ID: 1184728174

View in Genome Browser
Species Human (GRCh38)
Location 22:46358094-46358116
Sequence AGCCCAGGGAGGCTCCGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184728174_1184728184 8 Left 1184728174 22:46358094-46358116 CCAGCACGGAGCCTCCCTGGGCT No data
Right 1184728184 22:46358125-46358147 CCCTGATTTATGGCTGTGGTCGG No data
1184728174_1184728182 4 Left 1184728174 22:46358094-46358116 CCAGCACGGAGCCTCCCTGGGCT No data
Right 1184728182 22:46358121-46358143 GGTTCCCTGATTTATGGCTGTGG No data
1184728174_1184728186 9 Left 1184728174 22:46358094-46358116 CCAGCACGGAGCCTCCCTGGGCT No data
Right 1184728186 22:46358126-46358148 CCTGATTTATGGCTGTGGTCGGG No data
1184728174_1184728187 21 Left 1184728174 22:46358094-46358116 CCAGCACGGAGCCTCCCTGGGCT No data
Right 1184728187 22:46358138-46358160 CTGTGGTCGGGCCTCCAGCCTGG No data
1184728174_1184728188 22 Left 1184728174 22:46358094-46358116 CCAGCACGGAGCCTCCCTGGGCT No data
Right 1184728188 22:46358139-46358161 TGTGGTCGGGCCTCCAGCCTGGG No data
1184728174_1184728181 -2 Left 1184728174 22:46358094-46358116 CCAGCACGGAGCCTCCCTGGGCT No data
Right 1184728181 22:46358115-46358137 CTCAGGGGTTCCCTGATTTATGG No data
1184728174_1184728189 30 Left 1184728174 22:46358094-46358116 CCAGCACGGAGCCTCCCTGGGCT No data
Right 1184728189 22:46358147-46358169 GGCCTCCAGCCTGGGAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184728174 Original CRISPR AGCCCAGGGAGGCTCCGTGC TGG (reversed) Intergenic
No off target data available for this crispr