ID: 1184735776

View in Genome Browser
Species Human (GRCh38)
Location 22:46396996-46397018
Sequence GGCCATTCCCCATGTGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184735776_1184735780 16 Left 1184735776 22:46396996-46397018 CCCAGGACACATGGGGAATGGCC 0: 1
1: 0
2: 1
3: 14
4: 163
Right 1184735780 22:46397035-46397057 TTAAGCACCTCAAAACTCTGAGG No data
1184735776_1184735782 29 Left 1184735776 22:46396996-46397018 CCCAGGACACATGGGGAATGGCC 0: 1
1: 0
2: 1
3: 14
4: 163
Right 1184735782 22:46397048-46397070 AACTCTGAGGCCACCCTGAATGG 0: 1
1: 1
2: 1
3: 8
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184735776 Original CRISPR GGCCATTCCCCATGTGTCCT GGG (reversed) Intronic
900126398 1:1070729-1070751 TGCCCTGCCCCAAGTGTCCTGGG + Intergenic
901039587 1:6355919-6355941 GGCCATGCCTCCTGTGCCCTGGG + Intronic
901163756 1:7199680-7199702 GGCCAGTTCCCATGCGTCCTTGG - Intronic
901504568 1:9676463-9676485 GGCCCTTCCCCAGTTGGCCTGGG + Intronic
901577022 1:10209906-10209928 GGGCATTCCACTTGTCTCCTTGG - Intergenic
902807749 1:18871636-18871658 GGCCATTCCCCAAGTGCCACTGG - Exonic
904909813 1:33926259-33926281 AGCCACTCCCTATGTGACCTTGG - Intronic
905939002 1:41848163-41848185 GGCCATTCCTCATGGGACTTTGG - Intronic
906980699 1:50625288-50625310 GGCCATTCCTCATTTCTTCTGGG + Intronic
907458478 1:54591421-54591443 GGCCATTCCCACTGTGTTCACGG + Intronic
907460411 1:54602201-54602223 GGCCCTTACCCCTGTGGCCTTGG + Intronic
910809891 1:91225396-91225418 GGAGATGCCTCATGTGTCCTTGG + Intergenic
910877175 1:91888015-91888037 CCACAATCCCCATGTGTCCTAGG + Intronic
911161761 1:94688697-94688719 AGCCATTACCTATGTTTCCTAGG + Intergenic
912853327 1:113145763-113145785 TGCCCTTGCCCATGTGGCCTTGG - Intergenic
913396390 1:118376697-118376719 GGCCATGCCCCAGGTGTCCATGG - Intergenic
913962071 1:143347824-143347846 AGCCATTCCACATGTACCCTTGG - Intergenic
914056427 1:144173399-144173421 AGCCATTCCACATGTACCCTTGG - Intergenic
914122719 1:144792963-144792985 AGCCATTCCACATGTACCCTTGG + Intergenic
915194456 1:154179029-154179051 GGCTAATCCCCTTCTGTCCTTGG - Intronic
915533675 1:156520250-156520272 GGGTATTCACCATGTTTCCTAGG - Intergenic
917148481 1:171919046-171919068 GGCCATTCATCATTTTTCCTTGG + Intronic
917623715 1:176824693-176824715 GCTCATTCCCCAAGTGACCTTGG + Intronic
918080842 1:181206656-181206678 CGCCCTTCCTCCTGTGTCCTGGG - Intergenic
918308351 1:183267587-183267609 GGACATTCCCCCTGTGCCCTGGG + Intronic
919075425 1:192808176-192808198 GGTCATTCCTCAGGAGTCCTTGG - Intergenic
920646883 1:207810413-207810435 AGCCACTCACCATGTGTTCTTGG - Intergenic
924609378 1:245561069-245561091 GGCCAGTCACCAGGTGACCTGGG + Intronic
