ID: 1184737853

View in Genome Browser
Species Human (GRCh38)
Location 22:46409671-46409693
Sequence TGTGCCCGGGACCACCGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 66}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184737853_1184737861 13 Left 1184737853 22:46409671-46409693 CCCTCACGGTGGTCCCGGGCACA 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1184737861 22:46409707-46409729 CCTCCCAGGCCGCCGTGACCGGG 0: 1
1: 0
2: 1
3: 19
4: 164
1184737853_1184737865 16 Left 1184737853 22:46409671-46409693 CCCTCACGGTGGTCCCGGGCACA 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1184737865 22:46409710-46409732 CCCAGGCCGCCGTGACCGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 111
1184737853_1184737862 14 Left 1184737853 22:46409671-46409693 CCCTCACGGTGGTCCCGGGCACA 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1184737862 22:46409708-46409730 CTCCCAGGCCGCCGTGACCGGGG 0: 1
1: 0
2: 1
3: 10
4: 122
1184737853_1184737870 30 Left 1184737853 22:46409671-46409693 CCCTCACGGTGGTCCCGGGCACA 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1184737870 22:46409724-46409746 ACCGGGGGGATGGACGACGCCGG 0: 1
1: 0
2: 0
3: 3
4: 30
1184737853_1184737858 -1 Left 1184737853 22:46409671-46409693 CCCTCACGGTGGTCCCGGGCACA 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1184737858 22:46409693-46409715 ATCAAGGAGCAATGCCTCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 141
1184737853_1184737859 12 Left 1184737853 22:46409671-46409693 CCCTCACGGTGGTCCCGGGCACA 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1184737859 22:46409706-46409728 GCCTCCCAGGCCGCCGTGACCGG 0: 1
1: 0
2: 1
3: 7
4: 153
1184737853_1184737863 15 Left 1184737853 22:46409671-46409693 CCCTCACGGTGGTCCCGGGCACA 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1184737863 22:46409709-46409731 TCCCAGGCCGCCGTGACCGGGGG 0: 1
1: 0
2: 0
3: 10
4: 81
1184737853_1184737867 20 Left 1184737853 22:46409671-46409693 CCCTCACGGTGGTCCCGGGCACA 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1184737867 22:46409714-46409736 GGCCGCCGTGACCGGGGGGATGG 0: 1
1: 0
2: 0
3: 10
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184737853 Original CRISPR TGTGCCCGGGACCACCGTGA GGG (reversed) Intronic
901333107 1:8425528-8425550 GGTGACCGGGCCCTCCGTGAAGG + Intronic
904808437 1:33147696-33147718 TGTGCCCGGGTCCAGGGTTAGGG + Exonic
906276678 1:44521945-44521967 TGTGTCTGGGAACACAGTGAAGG + Intronic
916961819 1:169896407-169896429 TGGACCCAGGACCACAGTGAAGG + Intergenic
917642770 1:176998804-176998826 TGTGCCAGGCGGCACCGTGACGG + Intronic
923606106 1:235444481-235444503 TGAGCCCGGGATCAAGGTGATGG - Intronic
1063620565 10:7643558-7643580 TGTGCCCAGGACCAGCATGGGGG - Intronic
1067179393 10:43973410-43973432 TGTGCCCGAGCCCATCCTGAGGG + Intergenic
1076715786 10:132363068-132363090 TGAGCCCTGGACCACCGAGCTGG - Intronic
1078823413 11:14905355-14905377 TGTGCGCGGGTCCTCCGTGAGGG + Intronic
1084117533 11:67050726-67050748 TGTGCCCAGGACAGCCGTGGTGG + Exonic
1090798611 11:130156643-130156665 TGTGGCCGGGACCACTTAGAAGG - Intergenic
1098234700 12:68407280-68407302 TCTGCCCTGGCCCACCGTGGAGG + Intergenic
1099574276 12:84361680-84361702 TGCCCAGGGGACCACCGTGACGG + Intergenic
1102252626 12:111397656-111397678 TGTGCCAGGGACTACTCTGAGGG - Intergenic
1103232875 12:119346631-119346653 TGTGCCCGTGACCACAGACAAGG + Intronic
1103967369 12:124648263-124648285 TGTGCCAGGCACCAGCCTGAGGG - Intergenic
1104946621 12:132417504-132417526 TGACCCCGGGACCACTGTGTGGG - Intergenic
1113522273 13:110949419-110949441 TAGGCCCAGGCCCACCGTGACGG - Intergenic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1113936841 13:113999362-113999384 TGTGCCCGGGGTCACCGGGGTGG - Intronic
