ID: 1184726875

View in Genome Browser
Species Human (GRCh38)
Location 22:46352165-46352187
Sequence GAGCAGCACGCACCTGAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184726875_1184726878 -3 Left 1184726875 22:46352165-46352187 CCTTCTTCAGGTGCGTGCTGCTC 0: 1
1: 0
2: 2
3: 8
4: 126
Right 1184726878 22:46352185-46352207 CTCTTTGACACAAAGAGATGGGG 0: 1
1: 0
2: 1
3: 19
4: 225
1184726875_1184726880 15 Left 1184726875 22:46352165-46352187 CCTTCTTCAGGTGCGTGCTGCTC 0: 1
1: 0
2: 2
3: 8
4: 126
Right 1184726880 22:46352203-46352225 TGGGGCTGCGTGTCTGCCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 216
1184726875_1184726876 -5 Left 1184726875 22:46352165-46352187 CCTTCTTCAGGTGCGTGCTGCTC 0: 1
1: 0
2: 2
3: 8
4: 126
Right 1184726876 22:46352183-46352205 TGCTCTTTGACACAAAGAGATGG 0: 1
1: 0
2: 2
3: 18
4: 217
1184726875_1184726879 14 Left 1184726875 22:46352165-46352187 CCTTCTTCAGGTGCGTGCTGCTC 0: 1
1: 0
2: 2
3: 8
4: 126
Right 1184726879 22:46352202-46352224 ATGGGGCTGCGTGTCTGCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 207
1184726875_1184726877 -4 Left 1184726875 22:46352165-46352187 CCTTCTTCAGGTGCGTGCTGCTC 0: 1
1: 0
2: 2
3: 8
4: 126
Right 1184726877 22:46352184-46352206 GCTCTTTGACACAAAGAGATGGG 0: 1
1: 0
2: 1
3: 15
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184726875 Original CRISPR GAGCAGCACGCACCTGAAGA AGG (reversed) Exonic
901919842 1:12528158-12528180 GAGCAGCGGGCATCTGAGGAAGG + Intergenic
904058387 1:27687076-27687098 GAACACCACGGACCTGCAGAAGG - Intergenic
917689324 1:177451105-177451127 GAGTAGCACATCCCTGAAGAAGG + Intergenic
921045059 1:211470296-211470318 GACCGGCTCGCATCTGAAGATGG + Intergenic
1062935748 10:1386037-1386059 GAGCAGCACACACCTTGGGATGG + Intronic
1065335013 10:24648183-24648205 CAGCAGCACGAACCTAATGAAGG - Intronic
1066602658 10:37125193-37125215 GTGCAGCTCCCACCTGAACATGG + Intergenic
1068715483 10:60183080-60183102 GAGCAGCAGGCACCTAGACATGG - Intronic
1069204228 10:65661680-65661702 GAGCAGCAAGCAGCTGAACCTGG + Intergenic
1071456966 10:85858318-85858340 GTGCTGCAGGCCCCTGAAGAAGG - Intronic
1072719473 10:97771841-97771863 GCGCGGCGCGCACCTGGAGAGGG - Exonic
1073540719 10:104314746-104314768 CAGCAGCTACCACCTGAAGACGG - Exonic
1075225315 10:120623943-120623965 CAGCAGCACGCAGCTGGGGAGGG - Intergenic
1076016451 10:127031326-127031348 GAGCAGCATGGTCTTGAAGAAGG - Intronic
1076055983 10:127373222-127373244 GACCAGCAGGCACCTCAAGAAGG - Intronic
1076317705 10:129554196-129554218 GAGCAGCACGCAGGTGATGACGG + Intronic
1076890273 10:133280000-133280022 GCCCAGCACGCACCCGCAGAAGG - Intronic
1077408590 11:2393346-2393368 GGGCAGCATGCACCTGGGGAGGG - Intronic
1083832724 11:65243199-65243221 TAGTGGCACACACCTGAAGAAGG - Intergenic
