ID: 1184729694

View in Genome Browser
Species Human (GRCh38)
Location 22:46365772-46365794
Sequence TTGGGAACACAGAAGGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 343}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184729694_1184729709 24 Left 1184729694 22:46365772-46365794 CCCTACCCCTTCTGTGTTCCCAA 0: 1
1: 0
2: 0
3: 22
4: 343
Right 1184729709 22:46365819-46365841 CCGAGTATGTGGGGGAAAGGTGG 0: 1
1: 0
2: 1
3: 7
4: 193
1184729694_1184729703 15 Left 1184729694 22:46365772-46365794 CCCTACCCCTTCTGTGTTCCCAA 0: 1
1: 0
2: 0
3: 22
4: 343
Right 1184729703 22:46365810-46365832 AACAGCCTCCCGAGTATGTGGGG 0: 1
1: 0
2: 0
3: 75
4: 2260
1184729694_1184729712 29 Left 1184729694 22:46365772-46365794 CCCTACCCCTTCTGTGTTCCCAA 0: 1
1: 0
2: 0
3: 22
4: 343
Right 1184729712 22:46365824-46365846 TATGTGGGGGAAAGGTGGTGGGG 0: 1
1: 0
2: 1
3: 38
4: 392
1184729694_1184729701 13 Left 1184729694 22:46365772-46365794 CCCTACCCCTTCTGTGTTCCCAA 0: 1
1: 0
2: 0
3: 22
4: 343
Right 1184729701 22:46365808-46365830 AAAACAGCCTCCCGAGTATGTGG 0: 1
1: 4
2: 11
3: 50
4: 848
1184729694_1184729711 28 Left 1184729694 22:46365772-46365794 CCCTACCCCTTCTGTGTTCCCAA 0: 1
1: 0
2: 0
3: 22
4: 343
Right 1184729711 22:46365823-46365845 GTATGTGGGGGAAAGGTGGTGGG 0: 1
1: 0
2: 1
3: 29
4: 352
1184729694_1184729704 16 Left 1184729694 22:46365772-46365794 CCCTACCCCTTCTGTGTTCCCAA 0: 1
1: 0
2: 0
3: 22
4: 343
Right 1184729704 22:46365811-46365833 ACAGCCTCCCGAGTATGTGGGGG 0: 1
1: 0
2: 1
3: 70
4: 295
1184729694_1184729713 30 Left 1184729694 22:46365772-46365794 CCCTACCCCTTCTGTGTTCCCAA 0: 1
1: 0
2: 0
3: 22
4: 343
Right 1184729713 22:46365825-46365847 ATGTGGGGGAAAGGTGGTGGGGG 0: 1
1: 2
2: 4
3: 70
4: 725
1184729694_1184729702 14 Left 1184729694 22:46365772-46365794 CCCTACCCCTTCTGTGTTCCCAA 0: 1
1: 0
2: 0
3: 22
4: 343
Right 1184729702 22:46365809-46365831 AAACAGCCTCCCGAGTATGTGGG 0: 1
1: 0
2: 4
3: 136
4: 4838
1184729694_1184729706 21 Left 1184729694 22:46365772-46365794 CCCTACCCCTTCTGTGTTCCCAA 0: 1
1: 0
2: 0
3: 22
4: 343
Right 1184729706 22:46365816-46365838 CTCCCGAGTATGTGGGGGAAAGG 0: 1
1: 0
2: 0
3: 12
4: 259
1184729694_1184729710 27 Left 1184729694 22:46365772-46365794 CCCTACCCCTTCTGTGTTCCCAA 0: 1
1: 0
2: 0
3: 22
4: 343
Right 1184729710 22:46365822-46365844 AGTATGTGGGGGAAAGGTGGTGG 0: 1
1: 0
2: 1
3: 38
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184729694 Original CRISPR TTGGGAACACAGAAGGGGTA GGG (reversed) Intronic
900711192 1:4115502-4115524 CTGGGAACACACAAGAGGCAAGG - Intergenic
901118708 1:6872162-6872184 TTGGGAGTAGAGAAGAGGTATGG - Intronic
901564758 1:10104337-10104359 TTTGGAACGCAGAAGAGGTATGG + Intronic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
904499387 1:30905407-30905429 TTGGGAAGGCAGGAGGGGTGGGG - Intronic
905484743 1:38287285-38287307 TTGTGAACAGAGAAGGGCTCTGG + Intergenic
906488944 1:46252627-46252649 TAGGGAACACAGAAGAAGAATGG + Intronic
907473075 1:54686856-54686878 TTGGGAACATAACTGGGGTAAGG - Intronic
907903587 1:58763920-58763942 TTGAGAATAGAGAAAGGGTAGGG - Intergenic
908440135 1:64145282-64145304 TATGGAACAAAGAAGGGGAAGGG + Intronic
908811276 1:67984537-67984559 TTGGGAGAAAAGAAGGGGTCAGG - Intergenic
909435963 1:75642789-75642811 TTTGGAAAACAGTGGGGGTAGGG + Intergenic
910051504 1:82979267-82979289 TAGGGAACACAGTAGGAGCAAGG - Intergenic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