1115036080 14:28858338-28858360 GGTGCCTGGGACGACCTTGATGG + Intergenic
1122049161 14:99043382-99043404 TGTGCCAGGGACCTCCTTGGAGG - Intergenic
1122289295 14:100671266-100671288 TGTGCCCAGGGCCACTGGGATGG + Intergenic
1125736277 15:41928722-41928744 TGTGCCGAGCACCACCCTGAGGG + Intronic
1135559508 16:23465112-23465134 TGAGCCAGGCACCACCCTGAAGG - Exonic
1139952965 16:70680854-70680876 TCTCCCCAGGACCACCGTGCTGG - Exonic
1140409021 16:74730214-74730236 TGTGCCTGTGACCAGGGTGAAGG + Intronic
1142997960 17:3772306-3772328 TGAGCCCGGGAGCTCCATGAAGG + Intronic
1152838677 17:82552099-82552121 TGTGCCTTGGTCCACCGCGAGGG - Intronic
1153989625 18:10384967-10384989 TGTGCCGGGCACTACTGTGATGG - Intergenic
1156220029 18:35041684-35041706 AGCGCCGGGGACCGCCGTGAGGG + Intronic
1161284227 19:3460456-3460478 TGTCCCCGGTATCCCCGTGAAGG - Intronic
1162079438 19:8209537-8209559 GGGGCCGGGGACCGCCGTGAGGG - Intronic
1162829674 19:13276490-13276512 TGTGCCGGGGATCACAGAGAGGG - Intronic
1163178825 19:15584412-15584434 TGTGCCTGGGACCCCCATGTGGG - Intergenic
1163869108 19:19803308-19803330 TGTTCCAGGGACCACAGTAAAGG - Intronic
1164466681 19:28492930-28492952 GCTGCCCGGGACCAACCTGAGGG - Intergenic
925969759 2:9098227-9098249 TGAGCCCAGGACAACCCTGATGG + Intergenic
929940487 2:46330190-46330212 TCTGCCCCTGACCCCCGTGATGG + Intronic
931797048 2:65721369-65721391 TGTGCCTGGGACCACCATAGAGG + Intergenic
948096085 2:235334871-235334893 TATTCCAGGGCCCACCGTGAGGG - Intergenic
1178704032 21:34858204-34858226 TGTGGCCAGGACCACAGGGAAGG + Intronic
1178777014 21:35561650-35561672 TGTGCCCGGAACTCCAGTGAGGG - Intronic
1184732729 22:46379730-46379752 TGTGCCCAGGGCAACTGTGATGG + Intronic
1184737853 22:46409671-46409693 TGTGCCCGGGACCACCGTGAGGG - Intronic
964772674 3:160240318-160240340 TGAGCACGGGAGCACCGTGTGGG + Intronic
968307071 3:197657493-197657515 TGAGCCCCGGAGCTCCGTGAAGG + Intergenic
968478748 4:824960-824982 TGGGCTCGGGACCACCGCGGAGG - Intronic
970998891 4:22300450-22300472 TATTCCCGAGACCACAGTGATGG - Intergenic
979478795 4:121189942-121189964 TGTGCCCAGGAGGACCGTGCAGG + Intronic
1000039073 5:157471726-157471748 TGTGGCCGGAAGCACAGTGATGG + Exonic
1005939030 6:30547111-30547133 TGTGCCTGGGACATCTGTGAAGG - Exonic
1015433989 6:133164491-133164513 TGTGCCTGAGGCCACAGTGATGG - Intergenic
1016171540 6:141024178-141024200 TTGACCCGGGACCACCCTGAAGG + Intergenic
1017819811 6:158041175-158041197 TGTGCCCAGGGCCACCCTGCTGG + Intronic
1019771640 7:2886963-2886985 TGTGCGTGGGACCACAGTGAGGG + Intergenic
1022024164 7:26430338-26430360 CGTGCCTGGGACCACCGTGATGG - Intergenic
1024984325 7:55182327-55182349 TGTGCCAGGGACCAGAGGGAGGG + Intronic
1026108243 7:67437818-67437840 AGTGCCGAGGACCACCGGGAGGG - Intergenic
1026867629 7:73833277-73833299 TATGCCCGGGACCCCGGTGAAGG + Intergenic
1035292971 7:157851476-157851498 TGTGCCCGGAACCTCAGTGATGG - Intronic
1035934920 8:3826194-3826216 TGTGTCCAGCTCCACCGTGAAGG - Intronic
1039247133 8:35621289-35621311 TGAGCCCGGGATCACAGTGTAGG + Intronic
1045392838 8:101732290-101732312 TGAGCCCTGGATCACCATGATGG - Intronic
1045890313 8:107148230-107148252 TGTGCGCAGGAACACGGTGAGGG + Intergenic
1046567720 8:115922167-115922189 CATGCCAGGGACCACCCTGAAGG - Intergenic
1052835996 9:33250531-33250553 TGTGCCAGGCACCACCTGGAAGG + Intronic
1054801651 9:69355738-69355760 ACTGCCCCGGACCTCCGTGATGG + Intronic
1060215015 9:121733694-121733716 TGTGCCCGGGGCCACTGGGAAGG + Intronic
1062623975 9:137434754-137434776 TGTGGCCAGCACCACCCTGACGG + Exonic
1189971201 X:46420070-46420092 TGTGCCAGGGACCACGGACATGG - Intergenic
1200119988 X:153785659-153785681 TCTGCCTGAGACCCCCGTGAGGG + Exonic