1085346327 11:75770339-75770361 GAGCAGCACCCACACCAAGAGGG - Intronic
1088303995 11:108388950-108388972 TTGCAGTACGCATCTGAAGATGG + Intronic
1089534118 11:119150061-119150083 GCTGACCACGCACCTGAAGAAGG + Exonic
1097107844 12:56635710-56635732 GTGCAGCCCCCACCTGAAGGTGG + Intronic
1105721407 13:23118811-23118833 GAGCAGCAGGCACATGAAGAGGG + Intergenic
1111138951 13:84088115-84088137 GAGAAGCAAGCGCCTCAAGAAGG + Intergenic
1113727768 13:112617979-112618001 GAGCAGCACGCATTTGGAGCAGG - Intergenic
1113849166 13:113408100-113408122 GAGCAGCAGGCTGCTGAGGATGG + Intergenic
1117181467 14:53196108-53196130 GAGCATCACGTGTCTGAAGATGG - Intergenic
1121616968 14:95319866-95319888 GAGCGGCACGCACCCGGCGAGGG + Exonic
1122357204 14:101130955-101130977 GAGCAGCAGGCACGTGGAGGGGG - Intergenic
1122637659 14:103138029-103138051 GAGCCGTGTGCACCTGAAGAGGG + Intergenic
1122987004 14:105217122-105217144 GAGCAGCACACTGCTGAGGAAGG - Intronic
1128494408 15:68185532-68185554 CAGGAACACGCAGCTGAAGAAGG + Intronic
1128767466 15:70259920-70259942 GAGCAGCACCAACCACAAGAGGG + Intergenic
1129426744 15:75468971-75468993 GAGCAGAAGGTACCTGAAGAAGG + Exonic
1130140893 15:81225452-81225474 GAGCATCAGGGACCTGGAGATGG - Exonic
1131045080 15:89308010-89308032 TAGCAGCAAGCACATGAAGAAGG + Intronic
1131873665 15:96783492-96783514 GTGCAGGACTCTCCTGAAGAAGG + Exonic
1133742916 16:8664858-8664880 GAGCAGCCCGCACCTGAGCCAGG + Intergenic
1135085022 16:19468409-19468431 CAGCAGCAAGCACTTGATGAAGG - Intronic
1135170011 16:20175638-20175660 TAGCAGCACGCAGCTGCATAAGG + Intergenic
1138848749 16:60600071-60600093 GATCAGCACTCAACTGAATAAGG - Intergenic
1139157155 16:64457439-64457461 GATCAGAAAGTACCTGAAGAAGG + Intergenic
1139591928 16:67937763-67937785 GAGCAGCACGCAGCTGCCAAAGG + Intergenic
1140180297 16:72709726-72709748 AAGTGGCACACACCTGAAGAGGG - Intergenic
1142365387 16:89647262-89647284 GAGCACCATGGACCTGCAGAAGG - Exonic
1142904600 17:3033596-3033618 GAGCAGGAGGAACCTGAGGAAGG - Exonic
1145956506 17:28858489-28858511 GAGCACTACCCACCTGAGGAAGG + Intronic
1145965254 17:28912469-28912491 GAGCAGCACTCACCTGACGATGG + Exonic
1147721628 17:42543208-42543230 GTGCAGCATGCACCAGATGAAGG - Exonic
1150069628 17:62139958-62139980 GAGCAGGCAGCACTTGAAGAAGG + Intergenic
1150495776 17:65606943-65606965 AACCAGCACGCACCTGACCAGGG - Intronic
1151769297 17:76149353-76149375 GAGTGGCACCCACTTGAAGAGGG + Intronic
1152137058 17:78510718-78510740 GAGCAGAACGCACCTGCACTGGG + Intronic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1154228882 18:12535589-12535611 GAGCAGCACACAACTATAGAAGG + Exonic
1154475062 18:14747770-14747792 GTGCAGCTCCCACCTGAACATGG + Intronic
1156469222 18:37367097-37367119 GGCCAGCATGCACCTGAGGAGGG + Intronic