912230085 1:107783303-107783325 TAGGGAACAGAGAAGGGGCCAGG + Intronic
912936250 1:114005882-114005904 TTGAGAACAGTGAAGAGGTAGGG + Intergenic
915062142 1:153195071-153195093 TTGGGGACCCAGAAGGGGACTGG - Intergenic
915715264 1:157939441-157939463 TTGGGAACTCAGAAAGGTTAGGG - Intergenic
916246834 1:162696728-162696750 TTGGGCAAACAGCAAGGGTATGG - Intronic
916618307 1:166468015-166468037 TCTGGAACACAGGAGAGGTAAGG + Intergenic
916748255 1:167701048-167701070 TTGGGAATACGGAAGTGGCAAGG - Intronic
916989760 1:170229840-170229862 TTGGAAACACCTAAAGGGTAAGG + Intergenic
916995192 1:170289264-170289286 ATGGCAATACAGAAGGGGAATGG - Intergenic
917254863 1:173103599-173103621 TGGGGAAGTCAGAAGGGGGATGG + Intergenic
917410822 1:174758452-174758474 TTGGAGACTCAGAAGGGGAAAGG - Intronic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
920836644 1:209517259-209517281 TTGGGAGCACAGGAGGAGAAAGG - Intergenic
921814613 1:219549564-219549586 TGGAGAACACAGAAGGGAAAAGG - Intergenic
922566988 1:226607454-226607476 TTAGGAACAAAGAAGGGCTTAGG + Exonic
923991279 1:239439771-239439793 TCTGGAACACAGAGAGGGTAAGG + Intronic
924450581 1:244175258-244175280 TTGGGAGCACATAAAGGGGATGG - Intergenic
924928037 1:248702581-248702603 CTGGGAGAACAGAAGGGCTATGG - Intergenic
1064682459 10:17824830-17824852 ATGGGGAAACAGAAAGGGTAGGG - Intronic
1066182346 10:32975474-32975496 ATAGGAACTCAGAAGGGGCAAGG - Intronic
1066808515 10:39291659-39291681 TTGGGAGCACAGAAGCCCTATGG - Intergenic
1067562341 10:47312670-47312692 TCGGGAACACAGCAGGGCTCTGG - Exonic
1068960941 10:62865682-62865704 TGGGGAACACATTAGGGGTGAGG - Intronic
1071936494 10:90537312-90537334 TTGGGAAGACAGACGGGTCAAGG + Intergenic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1073937221 10:108648048-108648070 TTGGGAACACAGCAGGCATAGGG - Intergenic
1074298966 10:112216000-112216022 CTGGGAACTAAGAAGGTGTAGGG + Intergenic
1075004007 10:118817682-118817704 TTGGGAACACAGAGGGCAGAAGG + Intergenic
1076258673 10:129048802-129048824 TTGGGGACACAGAACAGGGAGGG + Intergenic
1076351656 10:129819308-129819330 TTGAGAACACAGAATTGGGAAGG - Intergenic
1078292256 11:10024558-10024580 CTGAGAACAAAGAAGGGGTTTGG - Intronic
1079882423 11:25944175-25944197 TTGCCAACACAGAAGAGGCAGGG + Intergenic
1083016265 11:59457453-59457475 TTGGGGCCACAGAAGGGGAATGG - Exonic
1083228328 11:61298943-61298965 TTGAGAATACAGCAGGAGTAGGG - Intergenic
1085640841 11:78191679-78191701 CTGGGAACACCGAAGTGGCAGGG + Intronic
1085998342 11:81949762-81949784 TTGGGGACTCGGAAGGGGAAGGG - Intergenic
1086125423 11:83344291-83344313 TTGGGAACAGAGACTGGGGAGGG + Intergenic
1088438677 11:109843797-109843819 TGGGGAAGAGAGGAGGGGTATGG + Intergenic
1090082451 11:123623080-123623102 TTGGGAACACAGAAGCATCAAGG + Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092208592 12:6631890-6631912 TGGGCAACACAGGAAGGGTATGG - Intronic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094877365 12:34665864-34665886 TTGGGAGCACACAAGGCCTATGG + Intergenic
1095535435 12:43240519-43240541 TTGAGAACACAGAGGGAGTGGGG - Intergenic
1095922101 12:47542030-47542052 AGAGGAACACAGAAGGAGTATGG + Intergenic
1095999205 12:48114689-48114711 TTGGGAACACAGACTAGGGAGGG + Intronic
1096641418 12:52997480-52997502 TTGGGAGCATAGAAGAAGTAGGG - Intergenic
1100364647 12:93908654-93908676 TTGGGAACACAGAAGTGAACTGG - Intergenic
1100747196 12:97659473-97659495 GGAGGAACACAGAAGGGGCATGG - Intergenic