1063192070 10:3704968-3704990 GGCTAATCCTCATGTGTCATTGG - Intergenic
1067307599 10:45079542-45079564 GGCCTTCCCCCATGTGGCCCTGG - Intergenic
1068843935 10:61649198-61649220 GTCCTTTCCCCGTGTGTTCTTGG + Intergenic
1070504938 10:77104713-77104735 GGCCCTTGGCCATGTGACCTTGG + Intronic
1084872087 11:72105202-72105224 GCCCATTCCCCATAGGTCCCTGG + Intronic
1088194019 11:107256345-107256367 GGCGATGCCCCATGGGTCCTTGG - Intergenic
1089786456 11:120910834-120910856 GGTCCTTCCCCATGTGTCACAGG - Intronic
1090837361 11:130463011-130463033 GGCTTTTCCCCATGTGTCTGAGG - Intronic
1092992170 12:13913318-13913340 AGCCATTCCACAAGTGTCTTTGG - Intronic
1102815547 12:115862563-115862585 GGCCACTTGCCGTGTGTCCTCGG + Intergenic
1104347270 12:128011871-128011893 GCCCATTCCCCATGGGGCCAGGG - Intergenic
1104599345 12:130142027-130142049 AGCCATTTCCTGTGTGTCCTCGG + Intergenic
1105650193 13:22369147-22369169 GACCATTTCCCCTGTGTCTTTGG - Intergenic
1107501555 13:40983437-40983459 GCCAAGTCCCTATGTGTCCTGGG + Intronic
1107566512 13:41610869-41610891 GGACATTCCCCAGCTGTTCTGGG - Intronic
1111798509 13:92954197-92954219 CCACAATCCCCATGTGTCCTGGG - Intergenic
1111986359 13:95070496-95070518 GTCCCTTTCACATGTGTCCTGGG - Intronic
1113747025 13:112752375-112752397 CGCCATTCCCAAAGTCTCCTGGG + Intronic
1113922369 13:113920266-113920288 TGCCAGGCCCCATGTGTGCTGGG + Intergenic
1114930961 14:27466610-27466632 GGCCAGTCCCCATGACACCTGGG + Intergenic
1115224832 14:31091553-31091575 GGACAGTTCCCATGGGTCCTTGG + Intronic
1116183808 14:41569975-41569997 TCACAATCCCCATGTGTCCTGGG - Intergenic
1117959055 14:61145243-61145265 GGCCATTGCCTCTGAGTCCTTGG - Intergenic
1119853927 14:77885424-77885446 GGCCTTTCCTCATGTGGCCTGGG + Intronic
1120730896 14:88000113-88000135 TGCCTTTCCCCATGTGTTCTTGG + Intergenic
1120856095 14:89213731-89213753 GGCCCTTTCCCATTTGTCCTGGG + Intronic
1121047137 14:90796379-90796401 GCTCATTCCCCATATCTCCTTGG - Intronic
1121765120 14:96479433-96479455 GGCCATTCCCCCAGGTTCCTTGG + Intronic
1123922309 15:25078942-25078964 GCCCATGCCACATGTGTCCATGG - Intergenic
1125492665 15:40159839-40159861 GCCCAGTCCACATGAGTCCTGGG + Intergenic
1127323886 15:57874966-57874988 GTACATTCCACAGGTGTCCTGGG + Intergenic
1129053146 15:72798941-72798963 GGCGTTTCGCCATGTGGCCTAGG + Intergenic
1131705072 15:94984855-94984877 GGCCTTTCCCCCTGGATCCTGGG + Intergenic
1132393109 15:101453278-101453300 GGCCCTGCCCCATGTGCCCAGGG + Intronic
1132728014 16:1347124-1347146 GGCCTTTCCCCACGCTTCCTGGG + Intronic
1133434525 16:5767611-5767633 GGCAAATCCCGTTGTGTCCTTGG - Intergenic
1134386768 16:13780858-13780880 AGCCAGTCCCCATGTGTCCTGGG + Intergenic