1159250058 18:65864291-65864313 AAGCCGCAAGCAGCTGAAGATGG + Intronic
1160174715 18:76583421-76583443 TGGCAGCACCCACCTGGAGATGG - Intergenic
1160412307 18:78683376-78683398 GAGCAGTAGGCACATGAGGAGGG - Intergenic
1160728496 19:629657-629679 GAGCAGGCAGCACTTGAAGAAGG + Exonic
1161532775 19:4800222-4800244 GATCAGCCCTCACCTGAAGCTGG - Exonic
1163066364 19:14799239-14799261 GAGGAACACGGACATGAAGAGGG - Exonic
1163730045 19:18943681-18943703 GAGCAGCCCCAACCTGAAGCTGG + Intergenic
1164888748 19:31805183-31805205 GAGGAGCAGGCACCTGACGTGGG + Intergenic
925090182 2:1148861-1148883 GGGCAGGAGGCACCTGCAGAGGG - Intronic
926303289 2:11618910-11618932 GAGCAACACTCACCTGAGGGGGG - Exonic
926939613 2:18120790-18120812 GAGCAGCAAGCATCAGAAAAAGG + Intronic
927916944 2:26943181-26943203 GAGGAGCAGGCACCTGAACACGG + Intronic
929055582 2:37873530-37873552 GAGCATCAGCCACCTAAAGAAGG + Intergenic
933561150 2:83887791-83887813 GAGAAGCACAGAGCTGAAGAAGG + Intergenic
934773204 2:96921152-96921174 GAGCAGCACGCACCTGCTCCGGG + Exonic
935594047 2:104866251-104866273 GAGCAGCCTGCACCTGAAACGGG + Intergenic
942744165 2:179212751-179212773 GAGGAGCACCCACCTGTACAAGG - Intronic
947666674 2:231910392-231910414 GAGTGGCAGGCACATGAAGAAGG - Intergenic
1170782022 20:19434332-19434354 GAGAAGCAGGCAGCTGAACAAGG + Intronic
1179931236 21:44572285-44572307 GAGCAGGACCCACCGGAAGTTGG + Intronic
1184359247 22:44004296-44004318 GAGCTCCCCGCAACTGAAGAAGG + Intronic
1184726875 22:46352165-46352187 GAGCAGCACGCACCTGAAGAAGG - Exonic
952924942 3:38313903-38313925 GAGAAGCAAGCACCAGATGATGG - Exonic
953245117 3:41183848-41183870 AATCAGGAAGCACCTGAAGATGG + Intergenic
953916298 3:46923094-46923116 GAGCAGCAGGCCCCTCATGAAGG - Intronic
954293496 3:49661913-49661935 GCGCAGCAAGCACCGGAAGCAGG + Exonic
955842179 3:63124360-63124382 GGGCAGGAAACACCTGAAGAAGG - Intergenic
956750298 3:72339771-72339793 GAGCAGCAGGGACAGGAAGAGGG + Intergenic
956982510 3:74654908-74654930 GAGCAGCAGGGCACTGAAGAAGG + Intergenic
959398312 3:105868842-105868864 GAACAGCTCGCTCCCGAAGAAGG + Exonic
963079247 3:141375937-141375959 GAGCAGGAGGAACCTGAAAATGG + Intronic
964060454 3:152515702-152515724 GAGAAGCAAACACCTGAAAAAGG - Intergenic
965035029 3:163426655-163426677 GAGCTGCACGGAGCTGATGAAGG - Intergenic
968149285 3:196324428-196324450 GAGCAGTAAGCACCTGCGGAGGG + Exonic
969213871 4:5708276-5708298 GAGCAGCACGCAGGTAAGGAGGG - Exonic
969540194 4:7784012-7784034 GAGCAGGTCCCACCTGAAGAAGG + Intronic
969672718 4:8598558-8598580 GAGCAGCAGGAACCCGGAGAAGG - Intronic
971471053 4:27027548-27027570 GAGCAGCTCTCACCAGCAGAAGG - Intergenic
974387322 4:61218707-61218729 AAGCAGCACCTTCCTGAAGAAGG + Intronic
975409677 4:74035756-74035778 TAGCTACACGCACCTGGAGAGGG + Intergenic