1100757448 12:97767055-97767077 TTGTCAACAAAGAAGGGGAAGGG + Intergenic
1101728636 12:107408464-107408486 CTGGGAAGACAGTAGGGGCAGGG + Intronic
1102195410 12:111021823-111021845 TTGGGCACACAGAGAGGGAAGGG + Intergenic
1102615770 12:114152750-114152772 AAGGGAAGACAGAAGGGCTAGGG + Intergenic
1102813190 12:115841705-115841727 GTGGGAAGAGAGAAGGGGGAAGG - Intergenic
1104150613 12:126078830-126078852 TTAGGAACAAAGAAGAGATAAGG - Intergenic
1104882262 12:132080765-132080787 TTGGGCACACAGACTGGGTGTGG - Exonic
1104882270 12:132080805-132080827 TTGGGCACACAGACTGGGTGTGG - Exonic
1104882278 12:132080845-132080867 TTGGGCACACAGACTGGGTGTGG - Exonic
1104882286 12:132080885-132080907 TTGGGCACACAGACTGGGTGTGG - Exonic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1107240198 13:38223705-38223727 TTGGGAACACAGAGAGGTAATGG + Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108018264 13:46098274-46098296 TGGGGAAAACAGAACGGGTAGGG + Intronic
1108852925 13:54757497-54757519 TTTGGAAGACAGAAGGTATATGG - Intergenic
1109483629 13:62990278-62990300 TTGGAAACTCAGAAGGGAGAGGG - Intergenic
1110412927 13:75223110-75223132 TTGGGAATGCATCAGGGGTATGG - Intergenic
1110484264 13:76019768-76019790 ATGGGGACCCAGAAGGGGCATGG + Intergenic
1110911617 13:80972713-80972735 TTTGGAACACAAAAGGTGGAAGG - Intergenic
1110957997 13:81581004-81581026 TTGGGAACAAATAAGGGAGATGG + Intergenic
1110964515 13:81676151-81676173 TGGGGAAGCCAGAAGGGGGATGG + Intergenic
1111262489 13:85760395-85760417 ATGGGGAGCCAGAAGGGGTATGG + Intergenic
1111990790 13:95114848-95114870 TTGAGAAAAAAGCAGGGGTAGGG + Intronic
1112291856 13:98150871-98150893 TTTGGCACACAGAAGGATTATGG + Intronic
1112390529 13:98979681-98979703 TTTGGAACACAGATTTGGTAGGG - Intronic
1112746637 13:102534247-102534269 TTGGATACTCAGAAGAGGTACGG - Intergenic
1114255678 14:20999568-20999590 TATGGAACAAAGATGGGGTAGGG - Intronic
1114438295 14:22726283-22726305 TGGGGAAGACAGCAGGGGCATGG + Intergenic
1115176595 14:30569179-30569201 CTGGGGAGAGAGAAGGGGTAGGG - Intronic
1120278816 14:82412912-82412934 TTGGGAAGAAAGTAGAGGTAGGG + Intergenic
1120280463 14:82431747-82431769 ATGGGAAGGCAGAAGGGGGATGG + Intergenic
1120285998 14:82502620-82502642 TGGGGAGCACAGTTGGGGTAAGG - Intergenic
1120645705 14:87071521-87071543 TGGGGAACACAGATGGAGTAGGG + Intergenic
1123037247 14:105476515-105476537 TTGGGAACACAGAATCGATTGGG - Intronic
1127470662 15:59287136-59287158 TGGGGAACTTAGAAGGGGTGGGG + Intronic
1128815377 15:70604379-70604401 TGAGGAACCCAGAAGGGGTGAGG - Intergenic
1129952130 15:79601254-79601276 TTGAAAACACAGAAGGTGTGAGG + Intergenic
1130031312 15:80317000-80317022 TTGGGAACAGAGCTGGGGTCAGG - Intergenic
1130430447 15:83842050-83842072 ATGGGAAGGCAGAAGGGGGATGG - Intronic
1131254705 15:90854441-90854463 TTGGGAAGCCAGAATGGGCACGG + Intergenic
1131430970 15:92388745-92388767 TTGGAAACTCCGAAGGGATAGGG - Intergenic
1131535389 15:93232882-93232904 GCGGGAACACTGATGGGGTAGGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1134133872 16:11667513-11667535 TGGGGCCCACAGAAGGGGTGAGG - Intergenic
1134202116 16:12207884-12207906 TTGTGACCACATAAGGGGTAGGG + Intronic
1134912024 16:18036124-18036146 CTGGGAACACTGAGGGGGAAAGG + Intergenic
1136383814 16:29910652-29910674 TTAGAAACTCAGAAGGGGTGAGG - Intronic
1136428840 16:30185700-30185722 ATGGAAACACAGAGGGGGTTGGG + Intronic
1136949161 16:34694057-34694079 ATGGGAACAAAGAAGGAGTTAGG + Intergenic
1137577553 16:49612093-49612115 TTTGGAAAACAGAAGAGGAAAGG + Intronic
