ID: 1184734179

View in Genome Browser
Species Human (GRCh38)
Location 22:46388485-46388507
Sequence GCGGCCTTATGCAGACTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184734177_1184734179 -8 Left 1184734177 22:46388470-46388492 CCTGCCTGGTCTCTGGCGGCCTT No data
Right 1184734179 22:46388485-46388507 GCGGCCTTATGCAGACTAGAAGG No data
1184734176_1184734179 -7 Left 1184734176 22:46388469-46388491 CCCTGCCTGGTCTCTGGCGGCCT No data
Right 1184734179 22:46388485-46388507 GCGGCCTTATGCAGACTAGAAGG No data
1184734171_1184734179 6 Left 1184734171 22:46388456-46388478 CCCAGCAAGGGGACCCTGCCTGG No data
Right 1184734179 22:46388485-46388507 GCGGCCTTATGCAGACTAGAAGG No data
1184734173_1184734179 5 Left 1184734173 22:46388457-46388479 CCAGCAAGGGGACCCTGCCTGGT No data
Right 1184734179 22:46388485-46388507 GCGGCCTTATGCAGACTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184734179 Original CRISPR GCGGCCTTATGCAGACTAGA AGG Intronic