1134566028 16:15252621-15252643 GGAGATACCCCATGTGTCATAGG - Intergenic
1134736466 16:16504077-16504099 GGAGATACCCCATGTGTCATAGG + Intergenic
1134931048 16:18208091-18208113 GGAGATACCCCATGTGTCATAGG - Intergenic
1138207835 16:55137856-55137878 GGACATTCCCCAAATATCCTTGG - Intergenic
1143297158 17:5879852-5879874 GGCTTTTCCCCGTGTTTCCTGGG + Intronic
1144162438 17:12573217-12573239 TGTTATTCCCAATGTGTCCTTGG + Intergenic
1145283956 17:21489885-21489907 GGAGATGCCTCATGTGTCCTTGG + Intergenic
1145393490 17:22475612-22475634 GGAGATGCCTCATGTGTCCTTGG - Intergenic
1146525480 17:33563763-33563785 AGTCACTCCCCATGTGGCCTTGG - Intronic
1148993860 17:51690501-51690523 CCCTATTCCCCATGTGTCATGGG + Intronic
1149879598 17:60275263-60275285 GGCGTTTCACCATGTTTCCTAGG - Intronic
1151161435 17:72168988-72169010 TGCCATTTCCCATGTTTCCATGG - Intergenic
1154073716 18:11178768-11178790 GGCAATTCCCCTTGGGCCCTTGG - Intergenic
1157280645 18:46344577-46344599 GGCCCTTCCCCAGGGGACCTTGG + Intronic
1157297413 18:46456426-46456448 GGCAGTTCCCCAGGAGTCCTAGG + Intronic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1162461246 19:10815657-10815679 GGCCAGTCCCCATGGTCCCTGGG + Intronic
1162803209 19:13122476-13122498 AGACATTCCCCAAGTGTCCCCGG - Intronic
1163201808 19:15775078-15775100 GGACATGCCCCAAGTGTCCTTGG + Intergenic
1163679847 19:18674843-18674865 CGCCATTCCCCAGCTGTCCCAGG + Intergenic
1165436852 19:35800175-35800197 GTCCATTCCCTATGGCTCCTTGG - Exonic
1168295050 19:55374224-55374246 GGCCATCCCCCATGTCCCCGAGG - Intergenic
1202695908 1_KI270712v1_random:126076-126098 AGCCATTCCACATGTACCCTTGG - Intergenic
926273478 2:11385876-11385898 AGACATTTCCCATGTGTCTTTGG - Intergenic
929263297 2:39891113-39891135 GGCCATTGCCCTGGTGTCCAAGG + Intergenic
930597013 2:53401366-53401388 GCACACTCCCCATGTGTGCTGGG - Intergenic
930888420 2:56355141-56355163 GGCCATTCCCCACGGCTCCTAGG + Intronic
933074425 2:77905503-77905525 AGCCATACCCAATATGTCCTTGG - Intergenic
934277072 2:91583124-91583146 AGCCATTCCACATGTACCCTTGG - Intergenic
934945210 2:98536256-98536278 GTCCTTTCCCCATCTGTCCCTGG - Intronic
937937980 2:127261279-127261301 AGCCATTTCCTGTGTGTCCTGGG + Exonic
941279570 2:163533381-163533403 TGCCATCAGCCATGTGTCCTTGG - Intergenic
942063070 2:172246059-172246081 TGCCATTCAACATGTGTTCTGGG - Intergenic
943649394 2:190440956-190440978 TGCCACCTCCCATGTGTCCTTGG - Intronic
945040142 2:205737185-205737207 GGGCACTCCCCATGTGTTCTGGG + Intronic
947321391 2:228923161-228923183 CCACAATCCCCATGTGTCCTGGG + Intronic
947453826 2:230234662-230234684 GGCTTTTCCCCATATGTTCTGGG + Intronic
948860784 2:240751729-240751751 GTCCATGCCCCATGTGGCCCTGG + Intronic