1137905206 16:52314746-52314768 GTGGGACCACAAAAGGGATATGG - Intergenic
1138294687 16:55876191-55876213 TTGTGAAGACAGAAGGTCTAGGG - Intronic
1138532283 16:57640931-57640953 GTGGGAACACAGATAGGGAAGGG + Intronic
1138938956 16:61766146-61766168 TTGGAAACTCAGAAGGGGGTAGG - Intronic
1141008832 16:80377837-80377859 ATGGAAACACAGAAAGGGAAGGG + Intergenic
1143553857 17:7648858-7648880 TTGGGGACACAGCATGGGTGTGG - Intronic
1144438269 17:15260591-15260613 CTGGGAACCCAGATGGGGAAGGG + Intronic
1145302100 17:21648017-21648039 GTGGGCCCACAGAAGGGGAAGGG - Intergenic
1145328446 17:21850801-21850823 GTGGGCCCACAGAAGGGGAAAGG - Intergenic
1145348210 17:22055299-22055321 GTGGGCCCACAGAAGGGGAAGGG + Intergenic
1145415370 17:22710085-22710107 GTGGGCCCACAGAAGGGGAATGG - Intergenic
1146123625 17:30215714-30215736 CCTGGAACACAGCAGGGGTAAGG + Exonic
1146508466 17:33425657-33425679 TTGAGAAAACAGAAGGGATGGGG + Intronic
1148002355 17:44397330-44397352 TTAGAAACACAGAAGAGGGAGGG + Intronic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149285606 17:55160790-55160812 TTGGGTGCAGAGAAGGGGGAAGG - Exonic
1150457319 17:65317251-65317273 TTGGGAGCACAGAAGGGCACAGG + Intergenic
1151446556 17:74169658-74169680 TTGGGAAGTTAGAAGGGGTGGGG + Intergenic
1151667038 17:75550960-75550982 TTGGGAACAGGGAAGGGATTGGG - Intronic
1151872296 17:76844592-76844614 TGGGGAAGAGAGAAGGGGGACGG + Intergenic
1152131662 17:78480839-78480861 TTGGGAGCACAGTGGGGGCAGGG - Intronic
1153208641 18:2734007-2734029 TTGGAAACACAAGATGGGTATGG - Intronic
1153504340 18:5780293-5780315 TTGGGATCAAAGAAGGGCAAGGG + Intergenic
1155371281 18:25103741-25103763 ATGGGAAGAGAGAAGGAGTAAGG + Intronic
1157429017 18:47608184-47608206 CTGGGAACAGAGAAGGGTTCAGG + Intergenic
1159400957 18:67933605-67933627 TTGGGAAGACAATAGGGCTAGGG + Intergenic
1160239427 18:77112559-77112581 CTGGAAACAGAGAAGGGGGAGGG - Intronic
1161005187 19:1932116-1932138 TTTGAAACACAGAAGGGGCAAGG + Intergenic
1162612652 19:11768048-11768070 TTGGGAAGAAAGAAGGGACAGGG - Intronic
1162761990 19:12893859-12893881 TGGGGAACACAGAAAGCATAGGG - Intronic
1163879053 19:19901636-19901658 ATGGGGAAAAAGAAGGGGTAGGG - Intronic
1164762308 19:30737243-30737265 TTGGGAGCACAGGTGGGGGACGG + Intergenic
1165301962 19:34975846-34975868 TGGGGACCCCAGAAGGGGAAGGG - Intergenic
1166379293 19:42347063-42347085 TTTGGACCACTTAAGGGGTAGGG - Intronic
1166731075 19:45059386-45059408 TGGGGCCCACAGAATGGGTAGGG - Intronic
1167115964 19:47489225-47489247 CTGGGAACAGAGAAAGGGAAGGG + Intronic
1167846847 19:52171633-52171655 TTGGGAACCCTGAAAGGGTGGGG + Intronic
1167859831 19:52273696-52273718 TGTGGACCACAGTAGGGGTAAGG - Intronic
1167943805 19:52970965-52970987 TTAAGAACACAAAAGGAGTAAGG + Intergenic
925993915 2:9276308-9276330 CTGGGAAGACAGCAGGGGGAGGG + Intronic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
928169824 2:28996074-28996096 GTGGGAACACAGGAGAGGGAGGG + Intronic
929136409 2:38627951-38627973 TTGGGAACAGTGGAGGGGGAAGG - Intergenic
929489085 2:42380623-42380645 TTGGGAAGAGAGATGGGGTCAGG + Intronic
929490606 2:42392699-42392721 ATAGGAACTCAGGAGGGGTAAGG + Intronic
930395216 2:50814375-50814397 TTGGGGAATGAGAAGGGGTAAGG - Intronic
933719834 2:85390852-85390874 TTGGGAGCACAGAAGTGCTATGG + Exonic
937219240 2:120332280-120332302 TGGGGAGCAGAGAAGGGGAACGG - Intergenic
937610196 2:123851967-123851989 CTGGGAACTCAGATGGGGAAAGG + Intergenic