976088539 4:81430594-81430616 GAGCAGCAGGGCACTGAAGAAGG + Intronic
984397647 4:179221884-179221906 GAGAAGAAGTCACCTGAAGATGG - Intergenic
984654935 4:182307477-182307499 GAGTAGCACTCACCTGAGGAAGG + Intronic
994272614 5:97799116-97799138 GAGCTGCAAGCAGCTTAAGAGGG + Intergenic
997223209 5:132187916-132187938 GAGCATCAAGATCCTGAAGAAGG + Intergenic
997577925 5:134997151-134997173 GACCAGCCCCCACCTGGAGAAGG - Intronic
1000230616 5:159312021-159312043 CAGCAGGACTCACCTGAAGGCGG - Intergenic
1007856033 6:44858712-44858734 GAGTGACACGCACCTGGAGAAGG + Intronic
1010660554 6:78566208-78566230 CAGCAGCACAGAGCTGAAGAGGG - Intergenic
1012341503 6:98130884-98130906 GAGCAGCAACAACCAGAAGATGG + Intergenic
1012827874 6:104168635-104168657 GAGAAGCATGTAGCTGAAGAAGG + Intergenic
1014249270 6:119099153-119099175 GAGGGGCGCACACCTGAAGAGGG + Intronic
1014249358 6:119099754-119099776 GAGGGGGGCGCACCTGAAGAGGG + Intronic
1015141603 6:129940534-129940556 GAGCAGCAGGCACAAGCAGAAGG + Intergenic
1018723042 6:166588422-166588444 GAGCATCATGCACCTGAACTGGG + Intronic
1018786069 6:167108908-167108930 GAGGAGCAGGCACCTCCAGATGG - Intergenic
1019816822 7:3207143-3207165 CAGCAGCAGGCAGCTGAAGTTGG - Intergenic
1020076342 7:5261443-5261465 GAGCAGGAAGCACCAGAAGGGGG + Intergenic
1026236339 7:68530116-68530138 AGACAGCAGGCACCTGAAGAGGG - Intergenic
1029092147 7:98056830-98056852 CAGCAGCACTCACCTTCAGAAGG + Intergenic
1030979579 7:116170683-116170705 AAGCAGCAGGCACCTGGAAAGGG + Intergenic
1033367246 7:140681116-140681138 GATCAACATGCTCCTGAAGATGG + Exonic
1035519649 8:266361-266383 GGTCAGTGCGCACCTGAAGAGGG + Intergenic
1035815934 8:2540434-2540456 GAGCATGACGCCTCTGAAGAGGG - Intergenic
1036785133 8:11680761-11680783 GAGCACCTCGCATCTGGAGAGGG - Intronic
1040356601 8:46624535-46624557 GAGCAGCAGAGACCTGAAAAAGG - Intergenic
1041167058 8:55101638-55101660 GAGCCGCCAGCACCTGGAGAAGG - Intergenic
1041410359 8:57546958-57546980 GAGCAAAATGGACCTGAAGATGG + Intergenic
1042364923 8:67925023-67925045 CATCAGCAAGCACCTGAAGGAGG - Intergenic
1046097647 8:109579786-109579808 GAGCAGGACTCACCTCATGATGG + Exonic
1046872086 8:119215006-119215028 GAGCAGGAGGCACTGGAAGAAGG + Intronic
1049248797 8:141577230-141577252 AAGCAGCAACCACCTGGAGAAGG - Intergenic
1052365115 9:27603510-27603532 GAGCAGCAAGCAGCTGAACCTGG + Intergenic
1058872472 9:109214520-109214542 GAGCAGGACGGAACTGAGGATGG + Intronic
1061283920 9:129611678-129611700 GATCAGCCCACACCTGAAGCAGG - Intronic
1187322539 X:18253083-18253105 GAGCAGCAAACCCCTGAAGAAGG + Intronic
1192266376 X:69541075-69541097 GAGCACATCCCACCTGAAGAGGG - Intergenic
1193458116 X:81755549-81755571 GAGGAGCACCCACCTGATGCTGG - Intergenic
1195407392 X:104530593-104530615 GGCCAGAACGCAACTGAAGATGG - Intergenic