ID: 1184730713

View in Genome Browser
Species Human (GRCh38)
Location 22:46369635-46369657
Sequence CCAAACATGCATGAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184730713_1184730719 -1 Left 1184730713 22:46369635-46369657 CCTTCCAGCTCATGCATGTTTGG 0: 1
1: 0
2: 1
3: 6
4: 143
Right 1184730719 22:46369657-46369679 GGGCACCCGGACTCCCGTGAAGG 0: 1
1: 0
2: 0
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184730713 Original CRISPR CCAAACATGCATGAGCTGGA AGG (reversed) Intronic
901114930 1:6835701-6835723 CAAAACATGCATGAGTGGTATGG - Intronic
903016485 1:20365369-20365391 CGAAACATGCATGAGCTTCTGGG + Intergenic
904629956 1:31833606-31833628 GCAGACATGCAGGGGCTGGATGG + Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
908991213 1:70092435-70092457 TCAAACATCCATGAGCAGTAAGG - Intronic
911557533 1:99363088-99363110 AAAAACACGCATGAGCTTGAAGG - Intergenic
911797551 1:102092911-102092933 CCCAACCTTGATGAGCTGGAAGG + Intergenic
912248631 1:107988186-107988208 CCTAACAGGCATGAGCTTTAGGG - Intergenic
915230364 1:154441429-154441451 CCACACATGCATAGGGTGGAGGG - Intronic
917571055 1:176265878-176265900 GCAAAGAGGCAGGAGCTGGAGGG + Intergenic
918719826 1:187838969-187838991 GCAAACAGGCAGGGGCTGGAGGG + Intergenic
919898186 1:202022935-202022957 ACAAACATGCCTGGGGTGGAGGG + Intergenic
923619657 1:235568066-235568088 CCAAAAAGGCAGGGGCTGGAAGG - Intronic
1064777538 10:18795726-18795748 GCAAACATGCTTTAGATGGATGG - Intergenic
1067143913 10:43679846-43679868 CCAAACAGGCATGAGGAGAAAGG - Intergenic
1067901263 10:50244087-50244109 GCAAAGAAGCAGGAGCTGGAGGG + Intronic
1069915849 10:71786276-71786298 CCACAGATTCATGGGCTGGAAGG - Intronic
1070889449 10:79931077-79931099 CCAACCATGGCTGAGATGGAGGG + Intergenic
1070963972 10:80518292-80518314 GCAGACATGCTTGAGCTGCAGGG - Exonic
1070992699 10:80746377-80746399 CCAACCAGGCATGAGCTGTATGG + Intergenic
1073290516 10:102410991-102411013 CCAGACATGCAGGACCTGGGAGG - Intronic
1078095752 11:8295862-8295884 CCCAACATGCAAGTGCTGCAAGG + Intergenic
1078452565 11:11451200-11451222 ACAAGCATGCATGATCTTGAAGG + Intronic
1079656704 11:22994255-22994277 CCAACGAGGCATGAGCTGTATGG - Intergenic
1082595507 11:55075352-55075374 CCAAACATCCATTTGCTGAAAGG - Intergenic
1083249194 11:61454429-61454451 CCAATCATCCATGAGCAGGAGGG + Intronic
1087946471 11:104165545-104165567 CCAGACTTTCAGGAGCTGGAAGG - Intergenic
1090336880 11:125974859-125974881 TCAAACATGGATGATCTGGGTGG - Intronic
1090755895 11:129791530-129791552 CCCAACATGGATGAACTTGAAGG + Intergenic
1091083175 11:132692355-132692377 CTATAGATGCATGAGCTGCATGG - Intronic
1091119340 11:133043648-133043670 CAAAAAATGCATGAGGAGGAAGG - Intronic
1091211990 11:133869727-133869749 CCAAACATGTATAAGCGGCAAGG + Intergenic
