373763 CAGAATTAACACAGTCTATGAGG - Intronic
1004169833 6:13287344-13287366 CTGACTGAAGACTGTCTGGCAGG + Exonic
1013452707 6:110300716-110300738 CTGTATTAAGAATGTCTAGGTGG - Intronic
1024977943 7:55131017-55131039 CAGACTCAAGTCTGACTAAGGGG + Intronic
1031962841 7:128005391-128005413 CAGATGAAAGACTGTCTGGGCGG - Intronic
1034493688 7:151407954-151407976 CAAACATAAGACTGTCTTGGGGG - Intronic
1035561909 8:611328-611350 CAGACTTAAGAGTGACTATATGG + Intergenic
1038122316 8:24631287-24631309 CAGACCTAGGACTGTGGAGGAGG - Intergenic
1038138319 8:24814708-24814730 CAGATTTATGACTGTGCAGGGGG + Intergenic
1046794975 8:118361153-118361175 CAGACTTGAGATTGTATAGTGGG - Intronic
1047265454 8:123303311-123303333 AAGACTTAATACTGTCAATGAGG - Intergenic
1050658525 9:7856574-7856596 AACACTTAACAATGTCTAGGAGG - Intronic
1051180975 9:14411763-14411785 CAGCCTTAATACAGTGTAGGAGG - Intergenic
1051326457 9:15976051-15976073 CAGACTTAAGGCTTTCAGGGCGG + Intronic
1188448989 X:30289317-30289339 CAGACTCAAGACTGTCTTCCAGG + Intergenic
1190659043 X:52638041-52638063 CACACTTAACACTGTCTGTGAGG + Intergenic
1191229671 X:58084134-58084156 CAGACTTAAGAAATTCTAAGGGG - Intergenic
1197643160 X:128988755-128988777 CAGATTTAAGACTTTTTTGGTGG + Intergenic