940660857 2:156543585-156543607 CTGGAAACACAGAAGAGGGAAGG + Intronic
941394110 2:164953170-164953192 TAAGGAGCACAGAAGGGTTATGG + Intronic
944819772 2:203418722-203418744 TAGTCAACACTGAAGGGGTAGGG + Intronic
945353499 2:208810738-208810760 TTCAGAACAAACAAGGGGTAAGG - Intronic
945361531 2:208900765-208900787 TTGGGAACAGAGATGAGGGAGGG - Intergenic
945419257 2:209614748-209614770 TTAGTATCACAGAAGGGGGAGGG + Intronic
945762831 2:213935457-213935479 ATGGGAAGAAAGAAGGGGCAAGG - Intronic
945842489 2:214904791-214904813 TTTGGAATGCAGAAGAGGTAAGG + Intergenic
946611864 2:221467175-221467197 TTGGAATTAGAGAAGGGGTAAGG + Intronic
947650883 2:231785467-231785489 TTGGAAGCACAGAAGAGGTTGGG - Intronic
1168972270 20:1938854-1938876 TTAGGAACACACAGAGGGTAGGG + Exonic
1169531922 20:6494573-6494595 TGGGAAATACAGAAGGAGTAAGG + Intergenic
1170788896 20:19491638-19491660 TTGGGAACAGAGGAGGGGCAGGG - Intronic
1170834059 20:19868691-19868713 TTGGGGACCCAGAAAGGGGAAGG + Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171558166 20:26096764-26096786 GTGGGCCCACAGAAGGGGAAGGG + Intergenic
1172091345 20:32434994-32435016 TTGGGAGGACAGTAGGGGCAAGG - Exonic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1172999170 20:39093193-39093215 TTGGGACCCCAGAAGGGTCAGGG - Intergenic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1173502678 20:43565502-43565524 TTGGGAACAGAGAAAGTGAAGGG - Intronic
1174090645 20:48044351-48044373 CGGAGAACACAGAAGGGCTAAGG + Intergenic
1174812387 20:53658066-53658088 ATGGGAAGAAAGAAGGGGGAAGG + Intergenic
1176652833 21:9565850-9565872 GTGGGCCCACAGAAGGGGAAGGG - Intergenic
1176675441 21:9772853-9772875 TTAGGCAGACAGAAAGGGTAGGG - Intergenic
1176866007 21:14055685-14055707 TGTAGAACAGAGAAGGGGTAGGG + Intergenic
1179056357 21:37938754-37938776 TTGGGAACTCAGGAAGGGGAAGG + Intergenic
1179124741 21:38580905-38580927 TTGAGAAGAGAGGAGGGGTAGGG - Intronic
1179266960 21:39812407-39812429 TTGGCACCACTGAAGGGGTAGGG + Intergenic
1181639431 22:24188931-24188953 CTGGGACCCCAGATGGGGTAAGG + Exonic
1183947699 22:41336039-41336061 GTGGGGACACAGAAAGGGTGGGG + Intronic
1184729694 22:46365772-46365794 TTGGGAACACAGAAGGGGTAGGG - Intronic
949243659 3:1900251-1900273 ATGGGAAATAAGAAGGGGTAGGG + Intergenic
951280415 3:20742122-20742144 GTGGGAAAGCAGAGGGGGTAGGG - Intergenic
951503200 3:23413657-23413679 GTGGGAACACAGAGAAGGTAAGG - Intronic
954701645 3:52453811-52453833 TTGAGGATGCAGAAGGGGTAGGG - Intronic
955553165 3:60106680-60106702 TTGGGAAGATAGAAAGGATAGGG - Intronic
957184616 3:76925661-76925683 AAGGGAACACAGATGGGGTCAGG + Intronic
958663712 3:97106515-97106537 TGGGGAAGCCAGAAGGGGGATGG - Intronic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960180275 3:114567721-114567743 TGGTGAACACAGGAGGGATACGG - Intronic
960406056 3:117261490-117261512 TTGGGAAAAGAGAAGTTGTAAGG - Intergenic
960970246 3:123134483-123134505 TGGGTAACACAGAACGGGGAGGG - Intronic
962029695 3:131586807-131586829 AGGGAAACACAGAAGGGGTTTGG + Intronic
963521445 3:146363187-146363209 TTCGGGGCACAGAAGGGGTTAGG - Intergenic
963864341 3:150344228-150344250 TTGGGAACACAGGGGGTGAAGGG - Intergenic
965395364 3:168155160-168155182 TTCAGAGCATAGAAGGGGTATGG - Intergenic
968920245 4:3518742-3518764 TCAGGAACACAGCAGGGGCAGGG - Intronic
970576462 4:17433561-17433583 TTAGGCACTCAGAAGGGGGAAGG + Intergenic
970897418 4:21119922-21119944 TTAGAAACACAGAAGAGGAAAGG + Intronic