1091642114 12:2245317-2245339 GCAAGCATGCATGTGCTGAAGGG - Intronic
1096314864 12:50555734-50555756 CCAAACAAGCATGGGGTGAAAGG - Intronic
1097956389 12:65490174-65490196 AACAACATGCATGAACTGGAGGG + Intergenic
1098538860 12:71628629-71628651 CCAAACATACATTAGTTGGTGGG - Intronic
1099373451 12:81866332-81866354 CCAAGGATGTATGAGCTGGCAGG - Intergenic
1100700403 12:97141368-97141390 TCAAACATGAATGAGCTTTAGGG + Intergenic
1102220709 12:111192498-111192520 GGAAAAAGGCATGAGCTGGAAGG - Intronic
1103721334 12:122977076-122977098 CCAAACCAGCAGGAGCTGGAAGG + Intronic
1104105285 12:125653142-125653164 CAAAACATGCACTGGCTGGAAGG - Intronic
1104696876 12:130870987-130871009 CCAAACAAGCTTGAGCTAGAGGG - Intergenic
1106406337 13:29478003-29478025 CCAAACAGGCATAAGCTCAATGG + Intronic
1107324348 13:39224934-39224956 CTAAACATGCATTTGATGGATGG + Intergenic
1107618306 13:42196395-42196417 CCAAACATCCATCAGTTGAATGG + Intronic
1107638719 13:42419373-42419395 CCAGATAGGGATGAGCTGGAGGG - Intergenic
1108266952 13:48720416-48720438 GCAAACATGGAGGACCTGGAGGG + Intergenic
1108270946 13:48759021-48759043 CAAAAGATGCAAGAGATGGAAGG + Intergenic
1109515187 13:63434994-63435016 CCACACATGTATGACATGGAAGG + Intergenic
1110926324 13:81157982-81158004 CTAAACATCCAGAAGCTGGATGG + Intergenic
1110941058 13:81349004-81349026 CCAAACATATATAAGCTGAAGGG - Intergenic
1111609119 13:90580210-90580232 CCAAATATTCATGAGCAGGGAGG - Intergenic
1113961608 13:114129412-114129434 CCTCACCTGCAAGAGCTGGAAGG + Intronic
1115031222 14:28796477-28796499 CCAAGAATTCATGAGCTGAAAGG - Intronic
1117419534 14:55530720-55530742 CCAAACATGCTTGAGCGTGCTGG - Intergenic
1118761148 14:68880874-68880896 CCAAAGATTGATCAGCTGGAGGG - Exonic
1126502975 15:49367505-49367527 CTTAAGATGCATGAGCTGGCTGG - Exonic
1127131848 15:55874273-55874295 CCAAACAAGCAGAAACTGGAGGG + Intronic
1131920166 15:97318266-97318288 CCAGACATTCAAGGGCTGGAGGG - Intergenic
1132295964 15:100734677-100734699 CAAAACATGCAGGTGCAGGATGG - Intergenic
1133822587 16:9249732-9249754 CCAAACATGCCAGATCTGTAGGG + Intergenic
1133985125 16:10662551-10662573 GCAAAGAGGCAGGAGCTGGAAGG - Intronic
1135281441 16:21156845-21156867 CCAAAAATGCCAGAGGTGGAAGG + Intronic
1135404949 16:22190975-22190997 CCAAACATGGAAGGGCGGGAAGG - Exonic
1144733846 17:17543857-17543879 CAAAAAAGGCATGAGCTGGCTGG - Intronic
1147254795 17:39175221-39175243 CGCAACAAGAATGAGCTGGAGGG - Exonic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1150217261 17:63477523-63477545 CCCAGCATGCACGAGTTGGATGG + Intergenic
1152628414 17:81398886-81398908 CGAAAGATGCATGAGGGGGATGG + Intronic
1154111126 18:11569380-11569402 CCAAAGATGCTGGAGATGGAAGG - Intergenic
1155491921 18:26408209-26408231 CCAAGAATGAATGACCTGGAAGG + Intergenic
1156261770 18:35451315-35451337 CCAAAAATGCATGAGATAGAAGG + Intronic