1169341234 20:4797947-4797969 GGCTTGTCACCATGTGTCCTGGG - Intronic
1174048710 20:47752337-47752359 TACCATTGACCATGTGTCCTTGG - Intronic
1176113832 20:63422534-63422556 GTCTCTTCCCCATGTGTCCGGGG - Intronic
1178483435 21:33000850-33000872 GGCCATTTCCTATCAGTCCTTGG + Intergenic
1181902659 22:26169243-26169265 GCCAATTCCCCTTGCGTCCTGGG - Intergenic
1182551054 22:31100880-31100902 GGGCAGTCCGCATGGGTCCTGGG - Exonic
1184735776 22:46396996-46397018 GGCCATTCCCCATGTGTCCTGGG - Intronic
951209606 3:19960490-19960512 GGCTATTCTCCATGTTTCCCAGG + Intronic
955341265 3:58127129-58127151 GGGGATTCCCCATGTTGCCTGGG - Intronic
955372927 3:58369017-58369039 GGCCATTTCACCTTTGTCCTGGG - Intronic
957921034 3:86748693-86748715 TGAAAATCCCCATGTGTCCTGGG + Intergenic
959041968 3:101432149-101432171 GGCCATACTCCTTGTGGCCTGGG + Intronic
960523000 3:118677391-118677413 GGCAGTTCCCCAGGTGACCTTGG - Intergenic
961433306 3:126898407-126898429 CTCCAGTCCCCATGTCTCCTCGG - Intronic
962421112 3:135229961-135229983 GGCCTTTCCCCATGTCTCCAGGG - Intronic
964981349 3:162685227-162685249 CCACAATCCCCATGTGTCCTGGG - Intergenic
966336319 3:178872122-178872144 GGGCTTTCCCCATGTTGCCTAGG - Intergenic
966491125 3:180529715-180529737 GGCCATCCTCCTTGTGGCCTGGG + Intergenic
966785716 3:183620957-183620979 GGTACTTCCCCATGTGGCCTTGG - Intergenic
967921628 3:194618181-194618203 GGATCTTCCCCATGTGACCTGGG - Intronic
969033682 4:4233254-4233276 AGCCATTCCACATGTACCCTTGG + Intergenic
969459674 4:7322300-7322322 GGCCATGCCCCCTCTGTCCTGGG + Intronic
977746206 4:100550413-100550435 GGCCAGTCCACATGGGTGCTTGG - Intronic
978713092 4:111809320-111809342 GGCCTTTGCCCTTGTCTCCTGGG + Intergenic
988318981 5:29668793-29668815 TGACAATCTCCATGTGTCCTGGG + Intergenic
989218181 5:38926642-38926664 CTATATTCCCCATGTGTCCTGGG - Intronic
991599198 5:68335726-68335748 TGACATGCCCAATGTGTCCTTGG + Intergenic
997356316 5:133265275-133265297 GGCCACTCTCCAAATGTCCTGGG + Intronic
997711682 5:136009687-136009709 GGCCATTCCCCATGTGGGAGCGG - Intergenic
997996201 5:138588652-138588674 GTGCATTCTCAATGTGTCCTGGG + Intergenic
998390708 5:141785395-141785417 GGCCTTTCCCCAGTGGTCCTAGG + Intergenic
999098388 5:149002179-149002201 GGCCATTCCCCATCTGACTCAGG - Intronic
999201987 5:149823171-149823193 GACAATTTGCCATGTGTCCTTGG + Intronic
1001490767 5:172153583-172153605 GGCTGTTCCCCAAGTGTCTTAGG - Intronic
1002372490 5:178766634-178766656 GGCCCTAGCCCATGTGACCTTGG + Intergenic
1002660543 5:180788420-180788442 GGCCATTCCCCAGCTGCACTTGG - Intergenic
1006931667 6:37692520-37692542 GGCCCTCCCCCATGCCTCCTGGG + Intronic
1007092110 6:39190881-39190903 GGCCCTGCCTCATGTGCCCTTGG + Exonic