972427677 4:38949691-38949713 TTGGCACCAGAGAAGGGGAAGGG - Intergenic
974458630 4:62160781-62160803 TTGGGATCTCAGGAGGGATAAGG + Intergenic
975445746 4:74463366-74463388 ATGAGAACAGAGAAGTGGTAGGG + Intergenic
975731771 4:77344350-77344372 TAGGCAAGAAAGAAGGGGTAAGG + Intronic
976023130 4:80655458-80655480 ATGGGTACACAGAATTGGTATGG + Intronic
976171927 4:82313263-82313285 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
977247903 4:94655607-94655629 TTGGGAACAAAGAAGTGGAATGG + Intronic
977627250 4:99200743-99200765 TGGGGCACAGAGAAGTGGTAAGG + Intergenic
978414784 4:108463778-108463800 ATGGGGAGCCAGAAGGGGTATGG - Intergenic
978598251 4:110401789-110401811 GTGGGAACAGAGGTGGGGTAGGG + Intronic
978959849 4:114663289-114663311 TTATGAACACAGAATGGGTCAGG + Intronic
978985473 4:115006832-115006854 TTGGGAACACTTAATGGTTATGG + Intronic
979572491 4:122244621-122244643 TTGGGAAGAGAAAAGGGGTTCGG + Intronic
980424763 4:132613670-132613692 TTAGAAACACAGAGGGGGAAAGG + Intergenic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
982033502 4:151324592-151324614 TTGGGTACACAAAAGCGGCACGG - Intronic
982102878 4:151985518-151985540 TTGTGAACAAAGAAGAGGAATGG + Intergenic
982131242 4:152230533-152230555 CTGGGAATCCAGAAGGGCTATGG + Intergenic
982396833 4:154923057-154923079 TTGGGAACAGAGAATAGGGAGGG + Intergenic
982765029 4:159336328-159336350 TTGGAGACTCAGAAGGGGAAGGG - Intronic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
985042839 4:185909366-185909388 TTGGAGACTCAGAAGGGCTAGGG + Intronic
985057513 4:186048402-186048424 TTGGGAACAGAGACTGGGGAGGG + Intergenic
987670704 5:21003753-21003775 TTGAGATCACAGATTGGGTAGGG - Intergenic
989607539 5:43258928-43258950 TTGGAGACTTAGAAGGGGTAGGG - Intronic
989838247 5:46023531-46023553 TTGGGAGCACAGGAGGCATATGG + Intergenic
990468226 5:56089127-56089149 CTGGGAACACAGGAGGAGAAAGG - Intergenic
990622221 5:57571852-57571874 TTTGGAAAACAGAAGGAATATGG + Intergenic
994278949 5:97876735-97876757 TTGAGAACAGAGAAGGAGTCAGG + Intergenic
994295030 5:98080579-98080601 TTGGGAACAGAGATGAGGGAGGG - Intergenic
995766236 5:115622814-115622836 TTAGGAACATAGAACGAGTAAGG - Intronic
996215056 5:120856195-120856217 TAGGGAAGCCAGAAGGGGGATGG - Intergenic
996525491 5:124474672-124474694 TTGTGGAAACAGAGGGGGTATGG - Intergenic
996826745 5:127691179-127691201 TTGGAATAATAGAAGGGGTATGG - Intergenic
997865650 5:137460427-137460449 TAGGGAACACAGAAGAGCCAAGG + Intronic
998230247 5:140357183-140357205 TTGGGGCCACAGAAAGGGCAAGG + Intergenic
998664071 5:144275692-144275714 TTGGGAACACTGAACGGCGAGGG + Intronic
999368231 5:151036844-151036866 TTGGGAGCCCAGAAGGAGCAGGG - Exonic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999965347 5:156803528-156803550 TTGGGAAACCAGAATGGGGAGGG + Intergenic
1001033130 5:168277276-168277298 TTGTGAACTCTGAAGGGTTATGG - Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001260860 5:170227389-170227411 ATGGAAACACAGAAGGGGCTGGG + Intergenic
1001760882 5:174207150-174207172 TTGGAAACTCAAAAGGGGGAGGG + Intronic
1003412573 6:5878504-5878526 TTTGCAATACAGAATGGGTAGGG - Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1005614436 6:27559104-27559126 TTTGGAAAACAGGAGGGGAAGGG + Intergenic
1006045047 6:31288045-31288067 ATTGGAACACAGCTGGGGTAAGG + Intronic
1006949283 6:37808311-37808333 GTGGGATCACTGAAGTGGTAAGG - Intergenic
1007430978 6:41776888-41776910 TTGGGAACACAGGAGAGGAGAGG + Intronic