1157185250 18:45534765-45534787 CCAACCATGCATTAGATGAAAGG + Intronic
1159058332 18:63489512-63489534 GCAAACATTTATGAGATGGAAGG - Intronic
1160032419 18:75273985-75274007 CCACACATGCATGCGCGTGAAGG + Intronic
1161301852 19:3546514-3546536 CAAACAAGGCATGAGCTGGATGG + Intronic
1163308390 19:16496811-16496833 CTAAAGCTGGATGAGCTGGATGG - Intronic
1168395270 19:56042114-56042136 GCACACATGCATGACCAGGAAGG + Intronic
1168444708 19:56402047-56402069 GCAAAGAGGCAGGAGCTGGAAGG - Intronic
927285673 2:21354455-21354477 CCAAAGAGGCAGGGGCTGGAGGG - Intergenic
928286587 2:29995357-29995379 GCATACATGCATGAGCTGTGAGG + Intergenic
934555735 2:95286243-95286265 CAGAACATGCCTGAGCTGCAGGG - Intronic
935359956 2:102238596-102238618 CCAAACAAGCATGTGTTAGAGGG - Intronic
935411527 2:102769349-102769371 CCAAACAAAAAAGAGCTGGAGGG + Intronic
936045086 2:109181131-109181153 CCAAACACAGACGAGCTGGAAGG - Intronic
938209300 2:129453457-129453479 AGAGACATGGATGAGCTGGAAGG - Intergenic
938316805 2:130335247-130335269 CCAAACATGCATAAGGTGAGAGG + Intergenic
938411875 2:131071840-131071862 CCAAACAGGTATGTGCTGGGTGG - Exonic
939407865 2:141782366-141782388 AAAAACATGCATAAGCGGGAAGG - Intronic
939417414 2:141917329-141917351 CCAAACATGGATGTGGTGTATGG + Intronic
942164655 2:173230426-173230448 TCAAACAGGCCTGAGGTGGAAGG - Intronic
946012319 2:216575376-216575398 ACAAACATGTTTTAGCTGGAAGG + Intronic
947933249 2:233981669-233981691 AGAAACAGGCAAGAGCTGGAAGG - Intronic
1170339720 20:15310636-15310658 ACACACATGCATGAACTTGAAGG + Intronic
1174870270 20:54174626-54174648 CCAAACATGAAACAGCAGGAAGG - Intergenic
1179989865 21:44942189-44942211 ACATACATTCATGATCTGGAAGG + Intronic
1181375896 22:22457739-22457761 CCAACCAGGCATGAACTGTATGG + Intergenic
1183160136 22:36107743-36107765 CCAAACCTGCATGGTTTGGAGGG - Intergenic
1183377218 22:37472365-37472387 CCAAACATGGGGGAGCTGGGAGG - Intronic
1184361551 22:44022215-44022237 ACAAAGTTCCATGAGCTGGAGGG - Intronic
1184730713 22:46369635-46369657 CCAAACATGCATGAGCTGGAAGG - Intronic
951246683 3:20349575-20349597 CAATACATGCAGAAGCTGGATGG + Intergenic
954586525 3:51741489-51741511 CCAACCAAGCATGAACTGTATGG + Intergenic
958959532 3:100495690-100495712 CCCAACCTGCAGGACCTGGATGG - Intronic
959882245 3:111457159-111457181 ATAAACATTCATCAGCTGGATGG + Intronic
961451225 3:127003205-127003227 CCAGACATGCATGAGCAGAGAGG - Intronic
961825240 3:129595798-129595820 CCAAACAGGCATGGCCTGGAAGG + Intronic
962189531 3:133295965-133295987 ACTAACATGAAAGAGCTGGACGG + Intronic
963383535 3:144560990-144561012 CCAAACAACCCAGAGCTGGAAGG + Intergenic
969216185 4:5724161-5724183 GCAAACATGCATAAGGTGGCTGG + Intronic
969244323 4:5922683-5922705 CCATGGATGCAGGAGCTGGAGGG - Intronic
970550197 4:17172687-17172709 TCAAACACGCAAGAGCTGAAAGG - Intergenic