1007590501 6:43017909-43017931 GGACATTCAGCCTGTGTCCTAGG + Exonic
1010790416 6:80057855-80057877 AGCCTTTCCCCATCTGTCCAGGG + Intergenic
1015873826 6:137802846-137802868 AGCCAGTCTCCCTGTGTCCTGGG + Intergenic
1016646255 6:146411919-146411941 GGCCATTTCCAATGTTTTCTTGG - Intronic
1017383983 6:153861541-153861563 GGGCAATCCCCAGGTGTCCTCGG - Intergenic
1018645515 6:165944242-165944264 GAATAATCCCCATGTGTCCTGGG - Intronic
1025974197 7:66356650-66356672 GGCCTTTCCCCCTGGTTCCTGGG - Intronic
1026567386 7:71500784-71500806 GGCCGTTCACCATGTGGCCATGG + Intronic
1027856950 7:83523646-83523668 GGCCAATCACCCTGTCTCCTTGG + Intronic
1029443466 7:100600682-100600704 GGCCATCCCCCCGGGGTCCTGGG - Exonic
1029457919 7:100680246-100680268 GGCCACTCCCCATGTCCCCAGGG + Exonic
1032110823 7:129073943-129073965 GGTCATTGCCCATGTGTTCCAGG + Intergenic
1032196148 7:129789753-129789775 TGCTATTCACCATGTGTGCTTGG - Intergenic
1032470501 7:132175011-132175033 GTCCATTGCTCATGTCTCCTAGG - Intronic
1032488790 7:132308360-132308382 GGCCATTTCCCATGTGCCTCTGG + Intronic
1033581619 7:142742270-142742292 GGCAATTCTCCAGGTGGCCTTGG - Intergenic
1036745914 8:11409491-11409513 GGCCAGCCTCCAAGTGTCCTCGG - Intronic
1037776358 8:21838428-21838450 GCCCCCTCCCCATGTGTCCAAGG - Intergenic
1039109899 8:34030273-34030295 GACAATTTCACATGTGTCCTTGG - Intergenic
1039910071 8:41819516-41819538 GGAGGTTCCCCATGTGTCCAAGG - Intronic
1042313047 8:67397441-67397463 GGCCTTTCACCGAGTGTCCTTGG + Intergenic
1047015283 8:120717667-120717689 GGCCATTTCCCATCTGTGCCAGG - Intronic
1047421117 8:124709241-124709263 AGCAATTCCCCAACTGTCCTTGG + Intronic
1049216651 8:141411412-141411434 GCCCCTCCACCATGTGTCCTGGG + Intronic
1049398300 8:142412146-142412168 GGCCCTTCCCCATGTGGCACAGG - Intergenic
1049612702 8:143562802-143562824 GGACACTCCCCACGTGTGCTGGG + Exonic
1050758083 9:9032906-9032928 GTCCCTTCCCCATGTGCACTAGG + Intronic
1050876020 9:10637545-10637567 AGCCTTTCCCCCTGTGTTCTAGG - Intergenic
1052900330 9:33788232-33788254 GGCAATTCTCCAGGTGGCCTTGG - Intronic
1053280872 9:36819178-36819200 GGCCATTCATCATGTGGCCGCGG + Intergenic
1055002296 9:71465621-71465643 GCCCATTCCCCATCAGCCCTGGG - Intergenic
1057028731 9:91757116-91757138 GGGCCTTCCCCATGTGCCCCAGG - Intronic
1187182807 X:16958891-16958913 GGCCATGCCCCATCCTTCCTAGG - Intronic
1187378299 X:18777139-18777161 ATTCATTACCCATGTGTCCTTGG - Intronic
1188500436 X:30819909-30819931 GCCCTTTCCCCATATGTCCTTGG - Intergenic
1192970761 X:76226690-76226712 GTGCATTCCACATGTGCCCTGGG - Intergenic
1195878125 X:109563539-109563561 GGAAATACCTCATGTGTCCTTGG + Intergenic
1198340622 X:135710140-135710162 TGCCATTCTCCAACTGTCCTGGG + Intergenic