1008241853 6:49123415-49123437 TTGGAAAGACAGAAGGTGTCTGG - Intergenic
1008248728 6:49210716-49210738 TTGAGAGCACAGAAGGGAGATGG - Intergenic
1009624394 6:66120542-66120564 TTGGAAACTCAGAAGGGGATAGG - Intergenic
1009671934 6:66765168-66765190 TTGGGAAGAGAGAAGAGGAAGGG - Intergenic
1010088778 6:71953433-71953455 TTGGTAACAAAGAAGTGGGACGG + Intronic
1010491001 6:76476570-76476592 TTGGGCTTTCAGAAGGGGTATGG - Intergenic
1011449823 6:87480875-87480897 TTTGTACCACAGAAGGGGGATGG - Intronic
1013127787 6:107201905-107201927 GGGGGAAAACAGAAGTGGTAAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014459378 6:121677543-121677565 TGGGGAAAAGAGAAGGCGTATGG + Intergenic
1015567931 6:134593120-134593142 TTGGGGACACAGGAAGGGTAGGG - Intergenic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015729616 6:136334745-136334767 TTGGGAAGCCAGAAGGGAGATGG - Intergenic
1016211753 6:141544458-141544480 TGGGGAAAACAGGAGGGGCAGGG + Intergenic
1018403748 6:163454650-163454672 TTGAGAAAAAGGAAGGGGTAAGG - Intronic
1019368448 7:647402-647424 TTGGGATCATAGAGGGGGCATGG - Intronic
1019372846 7:672059-672081 CTGGGAACACAGTGGGGGTAGGG - Intronic
1020152597 7:5695046-5695068 ATGGGGACACAGATGGGTTAGGG + Intronic
1021781230 7:24108732-24108754 TTGAGAGCAGAGTAGGGGTATGG + Intergenic
1022692015 7:32665423-32665445 TGGGGAAGACAGATGGGGCAAGG + Intergenic
1022768559 7:33443759-33443781 ATGGTCACACAGAAGGGGTCTGG - Intronic
1022919684 7:34999976-34999998 TGGGGAAGACAGATGGGGCAAGG + Intronic
1023660376 7:42465593-42465615 TTAGGGACACAGAAGGGATGTGG + Intergenic
1024030891 7:45458652-45458674 GTGGGAGCCCAGGAGGGGTAGGG + Intergenic
1024639997 7:51320707-51320729 TTAGGAGCAAAGAAGGGGGATGG - Intergenic
1025279179 7:57614562-57614584 GTGGGCCCACAGAAGGGGAAGGG - Intergenic
1025305552 7:57850938-57850960 GTGGGCCCACAGAAGGGGAAGGG + Intergenic
1025980788 7:66403811-66403833 TGGGGAACACAGAAGCGTTGAGG + Intronic
1026221810 7:68404979-68405001 TTGGGAACACTGGACTGGTAAGG - Intergenic
1027228489 7:76259620-76259642 GTGAGAACTCAGAAGGGGTGCGG + Intronic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027453072 7:78354922-78354944 CTGGGAAGATAGAAGAGGTATGG + Intronic
1027513749 7:79115234-79115256 TTGGGACCAGAGAAAGGGAAAGG + Intronic
1029289283 7:99489691-99489713 TTGTGGAAACAGAAGGGATATGG - Intronic
1029502772 7:100943896-100943918 CTGGGATCCCAGCAGGGGTATGG - Intergenic
1030727828 7:112946883-112946905 TTGGGAACACACAAAGGGGATGG - Intergenic
1030746563 7:113173039-113173061 TGGGGAAGCCAGAAGGGGAATGG - Intergenic
1030838677 7:114320362-114320384 TTAAGAACACAGAGGTGGTAGGG - Intronic
1031598192 7:123671735-123671757 GTGGGAAGACAGGAGGGATAGGG - Intergenic
1032738094 7:134711185-134711207 TTGGGAGGACAGGTGGGGTAAGG + Intergenic
1033176371 7:139127587-139127609 GTGGGCACACATAAGGGGTTGGG + Intergenic
1035138284 7:156729767-156729789 TTGGGAAAATAGAAGGGGGCTGG - Intronic
1035717767 8:1766897-1766919 CAGGCAGCACAGAAGGGGTATGG - Intronic
1037577107 8:20217400-20217422 TGGGGAAGAGAGAAGTGGTAAGG - Intronic
1037993179 8:23335191-23335213 ATGGGAACCCAGATGGGGTGAGG - Intronic
1038813238 8:30873530-30873552 TTGGGAATACTGGAGGGGTGGGG + Intronic
1041167493 8:55103525-55103547 GTGGGAAGACAGAAGGGATGAGG - Intronic
1041265455 8:56060038-56060060 TTGGGAACGCAGAGGGGTTAGGG - Intergenic
1041277492 8:56177884-56177906 CTGGGGACACAGAAGCAGTACGG - Intronic