972656150 4:41065566-41065588 CCATACATACATGAGCTGCCTGG + Exonic
979074178 4:116251153-116251175 CCTACCAATCATGAGCTGGAAGG - Intergenic
988894675 5:35659086-35659108 CCGAACATGCATGAGCTGCACGG - Exonic
991353540 5:65745067-65745089 TCAAACATGGAAGACCTGGATGG - Intronic
996815307 5:127567353-127567375 GCAAAGATGCAGGGGCTGGAGGG - Intergenic
997367544 5:133335544-133335566 CCAACCATGCAAGGCCTGGAGGG - Intronic
998159073 5:139803030-139803052 CCAAACAGGCATTACCTGAAAGG + Intronic
1002084305 5:176762327-176762349 GCAAAGATTCAAGAGCTGGATGG + Intergenic
1003898553 6:10631749-10631771 ACACAAATGCCTGAGCTGGAAGG + Intergenic
1007847945 6:44776304-44776326 GCAGATATGCATGAGGTGGAAGG - Intergenic
1011511574 6:88107128-88107150 CCAGAAATGCTTGAACTGGAAGG + Intergenic
1012797966 6:103787882-103787904 CCAAAGATTTATGAGCTGAAAGG + Intergenic
1012863291 6:104588019-104588041 GGAAACATGCTTGAGATGGAAGG - Intergenic
1019111633 6:169721957-169721979 CCAGGCATGCCAGAGCTGGACGG + Intronic
1024878524 7:54056281-54056303 TCAAACATGCATGAGATGTGAGG - Intergenic
1028807332 7:95043606-95043628 GCAAAGATGCAGGGGCTGGAGGG - Intronic
1029065727 7:97846399-97846421 CAAAACATGGATGAGCTCAAAGG + Intergenic
1030687922 7:112505718-112505740 ACAAACATGCATGAGCTCTCAGG + Intergenic
1031498609 7:122482882-122482904 CTACACATGCATGAGCTGATGGG - Intronic
1032140514 7:129325672-129325694 CAGAACATTCATGAACTGGAGGG - Intronic
1034294383 7:149959067-149959089 GCCAACATGCATCAGGTGGATGG - Intergenic
1034811686 7:154137805-154137827 ACCAACATGCATCAGGTGGATGG + Intronic
1035112137 7:156492111-156492133 CCAAGGAGGCATGAGCGGGAAGG - Intergenic
1036584983 8:10115462-10115484 CCAAACATCGAGGTGCTGGAGGG - Intronic
1038399257 8:27270552-27270574 CCAAACATACCTAGGCTGGAGGG - Intergenic
1038711758 8:29953425-29953447 TCACATATGCATAAGCTGGAAGG - Intergenic
1039913180 8:41840857-41840879 CCTAACAGGCATGAGGTGAAAGG - Intronic
1040351632 8:46574858-46574880 CAAAACATGGATGAGCTCAAAGG + Intergenic
1041253986 8:55963200-55963222 GCAAGCATGCATGAGCTCTAGGG + Intronic
1050057440 9:1670519-1670541 CCCAACAAGCAGGAGCTTGAAGG + Intergenic
1054738136 9:68777057-68777079 ACACACCTGCATGGGCTGGAGGG + Intronic
1055920608 9:81456497-81456519 CCAAACCTATATGAGCTGAAAGG - Intergenic
1061351421 9:130068025-130068047 CCAATCATGGCTGAGCTCGATGG - Intronic
1062605696 9:137347963-137347985 GCAGCCATGGATGAGCTGGAGGG + Intronic
1188856653 X:35204603-35204625 ACAAAGATGCATCAGCAGGAAGG + Intergenic
1189280596 X:39818014-39818036 CCAAAGATGGATGAAGTGGAGGG - Intergenic
1190088469 X:47416962-47416984 GCAAAGAGGCAAGAGCTGGAGGG + Intergenic
1194848272 X:98839008-98839030 GCAAACATGCATGGGCAGGGAGG + Intergenic
1199745113 X:150767524-150767546 GCAAACATGCCTGTGGTGGAGGG - Exonic