1041380746 8:57252169-57252191 GTGGGAACAAAGAGGGGGTTGGG + Intergenic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1043367596 8:79553275-79553297 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1044520832 8:93197645-93197667 TTGGAATCACAGAATGGGTATGG - Intergenic
1045436088 8:102166207-102166229 TTGGGCACACAGTGGAGGTAAGG - Intergenic
1045500818 8:102743123-102743145 TTGAGAACAAAGAAGGAGTCAGG + Intergenic
1046032557 8:108800990-108801012 TTTGGAGGACAGAAGAGGTAAGG - Intergenic
1046247525 8:111584228-111584250 TTGGGGGAACAGAAGAGGTAAGG - Intergenic
1046502606 8:115097613-115097635 TTGGAAAAACAGAAGGGCTAAGG + Intergenic
1046985686 8:120385801-120385823 TTGGCAACTCAGAAGGGTGAAGG - Intronic
1047216689 8:122881767-122881789 TTGGAAAAGCAGAAAGGGTATGG - Intronic
1048793769 8:138129425-138129447 GTGGCCCCACAGAAGGGGTATGG - Intergenic
1048952666 8:139509217-139509239 TTGAGGACACAGAAGGAATAGGG + Intergenic
1049693496 8:143972898-143972920 TAGTGAACAGAGAAGGGGTGTGG + Intronic
1050258228 9:3815367-3815389 TTGGGAACACAGACTAGGGAGGG + Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052830245 9:33209367-33209389 TGGGGAAGACAGAAGGGATATGG + Intergenic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053525064 9:38820818-38820840 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054197295 9:62045240-62045262 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054641114 9:67543442-67543464 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1055365694 9:75542353-75542375 TGGGGAAGAGAGAAGGGGTGGGG + Intergenic
1056819924 9:89832831-89832853 TTAGAAACTCAGAAGGGGAAGGG + Intergenic
1057006922 9:91568829-91568851 TTGTGAGCACAGAAGGGAGAGGG - Intronic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058711561 9:107683633-107683655 TTGGGGACAGAGAAGAGGAAGGG - Intergenic
1061803617 9:133126501-133126523 TTGGGAACACAGACCCGGTGTGG - Intronic
1062386069 9:136311991-136312013 TCGGGAGCACAGCAGGGGCATGG - Intergenic
1062412612 9:136432589-136432611 GTGGGAACAGAAATGGGGTAGGG + Intronic
1062510939 9:136905655-136905677 CTGGGAACAGAGAAAGGGAATGG - Intronic
1203630562 Un_KI270750v1:69391-69413 GTGGGCCCACAGAAGGGGAAGGG - Intergenic
1185926441 X:4152321-4152343 TTGGACACTCAGAAGGGGGAGGG - Intergenic
1186201888 X:7163350-7163372 CTGGGATCACAGAAGAGGTGTGG + Intergenic
1187556260 X:20355083-20355105 TCAGGAACAGAGAAGAGGTAAGG - Intergenic
1187586657 X:20669993-20670015 TTGGATACTCAGAAGGGGGAAGG - Intergenic
1187668397 X:21641902-21641924 GTGGGAGAACAGAAGGGGAAAGG + Intronic
1188552533 X:31379040-31379062 TTGGGAACAGAGACTGGGGAGGG - Intronic
1190969114 X:55331739-55331761 TTAGGAAGACAAAAGGGGTCAGG + Intergenic
1191673177 X:63768135-63768157 TTGGAGACTCAGAAGGGGAAGGG - Intronic
1192327276 X:70143539-70143561 TTGGGAACAGAGAAAGGAAATGG + Intronic
1192884445 X:75321994-75322016 TTGGAGACTGAGAAGGGGTAGGG - Intergenic
1193393440 X:80956569-80956591 TTGGGAACGCAGAAGGGCATTGG + Intergenic
1193405491 X:81096014-81096036 TTGGAGATGCAGAAGGGGTAAGG + Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1194873922 X:99163616-99163638 TTGGGAACAGAGACGAGGGAGGG + Intergenic
1196145204 X:112308843-112308865 GTGGAAACACAGAGGGGTTAGGG + Intergenic
1197725354 X:129772811-129772833 TTGGGACCTCAGAAGGGGCTGGG + Intergenic
1198134421 X:133733273-133733295 TTAGGGACTCAGAAGGGGGAGGG + Intronic
1198233104 X:134712263-134712285 CTGGGAAGTCAGATGGGGTATGG - Intronic
1200740412 Y:6847665-6847687 ATGGGAACAGAGAAGGAGAAGGG - Intergenic